Agrobacterium tumefaciens-mediated radix pseudostellariae hairy root genetic transformation method and application thereof

Abstract

The invention relates to the technical field of genetic engineering, in particular to an agrobacterium tumefaciens-mediated radix pseudostellariae hairy root genetic transformation method and application thereof. The method comprises the following steps: preparing a radix pseudostellariae explant; activating and culturing agrobacterium rhizogenes; constructing an engineering bacterium containing a target gene recombinant vector; infecting explants and inducing hairy roots; carrying out resistance screening and sterilization on transgenic hairy roots; carrying out amplification culture on hairy roots; and carrying out RT-PCR detection. The hairy root genetic transformation method provided by the invention is simple and rapid to operate and high in gene expression level, and can provide technical support for gene function research. Meanwhile, by using the genetic transformation method provided by the invention, through overexpression of the radix pseudostellariae cyclic peptide coding gene, a transgenic material with significantly improved content of the pharmacodynamic substance cyclic peptide of the radix pseudostellariae can be obtained, and a research material is provided for researching a biosynthetic pathway of the cyclic peptide.

Description

Technical Field

[0001] This invention relates to the field of genetic engineering technology, specifically to an Agrobacterium-mediated genetic transformation method for the hairy roots of Codonopsis pilosula and its application. Background Technology

[0002] Codonopsis pilosula, a traditional and precious Chinese medicinal herb, is derived from the dried tuberous root of Pseudostellaria heterophylla (Mip.) Paxex Paxet Hoffm., a plant in the Caryophyllaceae family. It possesses the effects of invigorating qi and strengthening the spleen, promoting body fluid production and moistening the lungs. Clinically, it is mainly used for symptoms such as infantile diarrhea, anorexia, malnutrition, and bronchial asthma. Cyclic peptides are an important material basis for the pharmacological activity of Codonopsis pilosula. Modern pharmacological studies have found that Codonopsis pilosula cyclic peptides have anti-inflammatory, anti-tumor, anti-HIV, tyrosinase inhibition, and angiogenesis promotion effects, showing great development potential and market application prospects.

[0003] Nineteen cyclic peptide components have been isolated from *Pseudostellarin*, including heterophyllin A-H and Pseudostellarin A-H. Among them, cyclic peptide HB is one of the key evaluation indicators for the quality control of *Pseudostellarin* granules. However, the content of cyclic peptide components in *Pseudostellarin* is low; for example, the content of the relatively high-content cyclic peptide HB is only about 0.020%~0.040%, which is insufficient to meet the market demand for high-quality *Pseudostellarin* and cyclic peptide compounds. Hairy roots have advantages such as rapid growth, the ability to synthesize and accumulate secondary metabolites, and stable production capacity, and can be used for the development and utilization of natural drug components. Large-scale production of plant secondary metabolites through hairy roots has been studied in many medicinal plants. Therefore, a simple and efficient method for constructing a genetic transformation system of transgenic hairy roots of *Pseudostellarin* can be explored to solve the supply problem of medicinal active ingredients in *Pseudostellarin*.

[0004] Cyclic peptides from *Pseudostellaria heterophylla* are small cyclic molecules composed of 2-10 amino acids. They are monocyclic formed only by the amide bond at the first ring, without disulfide bonds or other bridging structures, representing a typical cyclic peptide structure of the Caryophyllaceae family. Significant progress has been made in the isolation and identification of active substances and in pharmacological studies of *Pseudostellaria heterophylla*, but research on its functional genes lags behind due to the lack of an effective genetic transformation system. Currently, only a few cyclic peptide-encoding genes, including the PrePhHA gene, have been cloned, and key enzymes in the downstream pathways of cyclic peptide biosynthesis still need further investigation.

[0005] Based on this, this application, through in-depth research and investigation, has established an Agrobacterium-mediated genetic transformation method for the hairy roots of Codonopsis pilosula. By overexpressing the cyclic peptide encoding gene PrePhHA in the hairy roots of Codonopsis pilosula, the aim is to significantly improve the production efficiency of cyclic peptide compounds from the hairy roots. At the same time, it provides technical support for the downstream pathway analysis of cyclic peptide biosynthesis and the commercial production of cyclic peptide active ingredients from Codonopsis pilosula. Summary of the Invention

[0006] The purpose of this invention is to provide an Agrobacterium-mediated genetic transformation method for the hairy roots of Codonopsis pilosula and its application in obtaining transgenic materials with increased HA content of Codonopsis pilosula cyclic peptide.

[0007] To achieve the above objectives, the technical solution adopted by the present invention is as follows: The Agrobacterium-mediated genetic transformation method for the hairy roots of Codonopsis pilosula described in this invention includes the following steps: Preparation of S1 Codonopsis pilosula explants: Take the seeds of Codonopsis pilosula, wash them, soak them in water for 12-20 hours, disinfect the surface, take the embryos and inoculate them into MS medium for in vitro culture to obtain sterile seedlings of Codonopsis pilosula with fully expanded cotyledons. After cutting off the petioles and roots, the Codonopsis pilosula explants are obtained. The in vitro culture specifically involves: dark culture at 25℃ for 3 days to allow the embryos to germinate, followed by normal light culture for 10 days at a temperature of 25℃, humidity of 75%, light intensity of 1800 Lx, and a photoperiod of 16 h / 8 h. Activation and culture of S2 Agrobacterium rhizogenes: Agrobacterium rhizogenes K599 was streaked onto TY solid medium containing 50 mg / L streptomycin and incubated at 28°C for 36 h. Single colonies were picked and placed in 5 mL of TY liquid medium containing 50 mg / L streptomycin and cultured at 28°C and 200 r / min with shaking until the bacterial culture reached OD. 600 The concentration was 0.6~0.8; 100 μL of the above bacterial solution was taken and evenly spread on TY solid medium containing 50 mg / L streptomycin, and cultured at 28℃ for 12 h to obtain a large number of uniformly grown white colonies; Construction of engineered bacteria containing the target gene recombinant vector in S3: The *Codonopsis pilosula* cyclic peptide HA encoding gene *PrePhHA* was ligated to the plant expression vector pMDC83 to obtain the recombinant expression vector pMDC83-PrePhHA. This vector was then transformed into *Agrobacterium rhizogenes* K599 to obtain *Agrobacterium rhizogenes* engineered bacteria containing the recombinant expression vector pMDC83-PrePhHA. The nucleotide sequence of the *PrePhHA* gene is shown in SEQ ID NO.1, and the nucleotide sequences of the PCR amplification primers for the *PrePhHA* gene are shown in SEQ ID NO.2 and SEQ ID NO.3. S4 infection of explants and induction of hairy roots: Pick a single colony of the engineered bacteria and place it in TY liquid medium. Shake to expand the culture until the bacterial volume reaches OD. 600 The value is 0.6~0.8; then the bacterial solution is spread on TY solid medium containing 50 mg / L streptomycin and 50 mg / L kanamycin, and incubated upside down for 12~15 h to obtain engineered bacterial colonies for later use; the engineered bacteria obtained in the culture are evenly spread on the wound of the Codonopsis pilosula explant prepared in step S1, and induced culture is carried out by moist filter paper sandwich culture method. After the wound heals, hairy roots grow. The wetted filter paper sandwich culture method is as follows: place double-layered filter paper against the wall in a culture bottle containing a small amount of MS liquid culture medium, take the Codonopsis pilosula explant wrapped with bacteria and place it on the upper end of the filter paper sandwich for fixation, and contact the lower end of the filter paper with MS liquid culture medium, and culture for a total of 7-12 days; S5 transgenic hairy root resistance screening and sterilization: The hairy roots induced in the above steps were subcultured onto moistened filter paper in MS liquid medium supplemented with 400 mg / L cefotaxime sodium and 10 mg / L hygromycin for screening. The medium was changed every 10 days, and the culture was continued for 20 days. Hairy roots with significantly faster growth rates were selected and further placed in MS liquid medium supplemented with only 400 mg / L cefotaxime sodium. The culture was sterilized at 25°C, in the dark, and at a rotation speed of 100 rpm. The medium was replaced with fresh medium every 10 days, and the concentration of cefotaxime sodium was reduced by 50-100 mg / L each time. After 4-5 sterilization cultures, completely sterilized hairy roots were obtained. Expanded culture of S6 hairy roots: After resistance selection and sterilization culture, the vigorous hairy roots of Codonopsis pilosula were subcultured into B5 liquid medium and expanded in a constant temperature shaking incubator at 100 rpm. Fresh medium was replaced every 10 days, and culture was continued for 30-60 days to obtain a large number of transgenic hairy roots. S7 RT-PCR detection: Total RNA was extracted from the obtained transgenic hairy roots, reverse transcribed into cDNA, and then detected by PCR.

