Protein combination, vector and application of protein combination in construction of animal model of cerebral amyloid vascular disease

By expressing a combination of Aβ40 and ApoE4 proteins in animals, a brain amyloid angiopathy model was constructed using an adeno-associated virus vector. This solved the problems of long preparation cycles, high costs, and incomplete pathological features in existing models, providing a rapid, stable, and efficient experimental model.

CN120865373APending Publication Date: 2025-10-31CHINA PHARM UNIV +1
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202510737657.4
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-06-04
Publication Date
2025-10-31

AI Technical Summary

Technical Problem

Existing animal models of cerebral amyloid angiopathy suffer from long preparation cycles, high costs, incomplete pathological features, and ethical issues, and lack effective experimental models.

Method used

A combination of Aβ40 and ApoE4 proteins was used to express the protein in animals via an adeno-associated virus vector. A stereotactic injection into the brain was used to construct an animal model of cerebral amyloid angiopathy, and the combination of Aβ40 and ApoE4 proteins was used to form amyloid deposits in the brain.

Benefits of technology

We have developed a rapid, low-cost, stable, and reproducible animal model of cerebral amyloid angiopathy (CAA) with distinct pathological features and a high induction rate. This model is suitable for research on the pathogenesis and drug intervention of CAA.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120865373A_ABST
    Figure CN120865373A_ABST
Patent Text Reader

Abstract

The invention relates to the technical field of biology, in particular to a protein combination, a carrier and application of the protein combination to construction of a cerebral amyloid vascular disease animal model. The protein combination comprises Ab40 protein and ApoE4 protein, and the vector comprises an adeno-associated virus vector for expressing Ab40 and an adeno-associated virus vector for expressing ApoE4. According to the invention, two specific proteins Ab40 and ApoE4 are respectively introduced into an adeno-associated virus vector, the mixed adeno-associated virus is used for the first time to construct a cerebral amyloid angiopathy (CAA) animal model, specifically, secreting type Ab40 is expressed in neurons in the brain of a mouse through brain stereotactic injection, and secreting protein ApoE4 is expressed in astrocytes at the same time, so that the animal model of the cerebral amyloid angiopathy (CAA) is constructed. Deposition of Ab40 is formed in brain parenchyma and brain blood vessels, the success rate of modeling reaches 100%, and the effect is obviously better than that of the combination of amyloid protein beta and other proteins.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of biotechnology, and in particular to protein combinations, vectors, and their application in constructing animal models of cerebral amyloid angiopathy. Background Technology

[0002] Cerebral amyloid angiopathy (CAA) is caused by the deposition of amyloid-β (Aβ) protein in the walls of small blood vessels in the meninges and cortex, primarily in arterioles and capillaries, and occasionally in venules. Typical symptoms include intracerebral hemorrhage and dementia. Currently, there is no effective treatment or medication. The most common cause of CAA is the accumulation of Aβ40. CAA is usually sporadic, found in approximately 30% of non-demented elderly individuals and 80% of Alzheimer's disease (AD) patients. The prevalence is 2.3% in cases aged 65-74 years, 8.0% in cases aged 75-84 years, and 12.1% in cases over 85 years. CAA can also occur as a rare single-gene inherited disease, caused by mutations in the Aβ sequence of the human Aβ precursor protein (APP) and mutations in the genes of presenilin-1 (PS1) and presenilin-2 (PS2) involved in APP cleavage to produce Aβ. These mutations lead to the production and accumulation of Aβ40 around the blood vessel wall, which in turn damages the blood vessel wall.

[0003] Experimental animal models are the primary means of studying the pathogenesis and potential treatments for CAA. Currently, there are no cell culture or other models. Existing animal models mainly include naturally occurring models and transgenic mouse models. The former requires animals with very long lifespans (8-26 years old), resulting in a late age of CAA onset, making them extremely costly; furthermore, they lack consistent pathological characteristics, have limited access to resources, and ethical factors restrict their widespread application in CAA research. L, et al. Clin Sci (Lond). 2017 Sep 28; 131(19):2469-2488.). Transgenic mouse models such as APP-Dutch mice, Tg-SwDI mice, and APP-London mice have long experimental cycles and high costs due to transgenic preparation technology and hybridization breeding processes. The age of onset of animals is shorter than that of naturally occurring models, but a relatively long age (9-19 months) is still required, and the pathological characteristics are incomplete (Vargas-George S, et al. Brain Hemorrhages. 2022, 3(4):189-199.). Currently, there are no cases of successful modeling of CAA using adeno-associated virus (AAV) injection technology in disease model research. Studies have shown that AAV has multiple serotypes, with serotype 5 (Griffin JM, et.al. Gene Ther. 2019 May; 26(5):198-210.) and serotype 9 (Rajamani, et.al. Sci Rep. 2021 Nov; 18; 11(1):22541.) being the most infectious to astrocytes and neurons in the central nervous system, respectively. Summary of the Invention

[0004] In view of this, the present invention provides protein combinations, vectors, and their applications in constructing animal models of cerebral amyloid angiopathy. Compared with the prior art, the present invention utilizes a combination of Aβ40 and ApoE4 proteins to construct an animal model of cerebral amyloid angiopathy, which has the advantages of short cycle, low cost, high stability and reproducibility, and a survival rate of up to 100%.

[0005] This invention provides the application of protein combinations in constructing animal models of cerebral amyloid angiopathy;

[0006] The protein combination includes Aβ40 protein and ApoE4 protein.

[0007] In this invention, the Aβ40 protein and ApoE4 protein are human-derived proteins.

[0008] This invention conducted experiments on various protein combinations and found that expressing the combination of human Aβ40 protein and ApoE4 protein in animals can successfully induce an animal model of cerebral amyloid angiopathy. Compared with other protein combinations, the pathological features are more obvious and the induction rate is higher.

[0009] The present invention also provides materials for constructing animal models of cerebral amyloid angiopathy, comprising at least one of the following: (I) to (IV)

[0010] I) Nucleic acids encoding the Aβ40 protein and the ApoE4 protein;

[0011] II) Expression cassettes containing the nucleic acid described in I;

[0012] III) A vector containing the nucleic acid described in I) or the expression cassette described in II);

[0013] IV), including the host of the vector described in III).

[0014] V), including any one of I) to IV).

[0015] In some embodiments, the nucleic acid encoding the Aβ40 protein has any of the following nucleic acid sequences:

[0016] I. A nucleotide sequence as shown in SEQ ID No. 2;

[0017] II. A nucleotide sequence that has the same or similar function as the sequence shown in I, obtained by substituting, deleting, adding or modifying one or more bases in the sequence shown in I.

[0018] III. A nucleotide sequence that is at least 90% homologous to any one of the nucleotide sequences in I to II.

[0019] In some embodiments, the nucleic acid encoding the ApoE4 protein has any of the following nucleic acid sequences:

[0020] i. Nucleotide sequences as shown in SEQ ID No. 4 or SEQ ID No. 5;

[0021] ii. A nucleotide sequence that has the same or similar function as the sequence shown in i, obtained by substituting, deleting, adding or modifying one or more bases in the sequence shown in i;

[0022] iii. A nucleotide sequence that has at least 90% homology with any one of the nucleotide sequences in i to ii.