[0008] Preferably, in the Agrobacterium-mediated genetic transformation method for the hairy roots of Codonopsis pilosula of the present invention, the surface disinfection in step S1 specifically involves: taking soaked Codonopsis pilosula seeds, disinfecting them with 75% ethanol solution for 3 min, then adding 0.1% mercuric chloride solution for 6 min, and rinsing them with sterile water 4-5 times.

[0009] Preferably, in the Agrobacterium-mediated genetic transformation method for the hairy roots of Codonopsis pilosula of the present invention, the MS culture medium in step S1 is specifically: MS 4.4 g / L + sucrose 30 g / L + agar powder 8 g / L, with a pH value of 5.80.

[0010] Preferably, in the Agrobacterium-mediated genetic transformation method for the hairy roots of Codonopsis pilosula of the present invention, the construction and culture of the engineered bacteria containing the recombinant vector of the target gene in step S3 specifically involves: cloning the PrePhHA gene from the cDNA of the Codonopsis pilosula tuberous roots, ligating it to the double-digested pMDC83 vector using homologous recombination to construct the plant expression vector pMDC83-PrePhHA containing the target gene, transforming it into Agrobacterium rhizogenes K599 competent cells using the freeze-thaw method, obtaining resistant monoclonal antibodies after antibiotic screening, selecting single colonies for shake culture expansion, and obtaining the Agrobacterium rhizogenes engineered bacteria containing the pMDC83-PrePhHA expression vector.

[0011] In a further preferred embodiment, in the Agrobacterium-mediated genetic transformation method for the hairy roots of Codonopsis pilosula described in this invention, the PCR amplification system for the PrePhHA gene in step S3 is as follows: Easy Taq DNA polymerase 0.2 μL, 10×Easy Taq Buffer 2 μL, dNTP Mix (2.5 mM each) 1.6 μL, template cDNA 2 μL, upstream and downstream primers at a concentration of 10 μmol / L each 0.5 μL, and ddH2O 13.2 μL.

[0012] In a further preferred embodiment, in the Agrobacterium-mediated genetic transformation method for the hairy roots of Codonopsis pilosula described in this invention, the PCR amplification program for the PrePhHA gene in step S3 is as follows: pre-denaturation at 98°C for 1 min; denaturation at 98°C for 15 s, annealing at 56°C for 15 s, extension at 72°C for 20 s, 30 cycles; extension at 72°C for 2 min.

[0013] Preferably, in the Agrobacterium-mediated genetic transformation method for the hairy roots of Codonopsis pilosula of the present invention, the MS liquid culture medium in step S4 is specifically: MS 4.4 g / L + sucrose 30 g / L, pH value is 5.80.

[0014] Preferably, in the Agrobacterium-mediated genetic transformation method for the hairy roots of Codonopsis pilosula of the present invention, the B5 liquid culture medium in step S6 is specifically: 3.7 g / L B5 powder + 30 g / L sucrose, with a pH value of 5.80.

[0015] Preferably, in the Agrobacterium-mediated genetic transformation method for the hairy roots of Codonopsis pilosula described in this invention, step S7 RT-PCR detection is specifically implemented through the following steps: Total RNA was extracted from the transgenic hairy roots obtained from S7-1 and reverse transcribed into cDNA. S7-2 designed forward and reverse detection primers based on the pMDC83-PrePhHA plant expression vector sequence, as shown in SEQ ID NO.4 and SEQ ID NO.5 respectively; S7-3 Based on the PrePhHA gene sequence, primers were designed for real-time PCR detection to detect the expression level of the PrePhHA gene in the hairy roots of transgenic Codonopsis pilosula. The primer sequences are shown in SEQ ID NO.6 and SEQ ID NO.7. PhActin was used as an internal reference gene, and the primer sequences are shown in SEQ ID NO.8 and SEQ ID NO.9.

[0016] The application of the Agrobacterium-mediated genetic transformation method for the hairy roots of Codonopsis pilosula described in this invention in obtaining transgenic materials with increased HA content of Codonopsis pilosula cyclic peptide.

[0017] The beneficial effects of this invention are: 1. This invention provides an Agrobacterium-mediated genetic transformation method for the hairy roots of *Pseudostellaria heterophylla*. This method is simple, rapid, and produces high gene expression levels, providing technical support for gene function research. Furthermore, by overexpressing the *Pseudostellaria heterophylla* cyclic peptide encoding gene using this genetic transformation method, transgenic materials with significantly increased cyclic peptide content can be obtained, providing research materials for studying the biosynthetic pathway of cyclic peptides.

[0018] 2. This invention uses the cotyledons and petioles of *Codonopsis pilosula* and root-cut seedlings as explant materials, and has found that root-cut seedlings are the best explants for inducing hairy roots in *Codonopsis pilosula*. This invention uses *Agrobacterium rhizogenes* strains C58C1, K599, and Ar.Qual as engineered infection bacteria, and has found that *Agrobacterium rhizogenes* K599 is the best strain for inducing hairy roots in *Codonopsis pilosula*. This invention uses the hygromycin resistance carried by the expression vector for concentration screening, setting concentrations of 0 mg / L, 5 mg / L, 10 mg / L, 15 mg / L, and 20 mg / L, and has found that 10 mg / L hygromycin is the most suitable for screening resistance in hairy roots of *Codonopsis pilosula*. This invention uses 1 / 2 MS, B5, N6, and WPM as hairy root propagation media, and has found that B5 medium is the most suitable for the propagation of hairy roots in *Codonopsis pilosula*. This invention uses a filter paper sandwich method for long-term co-culture of *Agrobacterium* and explants, and simultaneously induces hairy roots; this method is simple and rapid.