[0023] In some embodiments, the vector includes vector 1 and vector 2, which are used to express Aβ40 protein and ApoE4 protein, respectively.

[0024] The vector 1 comprises: a vector backbone, a nucleic acid encoding a signal peptide, and a nucleic acid encoding an Aβ40 protein;

[0025] The vector 2 comprises: a vector backbone and nucleic acid encoding the ApoE4 protein.

[0026] The backbone vectors of vector 1 and vector 2 are adeno-associated virus vectors.

[0027] Preferably, the promoter is selected from CAG, hSyn promoter, hALDH1L1 promoter or GfaABC1D promoter.

[0028] In this invention, the signal peptide serves to guide the rapid extracellular secretion of Aβ40 protein. IgK is preferred in this invention. In a specific embodiment of this invention, the signal peptide is IgK, and the nucleic acid sequence encoding the IgK is shown in SEQ ID NO.1.

[0029] According to literature reports, the serotype of vector 1 is AAV9, and the serotype of vector 2 is AAV5; the results show that the modeling rate of this combination is 100%.

[0030] In this invention, the vector further includes at least one of the following: a nucleic acid encoding a tag peptide, an EGFP gene, an ITR sequence, and a nucleic acid encoding a self-cleaving polypeptide. In some specific embodiments, the vector further includes a gene encoding a tag peptide, an EGFP gene, an ITR sequence, and a gene encoding a self-cleaving polypeptide.

[0031] The tag peptide is used for subsequent detection of ApoE4 expression. This invention does not impose any particular limitation on the specific type of tag peptide; any type commonly used in the art is acceptable. In some embodiments, the tag peptide includes Myc or HA. In a specific embodiment of this invention, the nucleic acid sequence encoding the HA tag peptide is shown in SEQ ID NO. 3. The nucleic acid sequence encoding the Myc tag peptide is shown in SEQ ID NO. 6.

[0032] In some embodiments, the self-cleaving polypeptide includes T2A, P2A, and E2A. T2A is preferred in this invention.

[0033] In a specific embodiment of the present invention, the backbone of the vector is an adeno-associated virus vector, and the vector includes vector 1 and vector 2; vector 1 includes: a CAG promoter, an EGFP gene, a T2A sequence, nucleic acid encoding IgK, nucleic acid encoding Aβ40, and nucleic acid encoding HA; vector 2 includes a GfaABC1D promoter, nucleic acid encoding ApoE4 protein, and nucleic acid encoding Myc.

[0034] More specifically, vector 1 comprises, from its 5' to 3' end, the following components in sequence: a CAG promoter, an EGFP gene, a T2A sequence, a nucleic acid encoding IgK, a nucleic acid encoding Aβ40, and a nucleic acid encoding HA, referred to as pAAV-CAG-EGFP-T2A-IgK-Aβ40-HA; vector 2 comprises, from its 5' to 3' end, the following components in sequence: a GfaABC1D promoter, a nucleic acid encoding ApoE4 protein, and a nucleic acid encoding Myc, referred to as pAAV-GfaABC1D-ApoE4-Myc.

[0035] This invention also provides the application of the above-mentioned biomaterials in constructing an animal model of cerebral amyloid angiopathy.

[0036] This invention also provides a method for constructing an animal model of cerebral amyloid angiopathy, wherein the biological material described in this invention is used to infect animals to obtain an animal model of cerebral amyloid angiopathy.

[0037] The infection can be transmitted via injection.

[0038] The present invention also provides the application of the animal model of cerebral amyloid angiopathy obtained by the construction method in at least one of the following aspects:

[0039] Screening of drugs for the prevention and treatment of cerebral amyloid angiopathy;

[0040] Efficacy evaluation of drugs for the prevention and treatment of cerebral amyloid angiopathy;

[0041] Quality control of drugs for the prevention and treatment of cerebral amyloid angiopathy.

[0042] Compared with the prior art, the present invention has the following beneficial effects:

[0043] 1. Modeling was performed using the adeno-associated virus (AAV) system to achieve rapid, inexpensive, and simple experimental procedures;

[0044] 2. Human Aβ40 protein peptide was expressed in neurons and human ApoE4 gene was expressed in astrocytes, respectively, in order to achieve rapid deposition of Aβ40 in brain parenchyma and cerebral blood vessels;

[0045] 3. The N-terminus of the Aβ40 peptide is fused with an IgK secretion leader peptide to enable the rapid secretion of the Aβ40 peptide into the extracellular space;

[0046] 4. The terminal fusion tags HA and Myc of Aβ40 and ApoE4 facilitate subsequent immunofluorescence detection.

[0047] This invention is the first to utilize a hybrid adeno-associated virus (Aβ) to induce the expression of secretory Aβ40 in mouse neurons via stereotactic injection into the brain, while simultaneously expressing the secretory protein ApoE4 in astrocytes. This results in the deposition of Aβ40 in the brain parenchyma and blood vessels, successfully constructing an animal model of cerebral amyloid angiopathy (CAA). The modeling method of this invention is simple, and the animal model survival rate is 100%. Compared to existing animal models (such as spontaneously occurring models and transgenic animal models), this invention provides a rapid experimental cycle (requiring only one month), low cost (less than 300 RMB per mouse), high efficiency (one researcher can complete modeling of 20 mice per day), and stable and reproducible CAA animal model, providing a reliable experimental model for research on the pathogenesis and drug intervention of CAA. Attached Figure Description

[0048] Figure 1This is a schematic diagram illustrating the construction of the CAA animal model of the present invention. Wherein, ITR: inverted repeat sequence, an essential element for viral replication; CAG: strong promoter, which can highly express related proteins in neurons; EGFP: green fluorescent protein; T2A: self-cleaving polypeptide 2A, used to cleave EGFP and Igk-Aβ40-HA proteins; IgK: secretion signal peptide; HA: tag peptide; WPRE: post-transcriptional regulatory element, enhancing viral yield; GfaABC1D: astrocyte-specific promoter; Myc: tag peptide.

[0049] Figure 2 Immunofluorescence staining of Myc and CD31 in brain tissue of CAA mice after modeling in this invention. Myc staining represents ApoE4-Myc protein, yellow. CD31: vascular endothelial cell marker, light blue. DAPI: nuclear staining, dark blue. Rectangle 1: magnified view of ApoE4 deposition in the blood vessel wall. Rectangle 2: magnified view of ApoE4 expression in astrocytes. White arrow: blood vessel wall; red arrow: astrocytes. Scale bar for the first row: 100 μm; scale bars for the second and third rows: 25 μm.

[0050] Figure 3 Immunofluorescence staining of HA and CD31 in brain tissue of CAA mice after modeling in this invention. EGFP, purple; HA staining represents Aβ40 protein, yellow; CD31: vascular endothelial cell marker, light blue; DAPI: nuclear staining, dark blue. Rectangle 1: Magnified view of Aβ40 deposition in the blood vessel wall. Rectangle 2: Magnified view of Aβ40 extracellular deposition. Scale bar for the first row: 100 μm; scale bars for the second and third rows: 50 μm. Detailed Implementation

[0051] This invention provides protein combinations, vectors, and their applications in constructing animal models of cerebral amyloid angiopathy. Those skilled in the art can refer to this document and appropriately modify the process parameters to achieve the desired results. It should be particularly noted that all similar substitutions and modifications are obvious to those skilled in the art and are considered to be included in this invention. The methods and applications of this invention have been described through preferred embodiments; those skilled in the art will clearly be able to modify or appropriately alter and combine the methods and applications described herein without departing from the content, spirit, and scope of this invention to realize and apply the technology of this invention.

[0052] One objective of this invention is to provide a vector combination for constructing an animal model of cerebral amyloid angiopathy, comprising the viral vector pAAV-CAG-EGFP-T2A-IgK-Aβ40-HA and the viral vector pAAV-GfaABC1D-ApoE4-Myc;

[0053] The viral vector pAAV-CAG-EGFP-T2A-IgK-Aβ40-HA is obtained by inserting genes encoding the secretion signal peptide IgK, Aβ40 protein, and HA tag peptide into an AAV viral vector; the viral vector pAAV-GfaABC1D-ApoE4-Myc is obtained by inserting genes encoding the ApoE4 protein and Myc tag peptide into an AAV viral vector.

[0054] In this invention, AAV viral vector refers to adeno-associated virus vector.

[0055] In a preferred embodiment of the present invention, the viral vector pAAV-CAG-EGFP-T2A-IgK-Aβ40-HA is obtained by inserting the gene (IgK-Aβ40-HA) encoding the secretion signal peptide IgK, the Aβ40 protein peptide, and the HA tag peptide into the empty vector pAAV-CAG-EGFP-T2A-MCS; the viral vector pAAV-GfaABC1D-ApoE4-Myc is obtained by inserting the gene encoding the ApoE4 protein and the Myc tag peptide into the empty vector pAAV-GfaABC1D-MCS.

[0056] In a preferred embodiment of the present invention, the serotype of the viral vector pAAV-CAG-EGFP-T2A-IgK-Aβ40-HA is AAV9; and the serotype of the viral vector pAAV-GfaABC1D-ApoE4-Myc is AAV5.

[0057] A second objective of this invention is to provide a kit for constructing an animal model of cerebral amyloid angiopathy, the kit comprising the aforementioned vector combination.

[0058] A third objective of this invention is to provide the application of the above-mentioned vector combination or the above-mentioned kit in constructing an animal model of cerebral amyloid angiopathy.

[0059] Further, the application involves injecting a mixture of viral vectors pAAV-GfaABC1D-ApoE4-Myc and pAAV-CAG-EGFP-T2A-IgK-Aβ40-HA into the cerebral cortex of mice. Preferably, the serotype of the viral vector pAAV-CAG-EGFP-T2A-IgK-Aβ40-HA is AAV9; and the serotype of the viral vector pAAV-GfaABC1D-ApoE4-Myc is AAV5.

[0060] The fourth objective of this invention is to provide a method for constructing an animal model of cerebral amyloid angiopathy, by treating mice using the above-mentioned vector combination or the above-mentioned kit.

[0061] Furthermore, the treatment is administration. More specifically, the administration method includes injection.

[0062] The fifth objective of this invention is to provide an application of the animal model of cerebral amyloid angiopathy constructed using the above-described method in the screening or efficacy evaluation of drugs for the prevention and treatment of cerebral amyloid angiopathy.

[0063] In this invention, the codons of the nucleic acid encoding the ApoE4 protein were optimized, and the optimized sequence information is shown in SEQ ID No. 5. Other nucleic acid sequences are shown below:

[0064] The DNA sequence of the secretory signal peptide IgK is SEQ ID No. 1:

[0065] ATGGAGACAGACACACTCCTGCTATGGGTACTGCTGCTCTGGGTTCCAGGTTCCA CTGGTGAC.

[0066] The gene sequence encoding the Aβ40 protein peptide is SEQ ID No. 2:

[0067] GATGCAGAATTCCGACATGACTCAGGATATGAAGTTCATCATCAAAAATTGGTGTTCTTGCAGAAGATGTGGGTTCAAACAAAGGTGCAATCATTGGACTCATGGTGGGCG GTGTTGTC.

[0068] The nucleic acid sequence encoding the HA-tagged peptide is SEQ ID No. 3:

[0069] TACCCATACGATGTTCCAGATTACGCT.

[0070] The nucleic acid sequence encoding the ApoE4 protein is SEQ ID No. 4:

[0071] ATGAAGGTTCTGTGGGCTGCGTTGCTGGTCACATTCCTGGCAGGATGCCAGGCCAAGGTGGAGCAAGCGGTGGAGACAGAGCCGGAGCCCGAGCTGCGCCAGCAGACCGAGTGGCAGAGCGGCCAGCGCTGGGAACTGGCACTGGGTCGCTTTTGGGATTACCTGCGCTGGGTGCAGACACTGTCTGAGCAGGTGCAGGAGGAGCTGCTCAGCTCCCAGGTCACCCAGGAACTGAGGGCGCTGATGGACGAGACCATGAAGGAGTTGAAGGCCTACAAATCGGAACTGGAGGAACAACTGACCCCGGTGGCGGAGGAGACGCGGGCACGGCTGTCCAAGGAGCTGCAGGCGGCGCAGGCCCGGCTGGGCGCGGACATGGAGGACGTGCGCGGCCGCCTGGTGCAGTACCGCGGCGAGGTGCAGGCCATGCTCGGCCAGAGCACCGAGGAGCTGCGGGTGCGCCTCGCCTCCCACCTGCGCAAGCTGCGTAAGCGGCTCCTCCGCGATGCCGATGACCTGCAGAAGCGCCTGGCAGTGTACCAGGCCGGGGCCCGCGAGGGCGCCGAGCGCGGCCTCAGCGCCATCCGCGAGCGCCTGGGGCCCCTGGTGGAACAGGGCCGCGTGCGGGCCGCCACTGTGGGCTCCCTGGCCGGCCAGCCGCTACAGGAGCGGGCCCAGGCCTGGGGCGAGCGGCTGCGCGCGCGGATGGAGGAGATGGGCAGCCGGACCCGCGACCGCCTGGACGAGGTGAAGGAGCAGGTGGCGGAGGTGCGCGCCAAGCTGGAGGAGCAGGCCCAGCAGATACGCCTGCAGGCCGAGGCCTTCCAGGCCCGCCTCAAGAGCTGGTTCGAGCCCCTGGTGGAAGACATGCAGCGCCAGTGGGCCGGGCTGGTGGAGAAGGTGCAGGCTGCCGTGGGCACCAGCGCCGCCCCTGTGCCCAGCGACAATCA C。

[0072] The optimized nucleic acid sequence encoding the ApoE4 protein is SEQ ID No. 5:

[0073] ATGAAGGTGCTCTGGGCTGCCCTGCTGGTTACCTTCCTCGCCGGTTGTCAGGCCAAGGTGGAGCAGGCTGTGGAGACCGAGCCCGAGCCTGAGCTGCGGCAGCAGACTGAGTGGCAGTCTGGCCAGAGATGGGAACTGGCCCTGGGAAGGTTTTGGGACTACCTGCGCTGGGTGCAGACACTGAGCGAGCAGGTGCAGGAGGAACTGCTGAGCAGCCAGGTGACCCAGGAGCTGAGAGCCCTGATGGATGAGACAATGAAGGAACTCAAGGCTTATAAGAGCGAGCTGGAGGAGCAGCTGACCCCCGTGGCCGAGGAGACTAGGGCCAGACTGTCTAAGGAATTGCAGGCCGCCCAGGCCAGGCTGGGGGCCGATATGGAGGATGTGAGAGGCCGACTGGTGCAGTATCGAGGAGAGGTTCAGGCCATGCTGGGCCAGTCCACAGAGGAACTGCGGGTGAGGCTGGCCAGCCACCTGAGAAAACTGAGAAAACGCCTCCTGAGAGATGCCGATGACCTGCAGAAGAGGCTGGCTGTGTATCAGGCCGGGGCCAGAGAAGGCGCCGAAAGGGGACTGTCCGCTATCAGGGAAAGACTGGGCCCCCTGGTGGAGCAGGGCAGAGTGAGAGCTGCTACAGTGGGGTCTCTGGCCGGTCAGCCTCTACAGGAAAGAGCACAGGCATGGGGGGAACGACTGCGAGCTAGAATGGAAGAGATGGGAAGCAGAACACGAGACAGACTGGACGAGGTGAAGGAGCAGGTGGCCGAAGTGAGAGCCAAGCTGGAAGAGCAGGCTCAGCAAATCAGACTGCAGGCTGAGGCCTTCCAGGCCAGACTGAAGAGCTGGTTCGAGCCTCTGGTGGAGGATATGCAGAGACAGTGGGCTGGACTGGTGGAGAAGGTTCAGGCCGCTGTGGGAACAAGTGCCGCCCCTGTGCCCTCAGATAATCAC。

[0074] The nucleic acid sequence encoding the Myc tag peptide is SEQ ID No. 6: GAACAAAAACTCATCTCAGAAGAGGATCTG.

[0075] In this invention, expressions such as "comprising," "having," and "containing," as well as their grammatical synonyms, should be understood as inclusive rather than exclusive open-ended expressions (i.e., such terms do not exclude other elements or steps not explicitly listed). It should also be understood that the use of "comprising," "including," and "having" in this document also provides for the "composed of" option.

[0076] The term “and / or” as used herein includes any and all combinations of one or more of the related listed items.

[0077] In this invention, numerical ranges are involved. Unless otherwise specified, the numerical ranges are considered continuous and include the minimum and maximum values ​​of the range, as well as every value between the minimum and maximum values. Furthermore, when the range refers to integers, it includes every integer between the minimum and maximum values ​​of the range. Additionally, when multiple ranges are provided to describe features or characteristics, the ranges may be merged. In other words, unless otherwise specified, all ranges disclosed herein should be understood to include any and all subranges to which they are included.

[0078] In this invention, "at least one" means one or more, and "more than one" means two or more. "At least one of the following" or similar expressions refer to any combination of these items, including any combination of a single item or a plurality of items.

[0079] It should be understood that in the various embodiments of the present invention, the order of the sequence numbers does not imply the order of execution. Some or all steps may be executed in parallel or sequentially. The execution order of each process should be determined by its function and internal logic, and should not constitute any limitation on the implementation process of the embodiments of this application.

[0080] In this invention, "nucleic acid" includes any compound and / or substance comprising a polymer of nucleotides, wherein the nucleotides may be in the form of DNA, RNA, or cDNA. In embodiments of this invention, the nucleic acid is in the form of DNA. The DNA form includes cDNA, genomic DNA, or artificially synthesized DNA. The DNA may be single-stranded or double-stranded. The DNA may be a coding strand or a non-coding strand.

[0081] The test materials used in this invention are all common commercial products and can be purchased on the market.

[0082] The present invention will be further illustrated below with reference to the embodiments:

[0083] Example 1

[0084] In this embodiment, the AAV system was used to express the human Aβ40 protein peptide in neurons and the human ApoE4 gene in astrocytes. By stereotactic injection of AAV into the brain and expression of Aβ40 and ApoE4 in the animal brain, a rapid CAA animal model was successfully established.

[0085] 1. Construct the pAAV-CAG-EGFP-T2A-MCS vector

[0086] To construct the pAAV-CAG-EGFP-T2A-MCS vector, the inventors used pAAV-CAG-EGFP (purchased from Addgene) and modified it by adding a T2A module and a multiple cloning site (MCS).

[0087] The specific process is as follows:

[0088] 1) First, insert the MCS fragment, including the restriction enzyme sites: BstBI, NheI, SacI, AgeI, SpeI, EcoRI, EcoRV, and HindIII. The sequences are as follows:

[0089] Oligo up1:

[0090] GTACAAGTTCGAAGCTAGCGAGCTCACCGGTACTAGTGAATTCGATATCA(SEQ

[0091] ID No. 7)

[0092] Oligo down1:

[0093] AGCTTGATATCGAATTCACTAGTACCGGTGAGCTCGCTAGCTTCGAACTT(SEQ

[0094] ID No. 8)

[0095] All of the above DNA sequences were synthesized by Shanghai Sangon Biotech.

[0096] 2) Prepare two oligos at a concentration of 3 μg / μL using ddH2O. Dissolve 1 μL of each oligo in annealing buffer (10 mM Tris-HCl, 50 mM NaCl, 1 mM EDTA, pH 8.0), for a total volume of 50 μL. Place the mixture in a sealed centrifuge tube and immerse it in boiling water (100°C). Allow the reaction mixture to cool slowly to room temperature naturally in the boiling water bath, allowing the oligos to form DNA double strands with sticky ends through base pairing. After cooling, briefly centrifuge and collect the droplets from the tube wall.

[0097] 3) Insert the above MCS fragment into pAAV-CAG-EGFP.

[0098] pAAV-CAG-EGFP was digested with restriction endonucleases BsrGI and HindIII at 37°C for 30 min. The digested vector was identified by agarose gel electrophoresis and then recovered from the gel. 50 ng of the purified vector was mixed with 2 μL of the product from step 2) above, and T4 ligase and the corresponding buffer were added for ligation overnight at 16°C. The ligation product was added to Stable competent cells, gently tapped to mix, and incubated on ice for 30 min. Then, it was heat-shocked at 42°C for 1 min, incubated on ice again for 5 min, and 500 μL of Luria-Bertani (LB) medium was added. The cells were incubated on a shaker at 37°C and 225 rpm for 1 h. The bacterial culture was then centrifuged at 10,000 rpm for 1 min at room temperature, most of the supernatant was discarded, and the remaining bacterial culture was spread evenly by pipetting and then transferred to an LB plate. The plate was then slowly spread evenly using a sterile triangular glass rod and incubated at 37°C for at least 16 h.