[0019] 3. This invention provides a new method for inducing and expanding the culture of transgenic hairy roots of Codonopsis pilosula, laying the foundation for in-depth research on the hairy roots of Codonopsis pilosula, providing a new approach for the industrial and large-scale production of cyclic peptide compounds from the hairy roots of Codonopsis pilosula in the future, and also providing technical support for the large-scale production of medicinal active ingredients of Codonopsis pilosula. Attached Figure Description

[0020] Figure 1 The results of PCR identification of the rolB gene in the hairy roots of Codonopsis pilosula after infection with different Agrobacterium species are shown in the figure (A: hairy roots induced by strain C58C1; B: hairy roots induced by strain K599; C: hairy roots induced by strain Ar.qual; PCR detection of rolB gene, lane M is 2Kb DNA Marker, lanes 1-12 are different hairy root systems, lane 13 is wild-type root, lane 14 is deionized water, and lane 15 is strains C58C1, K599, and Ar.qual, respectively). Figure 2 The results of observing the red signal in the hairy roots of Codonopsis pilosula are shown in the figure. (In the figure: A, B, and C are the results of Agrobacterium K599 carrying the expression vector p35S-RUBY infecting the root-cut seedlings; D and E are the results of Agrobacterium K599 carrying the expression vector p35S-RUBY infecting the petioles; F to M are the results of hairy root observation after Agrobacterium K599 carrying the expression vector p35S-DsRed2 infecting the explants. Among them, F and H are the results of observation under natural light; G and I are the results of observation under 600nm excitation light with a handheld fluorescent protein excitation light source; J and L are the results of observation under white light with a fluorescence microscope; and K and M are the results of observation under a fluorescence microscope with an excitation wavelength of 543nm). Figure 3Gel images of positive detection of transgenic reporter gene-transgenic Codonopsis pilosula hairy roots (in the image: A is positive detection of transgenic p35S-RUBY hairy roots; B is positive detection of transgenic p35S-DsRed2 hairy roots; PCR detection of RUBY and DsRed2, lane M is a 2Kb DNA marker, lanes 1-12 are different hairy root systems, lane 13 is wild-type root, lane 14 is deionized water, and lane 15 is p35S-RUBY plasmid and p35S-DsRed2 plasmid respectively). Figure 4 The effects of different culture media on the biomass and accumulation of cyclic peptides in the hairy roots of Codonopsis pilosula (Figure: A represents the hairy roots of Codonopsis pilosula under different culture media; B represents the fold increase in fresh weight of hairy roots after 60 days of culture in different culture media; C represents the content of cyclic peptide HB in hairy roots under different culture media). Figure 5 The results of gene expression level and cyclic peptide HA content analysis in the hair roots of Codonopsis pilosula overexpressing PrePhHA were presented in the figure (A represents the expression level of PrePhHA in the hair roots; B represents the content of cyclic peptide HA in the hair roots). Detailed Implementation

[0021] The technical solution of the present invention will be described in detail below with reference to specific embodiments. The following embodiments are for explanation and illustration only, and do not constitute a limitation on the technical solution of the present invention.

[0022] Example 1 The specific steps of the Agrobacterium-mediated genetic transformation method for the hairy roots of Codonopsis pilosula are as follows: (1) Preparation of Codonopsis pilosula explants Take the seeds of *Codonopsis pilosula*, wash them, and soak them in clean water for 12-20 hours. After thoroughly disinfecting the surface of the soaked seeds, use forceps under a dissecting microscope to remove the outer seed coat, inner seed coat, and endosperm in sequence. Take out the morphologically intact embryos and inoculate them into MS medium (MS 4.4 g / L + sucrose 30 g / L + agar powder 8 g / L, pH 5.80) for in vitro culture to obtain sterile seedlings of *Codonopsis pilosula* with fully expanded cotyledons. Use a scalpel to cut off the petioles and roots to obtain *Codonopsis pilosula* explants.

[0023] The specific disinfection process is as follows: Take the soaked Codonopsis pilosula seeds, disinfect them with 75% ethanol solution for 3 minutes, then add 0.1% mercuric chloride solution for 6 minutes, and rinse with sterile water 4-5 times.

[0024] The specific process of in vitro culture is as follows: the embryos are cultured in the dark at 25℃ for 3 days to allow them to germinate, and then cultured under normal light for 10 days at a temperature of 25℃, a humidity of 75%, a light intensity of 1800 Lx, and a photoperiod of 16 h / 8 h.

[0025] (2) Activation and culture of Agrobacterium rhizogenes Agrobacterium rhizogenes K599 was streaked onto TY solid medium containing 50 mg / L streptomycin and incubated at 28°C for 36 h. Single colonies were picked and placed in 5 mL of TY liquid medium containing 50 mg / L streptomycin and cultured at 28°C and 200 r / min with shaking until the bacterial culture reached OD. 600 The concentration was 0.6~0.8; 100 μL of the above bacterial solution was taken and evenly spread on TY solid medium containing 50 mg / L streptomycin, and cultured at 28℃ for 12 h to obtain a large number of uniformly grown white colonies.

[0026] (3) Construction of engineered bacteria containing recombinant vectors of target genes The PrePhHA gene was cloned from the cDNA of the root tuber of *Codonopsis pilosula*. Homologous recombination was used to ligate it with the double-digested pMDC83 vector to construct the plant expression vector pMDC83-PrePhHA containing the target gene. This vector was then transformed into *Agrobacterium rhizogenes* K599 competent cells using a freeze-thaw method. Resistant single colonies were obtained after antibiotic selection. Single colonies were picked and cultured in a shake culture to obtain engineered *Agrobacterium rhizogenes* containing the pMDC83-PrePhHA expression vector. The nucleotide sequence of the PrePhHA gene is shown in SEQ ID NO.1, and the nucleotide sequences of the primers for PCR amplification of the PrePhHA gene are shown in SEQ ID NO.2 and SEQ ID NO.3.

[0027] The PCR amplification system for the PrePhHA gene was as follows: Easy Taq DNA polymerase 0.2 μL, 10×EasyTaq Buffer 2 μL, dNTP Mix (2.5 mM each) 1.6 μL, template cDNA 2 μL, forward and reverse primers at a concentration of 10 μmol / L each 0.5 μL, and ddH2O 13.2 μL. The amplification program was as follows: 98℃ pre-denaturation for 1 min; 98℃ denaturation for 15 s, 56℃ annealing for 15 s, 72℃ extension for 20 s, 30 cycles; 72℃ extension for 2 min.

[0028] (4) Infection of explants and induction of hairy roots Pick a single colony of the engineered bacteria and place it in TY liquid medium. Shake to expand the culture until the bacterial volume reaches OD. 600 The value is 0.6~0.8; then the bacterial solution is spread on TY solid medium containing 50 mg / L streptomycin and 50 mg / L kanamycin, and incubated upside down for 12~15 h to obtain engineered bacterial colonies for later use; the engineered bacteria obtained in the culture are evenly spread on the wound of the Codonopsis pilosula explant prepared in step (1), and induced culture is carried out by moist filter paper sandwich culture method. After the wound heals, hairy roots grow.

[0029] The wetted filter paper sandwich culture method is as follows: place double-layered filter paper on the wall of a culture flask containing a small amount of MS liquid culture medium (MS 4.4 g / L + sucrose 30 g / L, pH 5.80), take the Codonopsis pilosula explant wrapped with bacteria and place it on the upper end of the filter paper sandwich for fixation, and the lower end of the filter paper is in contact with the MS liquid culture medium. Culture for a total of 7 to 12 days.

[0030] (5) Screening for resistance and sterilization of transgenic hairy roots The hairy roots induced in the above steps were subcultured onto moistened filter paper in MS liquid medium supplemented with 400 mg / L cefotaxime sodium and 10 mg / L hygromycin for screening. The medium was changed every 10 days, and the culture was continued for 20 days. Hairy roots with significantly faster growth rates were selected and further placed in MS liquid medium supplemented with only 400 mg / L cefotaxime sodium. The culture was sterilized at 25°C, in the dark, and at a rotation speed of 100 rpm. The medium was replaced with fresh medium every 10 days, and the concentration of cefotaxime sodium was reduced by 50-100 mg / L each time. After 4-5 sterilization cultures, completely sterilized hairy roots were obtained.

[0031] (6) Expanded culture of hairy roots After resistance screening and sterilization culture, vigorous hairy roots of Codonopsis pilosula were subcultured into B5 liquid medium (B5 powder 3.7 g / L + sucrose 30 g / L, pH 5.80) and expanded in a constant temperature shaking incubator at 100 rpm. Fresh medium was replaced every 10 days, and culture was continued for 30-60 days to obtain a large number of transgenic hairy roots.

[0032] (7) RT-PCR detection Total RNA was extracted from the obtained transgenic hairy roots and reverse transcribed into cDNA. Forward and reverse detection primers were designed based on the pMDC83-PrePhHA plant expression vector sequence, as shown in SEQ ID NO.4 and SEQ ID NO.5. Real-time PCR primers were designed based on the PrePhHA gene sequence to detect the expression level of the PrePhHA gene in the transgenic Codonopsis pilosula hairy roots, as shown in SEQ ID NO.6 and SEQ ID NO.7. PhActin was used as an internal reference gene, and the primer sequences are shown in SEQ ID NO.8 and SEQ ID NO.9.

[0033] Example 2 Transgenic hairy root material with significantly increased HA content of Codonopsis pilosula cyclic peptide was obtained by the method in Example 1.

[0034] To further verify the reliability of the present invention and select the optimal solution, the inventors conducted a series of experiments, as follows: 1. Sequence Information SEQ ID NO.1: ATGTCTCCTAATTCAGCATCCACCGGTTTGAAGCCTAACGGAATAACTCCTGTCATTTTCAGTGAGGAGGTCATCGATGACGACAACACTTCCGCCCCAGTGTAA SEQ ID NO.2: PrePhHA-F: 5'-ATGTTCCCTAATTCAGCATCCACC-3' SEQ ID NO.3: PrePhHA-R: 5'-TTACACTGGGGCGGAAGTGT-3' SEQ ID NO.4: PMDC-F: 5'-CCACTATCCTTCGCAAGACCCT-3' SEQ ID NO.5: PMDC-R: 5'-ATGATAATCATCGCAAGACCGGC-3' SEQ ID NO.6: PrePhHA-qF: 5'-TTCAGCATCCACCGGTTTGAA-3' SEQ ID NO.7: PrePhHA-qR: 5'-ACTGGGGCGGAAGTGTTGTC-3' SEQ ID NO.8: PhActin-qF: 5'-AGGCTAACAGGGAGAAAATGACC-3' SEQ ID NO.9: PhActin-qR: 5'-CGTAGAATAGCATGGGGTAGAGC-3' SEQ ID NO.10: rolB-F1: 5'-CTATTCCTTCCACGCTTTCAACCA-3' SEQ ID NO.11: rolB-R1: 5'-GTGCAGCAGGCTCATGACGCCC-3' SEQ ID NO.12: DsRed-F: 5'-ATGGCCTCCTCCGAGAACG-3' SEQ ID NO.13: DsRed-R: 5'-CTACAGGAACAGGTGGTGGCG-3' SEQ ID NO.14: RUBY-F:5'-TGGGCAGGCCTCGATAAG-3' SEQ ID NO.15: RUBY-R: 5'-GCCAATATATCCTGTCAAACACTG-3' SEQ ID NO.16: PrePhHA-CF: 5'-caggtcgactctagaggatccATGTCTCCTAATTCAGCATCCACC-3' SEQ ID NO.17: PrePhHA-CR: 5'-cgatcggggaaattcgagctcTTACACTGGGGCGGAAGTGT-3' 2. Effects of different Agrobacterium rhizogenes strains on the transformation rate of hairy roots of Codonopsis pilosula 2.1 Activation and culture of Agrobacterium rhizogenes Agrobacterium rhizogenes C58C1 (catalog number: AC1110, containing pRiA4b agrobastic Ri plasmid), K599 (catalog number: AC1080, containing pRi2659 agrobastic Ri plasmid), and Ar. Qual (catalog number: AC1060, containing agrobastic Ri plasmid) were all purchased from Shanghai Weidi Biotechnology Co., Ltd. They were streaked onto TY solid culture dishes containing 50 mg / L streptomycin and incubated at 28℃ for 36 h. Single colonies were picked and cultured in 5 mL of TY liquid medium containing 50 mg / L streptomycin at 28℃ and 200 r / min with shaking until the bacterial culture reached OD. 600 The concentration was 0.6~0.8. 100 μL of the above bacterial solution was evenly spread on a TY solid culture dish containing 50 mg / L streptomycin and incubated at 28℃ for 12 h to obtain a large number of uniformly growing white colonies, which can be directly used for wound infection of Codonopsis pilosula explants.