[0099] Add 100 μL of LB medium containing ampicillin (1:1000) to a 1.5 mL centrifuge tube. Use a sterile pipette tip to pick a single colony from an LB agar plate and place it into the centrifuge tube. Incubate at 37°C on a shaker with uniform shaking at 225 rpm for 3–4 h. Sequencing of the bacterial culture confirms positive clones.

[0100] The positive clones obtained in the previous step were inoculated into 10 mL of LB liquid medium containing ampicillin and cultured on a shaker at 37°C and 225 rpm for 16-18 h. Then, the culture was centrifuged at 10,000 rpm for 1 min at room temperature, and the supernatant was discarded. Plasmid extraction using Plasmid DNA MiniKit I: Add 250 μL of Solution 1 from the kit, vortex until the bacterial cells are suspended and completely homogenized, transfer to a 1.5 mL centrifuge tube, add 250 μL of Solution 2, gently invert the centrifuge tube 4-6 times, and incubate at room temperature for 3 min. Add 350 μL of Solution 3, gently invert the tube until a distinct white flocculent precipitate is observed, centrifuge at 15000 rpm for 10 min at room temperature. Aspirate the supernatant and transfer to a DNA absorption column, centrifuge at 15000 rpm for 1 min at room temperature, and discard the filtrate. Add 500 μL of HBC buffer, centrifuge at 15000 rpm for 1 min at room temperature, and discard the filtrate. Add 700 μL of wash buffer, centrifuge at 15000 rpm for 1 min at room temperature, and discard the filtrate. Repeat this process once. Place the absorption column into a clean, sterile 1.5 mL centrifuge tube, add 30 μL of Nase-free ddH2O, centrifuge at 15,000 rpm for 2 min at room temperature, detect the DNA concentration using a Nano-300 analyzer, and store at -20°C for later use.

[0101] 4) Continue inserting the T2A fragment into pAAV-CAG-EGFP-MCS. The T2A sequence is as follows:

[0102] Oligo up2:

[0103] CGAAGAGGGCAGAGGAAGTCTGCTAACATGCGGTGACGTCGAGGAGAATCCTG GCCCAG(SEQ IDNo.9)

[0104] Oligo down2:

[0105] CTAGCTGGGCCAGGATTCTCCTCGACGTCACCGCATGTTAGCAGACTTCCTCTGC CCTCTT(SEQ IDNo.10)

[0106] 5) The subsequent method is the same as in 2) above, to obtain a DNA double strand with sticky ends.

[0107] 6) The pAAV-CAG-EGFP-MCS was digested at 37℃ for 30 min using restriction endonucleases BstBI and NheI. Subsequent experimental methods were the same as in 3), and the pAAV-CAG-EGFP-T2A-MCS vector was finally obtained.

[0108] 2. Construction of pAAV-GfaABC1D-MCS vector

[0109] Using the pAAV-CAG-EGFP-MCS vector described above, replace CAG-EGFP with GfaABC1D to obtain the desired pAAV-GfaABC1D-MCS vector.

[0110] The specific process is as follows:

[0111] 1) The GfaABC1D promoter was synthesized at Sangon Biotech. Using this promoter as a substrate, primers were designed to amplify GfaABC1D. The restriction enzyme sites NdeI and NheI were added. The PCR primers are as follows:

[0112] F:ATTACATATGAACATATCCTGGTGTGGAGTAGGGG(SEQ ID No.11)

[0113] PCR amplification was performed on R:ATTAGCTAGCGATCCGCGAGCAGCGGAGGTGATGCGTCTCC (SEQ ID No. 12), and the target fragment was identified by agarose gel electrophoresis and recovered by gel cutting.

[0114] 2) Digest the pAAV-CAG-EGFP-MCS vector and the target fragment obtained above with restriction endonucleases NdeI and NheI at 37°C for 30 min. Identify the digested vector and target fragment by agarose gel electrophoresis and recover them separately. Subsequent operations are as described above.

[0115] 3. Construct an adeno-associated virus (AAV) plasmid expressing Aβ40.

[0116] like Figure 1 To achieve high expression of the Aβ40 protein peptide, the following design was carried out when constructing the AAV expression plasmid: (1) The CAG promoter was used to achieve high expression mainly in neurons; (2) Green fluorescent protein (EGFP) was inserted downstream of the CAG promoter to track the AAV virus infection efficiency; (3) A T2A module was fused downstream of EGFP to express Aβ40 and EGFP respectively; (4) An IgK secretion leader peptide was fused to the N-terminus of the Aβ40 peptide to ensure that Aβ40 was secreted into the extracellular space, thereby causing the accumulation of Aβ40 in the extracellular space; (5) An HA tag was fused to the C-terminus of the Aβ40 peptide to facilitate the subsequent detection of Aβ40 expression level.

[0117] The specific process is as follows:

[0118] 1) First, synthesize the DNA sequence of the secretion signal peptide IgK shown in SEQ ID No. 1 and the DNA sequence of Aβ40 shown in SEQ ID No. 2;

[0119] All of the above DNA sequences were synthesized by Shanghai Sangon Biotech.

[0120] 2) Using IgK as a substrate, primers were designed with the NheI restriction site added, and IgK was linked to the first 20 bases of Aβ40. The primer sequences are as follows:

[0121] F1:ATTAGCTAGCGCCACCATGGAGACAGACACACTCCTGCTAT(SEQ ID No.13),

[0122] R1: TCATGTCGGAATTCTGCATCGTCACCAGTGGAACCTGGAACCCAG (SEQ ID No. 14) was amplified using a high-fidelity enzyme. The run program was set as follows: 98℃ for 3 min, 98℃ for 15 s, 60℃ for 20 s, 72℃ for 60 s, repeated for 30 cycles up to step two, with a 10 min extension at 72℃. The obtained PCR product was identified by 1% agarose gel electrophoresis at 130V for 30 min. The target gel band was accurately cut under handheld UV light and placed into a 1.5 mL centrifuge tube. The target fragment was purified and recovered using a gel extraction kit. Buffer GDP was added until the gel block was completely submerged, and the gel was incubated at 55℃ for 10 min until the gel block was completely dissolved. The DNA adsorption column from the kit was placed in a 2 mL collection tube, and the sol was transferred to the adsorption column using a pipette. The column was centrifuged at 12000 rpm for 1 min, and the filtrate was discarded. 300 μL of Buffer GDP was added, the column was allowed to stand for 1 min, and then centrifuged at 12000 rpm at room temperature for 1 min. The filtrate was discarded. Add 700 μL of Buffer GW, centrifuge at 12000 rpm for 1 min at room temperature, discard the filtrate, and repeat this operation. Finally, place the adsorption column into a 1.5 mL sterile centrifuge tube, add 30 μL of Elution Bufer to the center of the adsorption column, incubate for 2 min, and centrifuge at 12000 rpm for 1 min at room temperature. Detect the concentration of the recovered fragment using a Nano-300 analyzer, and store the DNA at -20°C.