[0035] 2.2 Infection with Agrobacterium Following step (1) in Example 1, explants of *Pseudostellaria heterophylla* were prepared. White colonies of C58C1, K599, and Ar.Qual were spread onto the wounds of the explants, and then co-cultured in a filter paper interlayer moistened with MS liquid medium. The explants were isolated with moistened filter paper and not directly immersed in the liquid medium. After 3 days of co-culture, callus formation was observed in the explant wounds. After 7 days, 1-4 hair roots were observed to grow from the callus wounds. After 12 days, hair roots approximately 3-7 cm in length were observed. Subsequently, the hair roots were subcultured into MS medium containing cefotaxime sodium for sterilization culture. The medium was changed every 10 days, and the culture was continued for 30 days to obtain well-grown hair roots.

[0036] 2.3 PCR detection of hairy roots of Codonopsis pilosula Primers were designed based on the rolB gene on the Ri plasmid T-DNA of Agrobacterium rhizogenes for PCR amplification. The primer sequences are shown in SEQ ID NO.10 and SEQ ID NO.11. Genomic DNA was extracted from Agrobacterium rhizogenes using the CTAB method, and the corresponding Agrobacterium culture was used as a positive control for PCR detection. The PCR amplification program was as follows: 95℃ pre-denaturation for 3 min; 95℃ denaturation for 30 s, 58℃ annealing for 30 s, 72℃ extension for 1 min, 30 cycles; 72℃ extension for 5 min, and incubation at 25℃. PCR amplification products were subjected to agarose gel electrophoresis.

[0037] 2.4 Results and Discussion The formation of hairy roots is due to the integration of the rol gene on the Ri plasmid of Agrobacterium rhizogenes into the plant genome. Therefore, PCR amplification can be used to detect whether the roots growing on the explant are hairy roots.

[0038] DNA was extracted from thoroughly sterilized roots of *Pseudostellaria heterophylla*. *Agrobacterium* strains were used as a positive control, and DNA from uninfected *Pseudostellaria heterophylla* tissue culture seedlings was used as a negative control. The rolB gene was detected. PCR identification results of the rolB gene in the hairy roots of *Pseudostellaria heterophylla* infected with different *Agrobacterium* strains are shown below. Figure 1As shown in the figure (A represents hairy roots induced by strain C58C1; B represents hairy roots induced by strain K599; C represents hairy roots induced by strain Ar.qual; PCR detection of the rol B gene, lane M is a 2 Kb DNA marker, lanes 1-12 represent different hairy root systems, lane 13 represents wild-type roots, lane 14 represents deionized water, and lane 15 represents strains C58C1, K599, and Ar.qual respectively). The results show that a 741 bp rol B band was detected in the hairy roots of *Pseudostellaria heterophylla* induced after infection with *Agrobacterium* K599, C58C1, and Ar.Qual, consistent with the band of the positive control strain. However, no corresponding band was detected in the roots of *Pseudostellaria heterophylla* tissue culture seedlings, indicating that the rol gene has been integrated into the genomic DNA of *Pseudostellaria heterophylla* rootlets.

[0039] However, the induction rate and positive rate of different Agrobacterium species in the hairy roots of *Pseudostellaria heterophylla* varied considerably. In this experiment, Agrobacterium K599, C58C1, and Ar.Qual were used to infect root-cut seedlings and induce root development. The transformation rates are shown in Table 1. Table 1 shows that the root induction rate was 39.29%–48.44% after 6 days of co-culturing with explants, and 65.00%–84.38% after 12 days of co-culturing. Among these, Agrobacterium K599 showed the highest root induction rate. Further analysis of the rol gene revealed that the probability of detecting the rol gene in the roots of seedlings infected with Agrobacterium C58C1 was 10.00%, the positive transformation rate after K599 infection was 80.00%, and the positive transformation rate after Ar.Qual infection was 66.66%.

[0040] Taking all factors into consideration, strain K599 has a high root induction rate and positive transformation rate, making it the optimal strain for inducing hairy roots in Codonopsis pilosula.

[0041] 3. Effects of different explant types on the transformation rate of Pseudostellaria heterophylla hairy roots 3.1 Activation and culture of engineered bacteria containing reporter gene expression vectors The expression vector p35S-DsRed2 carries a reporter gene sequence encoding a red fluorescent protein, which exhibits red fluorescence under excitation light at a wavelength of 543 nm. The expression vector p35S-RUBY carries a gene cluster encoding a magenta RUBY protein complex, which accumulates in cells and is visible to the naked eye as a magenta-colored tissue. The expression vectors p35S-DsRed2 and p35S-RUBY were transformed into Agrobacterium rhizogenes K599 and C58C1 competent cells, respectively, using a freeze-thaw method to obtain engineered strains carrying the expression vectors. The resulting bacterial cultures were evenly spread onto TY solid culture dishes containing the corresponding antibiotic resistance (50 mg / L Kan + 100 mg / L Stre), and incubated at 28°C for 12 h, yielding numerous uniformly growing white colonies.

[0042] 3.2 Induction of hairy roots using different explants Aseptic seedlings of Codonopsis pilosula were obtained by culturing according to step (1) in Example 1. The cotyledons and petioles of the aseptic seedlings and the seedlings with the roots removed were used as explants. An appropriate amount of cultured Agrobacterium white colonies carrying the reporter gene expression vector were applied to the wounds, and hairy roots were induced according to step (4) in Example 1.

[0043] 3.3 Observational statistics of reporting markers in the hairy roots of Codonopsis pilosula For the transformation of the expression vector p35S-DsRed2, after 12 days of co-culture, the red fluorescence signal of the hairy roots was observed under 600 nm excitation light using a handheld fluorescent protein excitation light source (LUYOR-3415RG, Luyor Instrument), and further fluorescence microscopy was performed at an excitation wavelength of 543 nm. For the transformation of the expression vector p35S-RUBY, after 12 days of co-culture, the magenta hairy roots were counted by visual observation, and further microscopic observation was performed under an optical microscope.

[0044] 3.4 PCR detection of reporter markers in the hairy roots of Codonopsis pilosula Specific primers were designed based on the reporter gene sequence in the expression vector for PCR detection. The nucleotide sequences of the primers are shown in SEQ ID NO.12, SEQ ID NO.13, SEQ ID NO.14, and SEQ ID NO.15.

[0045] 3.5 Results and Analysis The results of the observation of red signal in the hairy roots of Codonopsis pilosula are as follows: Figure 2As shown in the figure: A, B, and C are Agrobacterium K599 carrying the expression vector p35S-RUBY infecting root-cut seedlings; D and E are Agrobacterium K599 carrying the expression vector p35S-RUBY infecting petioles; F to M are observations of hairy roots induced after Agrobacterium K599 carrying the expression vector p35S-DsRed2 infects explants. Among them, F and H are observations under natural light, G and I are observations under 600 nm excitation light from a handheld fluorescent protein excitation source, J and L are observations under white light from a fluorescence microscope, and KM is an observation under a fluorescence microscope with an excitation wavelength of 543 nm. The results showed that, under the same conditions, no red fluorescent signal or rose-red phenotype was observed in the roots of *Codonopsis pilosula* that were not infected with *Agrobacterium rhizogenes*; hairy roots with red fluorescent signal were observed in explants infected with *Agrobacterium* K599 (carrying the expression vector p35S-DsRed2); and hairy roots with a rose-red phenotype were observed in explants infected with *Agrobacterium* (carrying the expression vector p35S-RUBY).

[0046] Further PCR testing revealed that the reporter gene sequence encoding red fluorescent protein could be specifically amplified in hairy roots with a red fluorescent phenotype; and the gene sequence encoding the rose-red RUBY protein complex could be specifically amplified in hairy roots with a rose-red phenotype. This indicates that the exogenous reporter gene DsRed2 and the reporter gene RUBY have been successfully integrated into the genome of *Codonopsis pilosula* hairy roots and are highly expressed. The gel image of the positive detection of reporter gene-transfected *Codonopsis pilosula* hairy roots is shown below. Figure 3 As shown in the figure: A is the positive detection of transgenic p35S-RUBY hairy roots; B is the positive detection of transgenic p35S-DsRed2 hairy roots; PCR detection of RUBY and DsRed2, lane M is a 2 Kb DNA Marker, lanes 1-12 are different hairy root systems, lane 13 is wild-type root, lane 14 is deionized water, and lane 15 is p35S-RUBY plasmid and p35S-DsRed2 plasmid respectively.

[0047] The transformation rates of *Pseudostellaria heterophylla* hairy roots induced by different explant types were statistically analyzed, and the results are shown in Table 2. The results show that different explant types have a significant impact on the transformation rate of *Pseudostellaria heterophylla* hairy roots. When infected with *Agrobacterium* K599 carrying a reporter gene expression vector, using cotyledon petioles as explants, the probability of observing red fluorescent roots was 10.83%, and the probability of observing rose-red roots was 5.22%. However, when using root-cut seedlings as explants, the probability of observing red fluorescent roots was 28.36%, and the probability of observing rose-red roots was 14.74%. This indicates that root-cut seedlings are the most suitable explant for inducing hairy roots in *Pseudostellaria heterophylla*, and the transformation rates of different exogenous genes may vary.

[0048] Furthermore, no hairy roots with red fluorescent signals or magenta phenotypes were observed on any explants infected with Agrobacterium C58C1, further indicating that Agrobacterium C58C1 infection of Codonopsis pilosula was inefficient in inducing hairy roots.

[0049] 4. Screening for optimal antibiotic concentrations To efficiently screen transgenic hairy roots, after 12 days of co-culture, the induced hairy roots of *Codonopsis pilosula* were subcultured into a medium containing appropriate concentrations of antibiotics for resistance screening. In this experiment, transgenic hairy roots expressing the p35S-DsRed2 vector were selected as the experimental group, and hairy roots induced only by K599 were selected as the control group. Hygromycin concentration gradients of 0 mg / mL, 5 mg / mL, 10 mg / mL, 15 mg / mL, and 20 mg / mL were set. Explants with hairy roots were subcultured into MS medium containing 400 mg / mL cefotaxime sodium and the corresponding hygromycin concentration gradients for resistance screening and sterilization culture. The screening medium was changed every 10 days. After two rounds of screening, the growth of hairy roots on the hygromycin concentration gradient media was statistically analyzed, and the results are shown in Table 3. The results showed that at concentrations of 0 mg / mL and 5 mg / mL, there was no significant difference between the transgenic hairy roots and the control group; at a concentration of 10 mg / mL, the transgenic hairy roots still grew well, while the control group grew slowly, showing a significant difference; at concentrations of 15 mg / mL and 20 mg / mL, the growth of both the transgenic hairy roots and the control group was inhibited, indicating that a hygromycin concentration of 10 mg / mL is the optimal concentration for antibiotic screening of transgenic hairy roots of Codonopsis pilosula.

[0050] 5. Effects of different culture media on the biomass and accumulation of secondary metabolites of the hairy roots of *Codonopsis pilosula* Using transgenic hairy roots of *Pseudostellaria heterophylla* induced in section 3, "Effects of Different Explant Types on Transformation Rate of Hairy Roots," as experimental material, after activation in liquid medium, equal amounts of hairy roots were subcultured into four media: 1 / 2 MS (Duchefa Biochemie, catalog number M0236), B5 (Duchefa Biochemie, catalog number G0210), N6 (Duchefa Biochemie, catalog number C0204), and WPM (Duchefa Biochemie, catalog number M0220) for scale-up culture. Five replicates were set for each culture condition. Fresh medium was used every 20 days, and the fresh weight of the hairy roots was measured. The culture was continued for 60 days. Finally, the hairy roots of *Pseudostellaria heterophylla* were collected, and the content of cyclic peptides in the hairy roots was determined by high-performance liquid chromatography (HPLC).

[0051] Differences in culture medium composition significantly affect the growth and secondary metabolic efficiency of hairy root cells. The effects of different culture media on the biomass and cyclic peptide accumulation of *Codonopsis pilosula* hairy roots are as follows: Figure 4 As shown in the figure (A represents the hairy roots of *Codonopsis pilosula* under different culture media; B represents the fold increase in fresh weight of hairy roots after 60 days of culture in different culture media; C represents the content of cyclic peptide HB in hairy roots under different culture media). Statistical analysis of fresh weight data revealed that the hairy root biomass increased fastest in WPM culture medium, with the fresh weight of hairy roots after 60 days of continuous culture being 76.12 times the initial fresh weight; followed by B5 medium and 1 / 2 MS medium, with increases of 35.35 times and 21.97 times, respectively; the hairy root biomass increased slowest in N6 medium.

[0052] The main difference between the four culture media mentioned above lies in their nitrogen sources. WPM medium is rich in nitrate nitrogen, B5 medium has a low ammonium nitrogen content, 1 / 2 MS medium contains a high nitrate content, and N6 medium has high potassium nitrate and ammonium sulfate content. In WPM medium, the hairy roots grow more densely and are yellowish-white; in 1 / 2 MS medium, the hairy roots are the darkest, appearing yellowish-brown; while in N6 medium, the hairy roots have the fewest and sparsest root development. Further analysis of the content of the main pharmacologically active substance, cyclic peptide HB, in the hairy roots showed that the cyclic peptide content was higher in B5 and 1 / 2 MS media, with no significant difference between the two culture conditions, but the cyclic peptide content in WPM medium was relatively lower. In summary, B5 medium is the most suitable for the large-scale culture of Pseudostellaria heterophylla hairy roots, as it not only promotes faster hairy root growth but also accumulates a higher content of cyclic peptides.

[0053] 6. Obtaining hairy roots of *Codonopsis pilosula* overexpressing the PrePhHA gene and determining its cyclic peptide HA content. 6.1 Cloning of PrePhHA, the precursor encoding gene of Codonopsis pilosula cyclic peptide HA Total RNA was extracted from *Codonopsis pilosula* and reverse transcribed into cDNA. The nucleotide sequence of the PrePhHA gene is shown in SEQ ID NO.1. Primers for PCR amplification of the PrePhHA gene were designed, and their nucleotide sequences are shown in SEQ ID NO.2 and SEQ ID NO.3.