[0123] 3) Using Aβ40 as a substrate, primers were designed to link Aβ40 to the HA-tagged peptide, and a HindIII restriction enzyme site was added. The primer sequences are as follows:

[0124] F2:GATGCAGAATTCCGACATGACTCAG (SEQ ID No. 15);

[0125] R2: ATTAAAGCTTTCAAGCGTAATCTGGAACATCGTATGGGTAGACAACACCGCCC ACCATG (SEQ ID No. 16) was amplified using a high-fidelity enzyme as described above. PCR amplification was performed, and the fragment was identified by agarose gel electrophoresis and recovered by gel extraction. Finally, using the PCR products obtained in the previous two steps as substrates, primers F1 and R2 were used to amplify the IgK-Aβ40-HA fragment containing the restriction endonuclease sites NheI and HindIII using a high-fidelity enzyme. After identification by agarose gel electrophoresis, the fragment was recovered by gel extraction.

[0126] 4) Insert the above IgK-Aβ40-HA into the AAV expression plasmid.

[0127] The pAAV-CAG-EGFP-T2A-MCS empty vector and the obtained IgK-Aβ40-HA gene fragment were digested with restriction endonucleases NheI and HindIII at 37°C for 30 min. The digested vector and fragment were identified by agarose gel electrophoresis and recovered separately. The purified gene fragment and vector were ligated at a molar ratio of 10:1 with T4 ligase and the corresponding buffer at 16°C overnight. The ligation product was added to Stable competent cells, gently tapped to mix, and incubated on ice for 30 min. The cells were then heat-shocked at 42°C for 1 min, incubated on ice again for 5 min, and 500 μL of Luria-Bertani (LB) medium was added. The cells were incubated on a shaker at 37°C and 225 rpm for 1 h. The bacterial culture was then centrifuged at 10,000 rpm for 1 min at room temperature, most of the supernatant was discarded, and the remaining bacterial culture was spread evenly by pipetting and then transferred to LB plates. The plates were then slowly spread evenly using a sterile triangular glass rod and incubated at 37°C for at least 16 h.

[0128] Add 100 μL of LB medium containing ampicillin (1:1000) to a 1.5 mL centrifuge tube. Using a sterile pipette tip, pick a single colony from an LB agar plate and place it into the centrifuge tube. Incubate at 37°C and 225 rpm on a shaker for 3–4 h. Perform PCR to identify whether the recombinant plasmid contains the target gene fragment. The PCR program is: 95°C for 3 min, 95°C for 15 s, 60°C for 20 s, 72°C for 75 s, repeating this cycle up to step two for 30 cycles, followed by a 10 min extension at 72°C. Perform 1% agarose gel electrophoresis on the PCR products at 130 V for 30 min. Select positive clones containing the target gene for further amplification and sequencing to confirm the positive clone.

[0129] The positive clones obtained in the previous step were inoculated into 10 mL of LB liquid medium containing ampicillin and cultured on a shaker at 37°C and 225 rpm for 16-18 h. Then, the culture was centrifuged at 10,000 rpm for 1 min at room temperature, and the supernatant was discarded. Plasmid extraction using Plasmid DNA MiniKit I: Add 250 μL of Solution 1 from the kit, vortex until the bacterial cells are suspended and completely homogenized, transfer to a 1.5 mL centrifuge tube, add 250 μL of Solution 2, gently invert the centrifuge tube 4-6 times, and incubate at room temperature for 3 min. Add 350 μL of Solution 3, gently invert the tube until a distinct white flocculent precipitate is observed, centrifuge at 15000 rpm for 10 min at room temperature. Aspirate the supernatant and transfer to a DNA absorption column, centrifuge at 15000 rpm for 1 min at room temperature, and discard the filtrate. Add 500 μL of HBC buffer, centrifuge at 15000 rpm for 1 min at room temperature, and discard the filtrate. Add 700 μL of wash buffer, centrifuge at 15000 rpm for 1 min at room temperature, and discard the filtrate. Repeat this process once. Place the absorption column into a clean, sterile 1.5 mL centrifuge tube, add 30 μL of Nase-free ddH2O, centrifuge at 15,000 rpm for 2 min at room temperature, detect the DNA concentration using a Nano-300 analyzer, and store at -20°C for later use.

[0130] 4. Construct AAV plasmid expressing ApoE4

[0131] like Figure 1 As shown, to achieve high expression of the ApoE4 protein, another AAV expression plasmid was constructed. Specifically, the ApoE4 gene was specifically expressed in astrocytes using the GfaABC1D promoter, and a Myc tag was fused to the C-terminus of this gene for subsequent detection of ApoE4 expression.

[0132] The specific process is as follows:

[0133] The ApoE4 gene (codon-optimized) was synthesized at Sangon Biotech. Using this gene as a substrate, primers were designed to amplify and clone the ApoE4 gene. The restriction enzyme sites BamHI and HindIII, as well as the Myc tag, were added. The PCR primers are as follows:

[0134] F:ATTAGGATCCGCCACCATGAAGGTGCTCTGGGCTGC (SEQ ID No. 17),

[0135] R:ATTAAAGCTTTCACAGATCCTCTTCTGAGATGAGTTTTTGTTCGTGATTATCTGA GGGC (SEQ ID No. 18) was subjected to PCR amplification, identified by agarose gel electrophoresis, and the target fragment was recovered by gel extraction.

[0136] The pAAV-GfaABC1D-MCS empty vector and the ApoE4 gene fragment obtained above were selected and digested with restriction endonucleases BamHI and HindIII at 37°C for 30 min. The digested vector and target fragment were identified by agarose gel electrophoresis and recovered separately. Subsequent methods were as described above.

[0137] 5. Packaging AAV virus

[0138] Current research shows that the AAV9 serotype has the characteristic of infecting neurons, while AAV5 has the characteristic of infecting astrocytes. Therefore, this invention packages the Aβ40 expression plasmid into the AAV9 serotype virus and the ApoE4 expression plasmid into the AAV5 serotype virus. The specific steps are as follows:

[0139] 1) Cell Culture

[0140] HEK293T cells in the logarithmic growth phase (passage number less than 30) were seeded in 15cm cell culture dishes. After the cell confluence density reached 90%, cell transfection was performed.

[0141] 2) Cell transfection

[0142] One hour before transfection, change the medium, discarding the cell culture medium and slowly add 20 mL of fresh, serum-free, antibiotic-free DMEM medium containing 25 mM HEPES. Take two sterile 50 mL centrifuge tubes and add 11 mL of serum-free, antibiotic-free DMEM to each. Add PEI transfection reagent (1 mg / mL) to one centrifuge tube and add a mixed plasmid (AAV-Aβ40:pAdDeltaF6:pAAV2 / 9n molar ratio = 1:1:1) or (AAV-ApoE4:pAdDeltaF6:pAAV2 / 5n molar ratio = 1:1:1) to the other centrifuge tube. Add the PEI incubation solution slowly to the plasmid incubation solution at a plasmid (μg):PEI (μL) ratio of 1:1.5, gently pipette to mix, and incubate at room temperature for 20 min to form a stable PEI-plasmid complex. Carefully add the incubation solution dropwise to the cell culture medium, gently shake to mix, and continue culturing in a cell culture incubator. Three hours after transfection, DMEM medium containing 10% FBS and 25 mM HEPES was added to the culture medium to bring the final FBS concentration to 2%. Twenty-four hours after transfection, the transfection efficiency and the correctness of the fluorescence could be observed under a fluorescence microscope by labeling the fluorescence.