[0054] The PrePhHA gene was amplified from total cDNA and sequenced. The PCR amplification system was as follows: Easy Taq DNA polymerase 0.2 μL, 10×Easy Taq Buffer 2 μL, dNTP Mix (2.5 mM each) 1.6 μL, template cDNA 2 μL, Primer-F (10 μmol·L⁻¹) －1 ) 0.5 μL, Primer-R( 10 μmol·L －10.5 μL of PCR product and 13.2 μL of ddH2O were added. The amplification program was as follows: 98℃ pre-denaturation for 1 min; 98℃ denaturation for 15 s, 56℃ annealing for 15 s, 72℃ extension for 20 s, 30 cycles; 72℃ extension for 2 min. The PCR amplification product was subjected to agarose gel electrophoresis, and a bright band was observed at the 100 bp position. Sequencing confirmed that the cloned sequence was correct.

[0055] 6.2 Construction of plant expression vectors containing the PrePhHA gene Based on the PrePhHA gene sequence, its coding region and restriction enzyme sites on the pMDC83 vector were analyzed. The plant expression vector pMDC83 was double-digested with restriction endonucleases BamHI and SacI. Simultaneously, a BamHI restriction site was introduced upstream of the PrePhHA gene sequence, and a SacI restriction site was introduced downstream of the PrePhHA gene sequence. A 15 bp homologous arm sequence was also introduced at the 5' end of the primers. The primer sequences are shown in SEQ ID NO.16 and SEQ ID NO.17.

[0056] Expression vectors were constructed using homologous recombination, and the constructed expression vectors were transformed into Agrobacterium rhizogenes K599 competent cells using the freeze-thaw method to obtain engineered strains containing the overexpression vector pMDC83-PrePhHA and the empty vector.

[0057] 6.3 Induction of hairy roots of *Codonopsis pilosula* transgenic gene K599 engineered bacterial culture carrying the plant expression vector pMDC83-PrePhHA was coated onto TY solid culture dishes containing the corresponding resistance (50 mg / L Kan + 50 mg / L Stre) and cultured to obtain a large number of white colonies; sterile seedlings of Codonopsis pilosula with 10 days of growth were obtained by culturing according to step (1) in Example 1, and the seedlings with roots removed were used as explants. An appropriate amount of cultured Agrobacterium white colonies were applied to the wound and Codonopsis pilosula hairy root induction was performed.

[0058] 6.4 PCR detection of hairy roots of transgenic Codonopsis pilosula Forward and reverse detection primers were designed based on the pMDC83-PrePhHA plant expression vector sequence, and the nucleotide sequences of the primers are shown in SEQ ID NO.4 and SEQ ID NO.5, respectively.

[0059] Primers for real-time PCR were designed based on the PrePhHA gene sequence to detect the expression level of the PrePhHA gene in the hairy roots of transgenic Codonopsis pilosula. The nucleotide sequences of the primers are shown in SEQ ID NO.6 and SEQ ID NO.7. PhActin was used as an internal reference gene, and the primer sequences are shown in SEQ ID NO.8 and SEQ ID NO.9.

[0060] 6.5 Extraction of cyclic peptide HA from the hairy roots of transgenic Codonopsis pilosula The hairy roots obtained after expansion culture were washed with water and dried overnight in a 40℃ oven until constant weight, then ground into a uniform powder. 0.100 g of the hairy root powder was weighed into a 10 ml EP tube using a 0.1 g balance, and 5 mL of methanol was added. The mixture was then sonicated for 45 min (30℃, 50% power). After sonication, the sample solution was centrifuged at 8000 rpm for 10 min. The supernatant was transferred to a new EP tube and dried in a nitrogen evaporator at 60℃. 1 mL of methanol was added to the EP tube and sonicated for 15 min to reconstitute the solution. The solution was filtered through a 0.22 μm filter and transferred to a sample vial for content determination.

[0061] 6.6 Determination of cyclic peptide HA content The high-performance liquid chromatography (HPLC) instrument is an SPD20A system controller with an evaporative light-scattering detector (ELSD). The chromatographic column is a Waters C1000T. 18 The column diameter was 5 μm (4.6 × 250 mm); the mobile phase was acetonitrile and 0.1% phosphoric acid water at a volume ratio of 60:40; the flow rate was 0.4 mL / min; the column temperature was 30 ℃; and the detection wavelength was 210 nm. 20 µL of standard sample was injected, and 20 µL of each test sample was injected, repeated three times. The elution time of the cyclic peptide HA standard was 21.021 min, and the retention time of the sample was 30 min. The content of cyclic peptide HA in the sample was calculated based on the concentration and peak area of ​​the standard, and then divided by the dry weight of the *Codonopsis pilosula* hairy root powder to calculate the content of cyclic peptide HA in the dry weight of the sample.

[0062] Analysis results of gene expression level and cyclic peptide HA content in the roots of Codonopsis pilosula with overexpression of PrePhHA are as follows: Figure 5 As shown in the figure (A represents the expression level of PrePhHA in the hairy roots; B represents the content of cyclic peptide HA in the hairy roots), the results show that the gene expression level of PrePhHA and the content of cyclic peptide HA were significantly increased in the hairy roots of transgenic Codonopsis pilosula, and the differences were statistically significant.

[0063] Although the present invention has been described in detail above with general descriptions, specific embodiments, and experiments, modifications or improvements can be made to it, which will be obvious to those skilled in the art. Therefore, all such modifications or improvements made without departing from the spirit of the present invention fall within the scope of protection claimed by the present invention.

Claims

1. An Agrobacterium-mediated genetic transformation method for the hairy roots of Codonopsis pilosula, characterized in that, Includes the following steps: Preparation of S1 Codonopsis pilosula explants: Take the seeds of Codonopsis pilosula, wash them, soak them in water for 12-20 hours, disinfect the surface, take the embryos and inoculate them into MS medium for in vitro culture to obtain sterile seedlings of Codonopsis pilosula with fully expanded cotyledons. After cutting off the petioles and roots, the Codonopsis pilosula explants are obtained. The in vitro culture specifically involves: dark culture at 25℃ for 3 days to allow the embryos to germinate, followed by normal light culture for 10 days at a temperature of 25℃, humidity of 75%, light intensity of 1800 Lx, and a photoperiod of 16 h / 8 h. Activation and culture of S2 Agrobacterium rhizogenes: Agrobacterium rhizogenes K599 was streaked onto TY solid medium containing 50 mg / L streptomycin and incubated at 28°C for 36 h. Single colonies were picked and placed in 5 mL of TY liquid medium containing 50 mg / L streptomycin and cultured at 28°C and 200 r / min with shaking until the bacterial culture reached OD. 600 The concentration was 0.6~0.8; 100 μL of the above bacterial solution was taken and evenly spread on TY solid medium containing 50 mg / L streptomycin, and cultured at 28℃ for 12 h to obtain a large number of uniformly grown white colonies; Construction of engineered bacteria containing the target gene recombinant vector in S3: The *Codonopsis pilosula* cyclic peptide HA encoding gene *PrePhHA* was ligated to the plant expression vector pMDC83 to obtain the recombinant expression vector pMDC83-PrePhHA. This vector was then transformed into *Agrobacterium rhizogenes* K599 to obtain *Agrobacterium rhizogenes* engineered bacteria containing the recombinant expression vector pMDC83-PrePhHA. The nucleotide sequence of the *PrePhHA* gene is shown in SEQ ID NO.1, and the nucleotide sequences of the PCR amplification primers for the *PrePhHA* gene are shown in SEQ ID NO.2 and SEQ ID NO.

3. S4 infection of explants and induction of hairy roots: Pick a single colony of the engineered bacteria and place it in TY liquid medium. Shake to expand the culture until the bacterial volume reaches OD. 600 The value is 0.6~0.8; then the bacterial solution is spread on TY solid medium containing 50 mg / L streptomycin and 50 mg / L kanamycin, and incubated upside down for 12~15 h to obtain engineered bacterial colonies for later use; the engineered bacteria obtained in the culture are evenly spread on the wound of the Codonopsis pilosula explant prepared in step S1, and induced culture is carried out by moist filter paper sandwich culture method. After the wound heals, hairy roots grow. The wetted filter paper sandwich culture method is as follows: place double-layered filter paper against the wall in a culture bottle containing a small amount of MS liquid culture medium, take the Codonopsis pilosula explant wrapped with bacteria and place it on the upper end of the filter paper sandwich for fixation, and contact the lower end of the filter paper with MS liquid culture medium, and culture for a total of 7-12 days; S5 transgenic hairy root resistance screening and sterilization: The hairy roots induced in the above steps were subcultured onto moistened filter paper in MS liquid medium supplemented with 400 mg / L cefotaxime sodium and 10 mg / L hygromycin for screening. The medium was changed every 10 days, and the culture was continued for 20 days. Hairy roots with significantly faster growth rates were selected and further placed in MS liquid medium supplemented with only 400 mg / L cefotaxime sodium. The culture was sterilized at 25°C, in the dark, and at a rotation speed of 100 rpm. The medium was replaced with fresh medium every 10 days, and the concentration of cefotaxime sodium was reduced by 50-100 mg / L each time. After 4-5 sterilization cultures, completely sterilized hairy roots were obtained. Expanded culture of S6 hairy roots: After resistance screening and sterilization culture, the vigorous hairy roots of Codonopsis pilosula were subcultured into B5 liquid medium and expanded in a constant temperature shaking incubator at 100 rpm. Fresh medium was replaced every 10 days, and culture was continued for 30-60 days to obtain a large number of transgenic hairy roots. S7 RT-PCR detection: Total RNA was extracted from the obtained transgenic hairy roots, reverse transcribed into cDNA, and then detected by PCR.

2. The method for genetic transformation of the hairy roots of *Pseudostellaria heterophylla* mediated by *Agrobacterium* according to claim 1, characterized in that, The surface disinfection described in step S1 is as follows: take the soaked Codonopsis pilosula seeds, disinfect them with 75% ethanol solution for 3 minutes, then add 0.1% mercuric chloride solution for 6 minutes, and rinse with sterile water 4-5 times.

3. The method for genetic transformation of the hairy roots of *Pseudostellaria heterophylla* mediated by *Agrobacterium* according to claim 1, characterized in that, The MS medium mentioned in step S1 is specifically: MS 4.4 g / L + sucrose 30 g / L + agar powder 8 g / L, with a pH of 5.

80.

4. The method for genetic transformation of the hairy roots of *Pseudostellaria heterophylla* mediated by *Agrobacterium* according to claim 1, characterized in that, The construction and culture of the engineered bacteria containing the target gene recombinant vector in step S3 are as follows: the PrePhHA gene is cloned from the cDNA of the root tuber of Codonopsis pilosula, and it is ligated with the double-digested pMDC83 vector using homologous recombination to construct the plant expression vector pMDC83-PrePhHA containing the target gene. The vector is then transformed into Agrobacterium rhizogenes K599 competent cells using the freeze-thaw method. Antibiotic-resistant monoclonal antibodies are obtained after screening, and single colonies are picked for shake culture to expand the culture and obtain the engineered Agrobacterium rhizogenes containing the pMDC83-PrePhHA expression vector.

5. The method for genetic transformation of the hairy roots of *Pseudostellaria heterophylla* mediated according to claim 4, characterized in that, The PCR amplification system for the PrePhHA gene described in step S3 is as follows: Easy Taq DNA polymerase 0.2 μL, 10×Easy Taq Buffer 2 μL, dNTP Mix 1.6 μL, template cDNA 2 μL, forward and reverse primers at a concentration of 10 μmol / L each 0.5 μL, and ddH2O 13.2 μL.

6. The method for genetic transformation of the hairy roots of *Pseudostellaria heterophylla* mediated according to claim 4, characterized in that, The PCR amplification program for the PrePhHA gene described in step S3 is as follows: 98℃ pre-denaturation for 1 min; 98℃ denaturation for 15 s, 56℃ annealing for 15 s, 72℃ extension for 20 s, 30 cycles; 72℃ extension for 2 min.

7. The method for genetic transformation of the hairy roots of *Pseudostellaria heterophylla* mediated according to claim 1, characterized in that, The MS liquid culture medium mentioned in step S4 is specifically: MS 4.4 g / L + sucrose 30 g / L, pH value is 5.

80.

8. The method for genetic transformation of the hairy roots of *Pseudostellaria heterophylla* mediated according to claim 1, characterized in that, The B5 liquid culture medium mentioned in step S6 is specifically: 3.7 g / L B5 powder + 30 g / L sucrose, with a pH value of 5.

80.

9. The method for genetic transformation of the hairy roots of *Pseudostellaria heterophylla* mediated according to claim 1, characterized in that, Step S7 RT-PCR detection is performed through the following steps: Total RNA extracted from transgenic hairy roots obtained in S7-1 was reverse transcribed into cDNA. S7-2 designed forward and reverse detection primers based on the pMDC83-PrePhHA plant expression vector sequence, as shown in SEQ ID NO.4 and SEQ ID NO.5 respectively; S7-3 Based on the PrePhHA gene sequence, primers were designed for real-time PCR detection to detect the expression level of the PrePhHA gene in the hairy roots of transgenic Codonopsis pilosula. The primer sequences are shown in SEQ ID NO.6 and SEQ ID NO.

7. PhActin was used as an internal reference gene, and the primer sequences are shown in SEQ ID NO.8 and SEQ ID NO.

9.

10. The application of the Agrobacterium-mediated genetic transformation method for the hairy roots of Codonopsis pilosula as described in any one of claims 1-9 in obtaining transgenic materials with increased HA content of Codonopsis pilosula cyclic peptide.

Images