[0143] 3) Collect AAV viruses

[0144] 48–72 hours after transfection, resuspend the culture medium with a pipette and try to lift all adherent cells. Collect the cells and culture medium into a 50 mL sterile centrifuge tube and centrifuge at 3500 rpm for 7 min at 4 °C. Collect the supernatant with a sterile syringe and filter it through a 0.45 μm microporous membrane into a new 50 mL centrifuge tube. Add 5 × PEG8000 and mix by inverting. Incubate at 4 °C. Invert the tube every 30 min for three times. After the last inversion, incubate at 4 °C overnight. Centrifuge the supernatant that has been left to stand overnight at 4°C at 3500g for 30 min. Discard the supernatant and resuspend the cell pellet in 2 mL of PBS + 0.001% PF68. Thaw the cell pellet that has been left to stand overnight at -80°C on ice. Add 2 mL of 5M NaCl to resuspend the pellet and mix well. Mix the mixture with 2 mL of PBS + 0.001% PF68 to resuspend the cell pellet. Transfer the mixture to a 15 mL centrifuge tube, invert it slowly 3-5 times, and place it on ice for later use.

[0145] 4) Ultrasonic fragmentation

[0146] Before using the sonicator, clean the probe by passing it through 84 disinfectant, 75% ethanol, and sterile water, then dry it with a paper towel. Take the cell resuspension from the previous step and sonicate it on ice: submerge the probe below the solution surface, sonicate at 30% power for 30 seconds, pause for 10 seconds, and repeat three times. Continue until the solution is no longer viscous. Centrifuge the sonicated liquid at 3500g, 4℃, for 30 minutes. Transfer the supernatant to a new 15mL centrifuge tube and place it on ice.

[0147] 5) Ultra-high speed centrifugation purification of AAV virus

[0148] Different concentrations of iodixanol solution and the supernatant of the lysis buffer were sequentially added to sterile ultracentrifuge tubes: using a pipette, 5.9 mL of 60% iodixanol layer, 3.9 mL of 40% iodixanol layer, 3.3 mL of 25% iodixanol layer, and 3.7 mL of 15% iodixanol layer were slowly added sequentially. The previously collected supernatant was then added to the top layer, and the tubes were capped. After balancing, the tubes were centrifuged at 48,000 rpm, 4°C, for 120 min.

[0149] 6) Concentration of AAV virus

[0150] After centrifugation, discard the supernatant and 60% layer. Accurately aspirate the remaining 40% layer using a 10ml syringe and transfer it to a new sterile 15mL centrifuge tube. Dilute the 40% layer to 14mL with PBS containing 0.001% PF68. Aspirate this solution using a sterile syringe and filter it through a 0.22μm microporous membrane into a new sterile 15mL centrifuge tube. Add 4-5mL of the filtered virus to a 100KD ultrafiltration tube and centrifuge at 3500rpm, 4℃, for 30min. Repeat this process until all virus has been ultrafiltered and the final product is concentrated to below 200μL. Aliquot the virus into 1.5mL sterile centrifuge tubes, seal tightly with sealing film, and store at -80℃, avoiding repeated freeze-thaw cycles.

[0151] 7) AAV virus titer determination

[0152] The viral titers of the AAV5 serotype AAV-GfaABC1D-ApoE4-Myc and the AAV9 serotype pAAV-CAG-EGFP-T2A-IgK-Aβ40-HA obtained in the above steps were determined as follows:

[0153] Take 1.1 μL of the 1.07 μg / μL pAAV-CAG-GFP plasmid stock solution and dilute it with 98.9 μL of water. Prepare a 2×10⁻⁶ solution. 9 A plasmid solution with a concentration of molecμLes / μl was prepared. It was then serially diluted with nuclease-free water to a concentration of 2×10⁻⁶. 8 2×10 7 2×10 6 2×10 5 2×10 4 2×10 3 To create a standard score.

[0154] Take 1 μL of the packaged AAV sample, add 9 μL of nuclease-free water to dilute to 10x, and then add nuclease-free water in a gradient dilution to 200x, 1000x, 5000x, 25000x, and 125000x.

[0155] Add the plasmid standard concentration and AAV serially diluted samples to eight-tube sets, 5 μL / well. Prepare the qPCR system using Matermix: SYBR Master Mix 2X 10 μL, 100 μM primer F 0.15 μL, 100 μM primer R 0.15 μL, and nuclease-free water 4.7 μL. Mix thoroughly and add 15 μL / well to the eight-tube sets. Mix with the plasmid standard concentration and AAV serially diluted samples by pipetting. ITR recognition primer F: GGAACCCCTAGTGATGGAGTT (SEQ ID No. 19), R: 5'-CGGCCTCAGTGAGCGA (SEQ ID No. 20).

[0156] Perform qPCR on the instrument and run the following program: 98℃ 3min / 98℃ 15sec / 58℃ 30sec / read plate / repeat 39x from step 3 / melt curve.

[0157] For data processing, the ordinate is the CT value, and the abscissa is the Log value, i.e., 9, 8, 7, 6, 5, 4 (powers). A linear calibration curve is fitted, and the AAV diluted sample values ​​are substituted into the formula to calculate the GC (genome copy) value.

[0158] 6. AAV virus injection

[0159] Two-month-old wild-type mice were anesthetized and their head hair was shaved. The mice's heads were then fixed to a stereotactic injection device, with their upper teeth hooked into the fixing holes and clamped. Small sticks were inserted to an appropriate depth into the cartilage of both ears and tightened, adjusting the head to be as horizontal as possible. The mouse's head skin was disinfected, and the skin was cut open with surgical scissors sterilized with 75% ethanol to expose the skull. The mouse's cranial surface was gently wiped with 10% hydrogen peroxide until the I-shaped sutures were exposed. A three-dimensional coordinate system of the skull was established using the anterior point (Bregma point) at the junction of the coronal and sagittal sutures as the zero point. Using the coordinates as a reference, the skull was adjusted so that the anterior and posterior fontanelles were at the same level, and 1.5 mm to the left and right of the anterior fontanelle point were also at the same level. The injection site was determined according to the cortical region coordinates (x = ±1.7 mm, y = -1.2 mm, z = -1.0 mm), and the skull covering the injection site was carefully removed with a skull drill. Accurately pipette 2 μL of adeno-associated virus (AAV) mixed solution, namely AAV5 serotype AAV-GfaABC1D-ApoE4-Myc and AAV9 serotype pAAV-CAG-EGFP-T2A-IgK-Aβ40-HA, and mix them in equal proportions. After mixing, the titer of both viruses is 1 × 10⁻⁶. 10vg / mL. 2 μL of AAV virus mixture was injected into each hemisphere of the brain. Virus injection was performed using a mouse brain stereotaxic instrument (Beijing Zhongshidichuang) at a rate of 0.2 μL / min. After injection, the syringe was left in place for 10 minutes, then slowly withdrawn by turning the knob. Following injection, the mouse was placed on a heated pad, the exposed skin was disinfected, the wound was sutured with sterile surgical sutures, and the mouse was returned to its cage. Its condition was closely monitored, and the mouse was kept in the cage for one month.

[0160] 7. Determine the success rate of CAA modeling

[0161] Mice injected with AAV were anesthetized and their limbs were fixed. The chest cavity was opened with surgical scissors to expose the heart. Physiological saline was perfused into the left ventricle of the heart with a syringe to completely rinse away the blood. Then, 4% paraformaldehyde solution was slowly perfused for pre-fixation. After that, the skin of the mouse brain was cut open to expose the skull. The skullcap was carefully peeled off with scissors, and the intact brain tissue was removed. The brain tissue was completely immersed in 4% paraformaldehyde solution and fixed at 4°C for 24 hours. The brain tissue was transferred to 30% sucrose solution and dehydrated at 4°C until the brain tissue completely sank to the bottom. A mold was prepared in advance using aluminum foil. After adding an appropriate amount of OCT embedding agent to the bottom, the mold was placed horizontally and pre-cooled at -80°C. After the bottom embedding agent solidified, the brain tissue was gently held with tweezers. The surface residual sucrose was gently absorbed with a paper towel. The olfactory bulb of the brain tissue was carefully placed into the mold with the brain tissue facing forward. Then, OCT embedding agent was quickly and evenly poured in to completely cover the brain tissue, avoiding air bubbles. It was stored at -80°C.

[0162] Pre-cool the cryostat to -20°C. Remove the embedding block from -80°C and quickly transfer it into the cryostat. Secure the brain tissue to the base using embedding medium. Adjust the angle so that the top and bottom edges of the embedding block are parallel to the blade. Cut the tissue into uniform sections 30 μm thick and gently transfer them to a 30% sucrose solution, then place them at 4°C for later use.

[0163] Remove the brain slices from the 30% sucrose solution and gently transfer them to PBS solution for 5 min, repeating three times. Gently transfer the brain slices to PBS solution containing 0.3% Triton and incubate at room temperature for 15 min. Transfer to 2.5% BSA blocking solution and block at room temperature for 30 min. Primary antibody incubation: After blocking, transfer the brain slices to primary antibodies (anti-HA, anti-Myc) prepared with immunohistochemical blocking solution and incubate overnight at 4°C. The next day, rinse the brain slices in PBS solution for 5 min, repeating three times. Then transfer the brain slices to secondary antibody (Alexa Fluor 546 conjugated goat anti-rabbit IgG) and incubate at room temperature in the dark for 1 hour. Rinse with PBS for 5 min, repeating three times. Mount with an anti-fluorescence quencher containing DAPI and observe and photograph under a fluorescence microscope.

[0164] like Figure 2As shown, Myc staining results indicate that ApoE4 secreted by astrocytes accumulates extracellularly and forms aggregates around blood vessels.

[0165] like Figure 3 As shown, HA staining results revealed that secreted Aβ40 accumulated extracellularly and formed perivascular aggregates, exhibiting pathological features of cerebral amyloid angiopathy.

[0166] 8. Stability Analysis

[0167] Twenty male C57BL / 6J mice were selected, with ten mice in the control group and ten in the model group. A CAA animal model was constructed using the method described above. The results showed that the success rate of CAA mouse model establishment using this method reached 100%, indicating that it is a stable and reproducible modeling method.

[0168] The above are merely preferred embodiments of the present invention. It should be noted that those skilled in the art can make various improvements and modifications without departing from the principle of the present invention, and these improvements and modifications should also be considered within the scope of protection of the present invention.

Claims

1. Application of protein assemblies in constructing animal models of cerebral amyloid angiopathy; The protein combination includes Aβ40 protein and ApoE4 protein.

2. A biomaterial for constructing an animal model of cerebral amyloid angiopathy, characterized in that, Includes at least one of the following (I to V): I) Nucleic acids encoding the Aβ40 protein and the ApoE4 protein; II) Expression cassettes containing the nucleic acid described in I; III) A vector containing the nucleic acid described in I) or the expression cassette described in II); IV) The host of the vector described in III); V), including any one of I) to IV).

3. The biomaterial according to claim 2, characterized in that, The nucleic acid encoding the Aβ40 protein has any of the following nucleic acid sequences: I. A nucleotide sequence as shown in SEQ ID No. 2; II. A nucleotide sequence that has the same or similar function as the sequence shown in I, obtained by substituting, deleting, adding or modifying one or more bases in the sequence shown in I. III. A nucleotide sequence that has at least 90% homology to any one of the nucleotide sequences in I-II; The nucleic acid encoding the ApoE4 protein has any of the following nucleic acid sequences: i. Nucleotide sequences as shown in SEQ ID No. 4 or SEQ ID No. 5; ii. A nucleotide sequence that has the same or similar function as the sequence shown in i, obtained by substituting, deleting, adding or modifying one or more bases in the sequence shown in i; iii. A nucleotide sequence that has at least 90% homology with any one of the nucleotide sequences in i to ii.

4. The biomaterial according to claim 2 or 3, characterized in that, The carrier includes carrier 1 and carrier 2; The vector 1 includes: a vector backbone, a nucleic acid encoding a signal peptide, and a nucleic acid encoding an Aβ40 protein; The vector 2 comprises: a vector backbone and nucleic acid encoding the ApoE4 protein.

5. The biomaterial according to claim 4, characterized in that, The backbone vectors of vector 1 and vector 2 are adeno-associated virus vectors; And / or, the promoter is selected from the CAG promoter, hSyn promoter, hALDH1L1 or GfaABC1D promoter; And / or, the signal peptide includes IgK; And / or, the serotype of the vector 1 is AAV9; the serotype of the vector 2 is AAV5.

6. The biomaterial according to claim 4 or 5, characterized in that, The vector further includes at least one of the following: a nucleic acid encoding a tag peptide, an EGFP gene, an ITR sequence, and a nucleic acid encoding a self-cleaving polypeptide; the tag peptide includes Myc or HA; and the self-cleaving polypeptide includes T2A, P2A, or E2A.

7. The biomaterial according to any one of claims 4 to 6, characterized in that, The vector 1 comprises, from 5' to 3', the following components in sequence: CAG promoter, EGFP gene, T2A sequence, nucleic acid encoding IgK, nucleic acid encoding Aβ40, and nucleic acid encoding HA; The vector 2 includes, from its 5' to 3' ends, the GfaABC1D promoter, nucleic acid encoding the ApoE4 protein, and nucleic acid encoding Myc.

8. The use of the biomaterials described in any one of claims 2 to 7 in constructing an animal model of cerebral amyloid angiopathy.

9. A method for constructing an animal model of cerebral amyloid angiopathy, characterized in that, Animals were infected with the biological material described in any one of claims 2 to 7 to obtain an animal model of cerebral amyloid angiopathy. The infection can be transmitted via injection.

10. The use of the animal model of cerebral amyloid angiopathy obtained by the construction method of claim 9 in at least one of the following aspects: Screening of drugs for the prevention and treatment of cerebral amyloid angiopathy; Efficacy evaluation of drugs for the prevention and treatment of cerebral amyloid angiopathy; Quality control of drugs for the prevention and treatment of cerebral amyloid angiopathy.