Zmmate40 gene and application thereof in salt stress tolerance of maize

Abstract

The application discloses a kind of ZmMATE40 Gene and its application in corn salt stress tolerance belong to the field of plant biotechnology breeding.The corn ZmMATE40 Gene, when overexpressed in plants, can make plants obtain salt stress tolerance phenotype, and the aforementioned gene resources and application method have broad application prospects in the field of corn breeding.

Description

TECHNICAL FIELD

[0001] The present application belongs to the field of plant biotechnology, and particularly relates to ZmMATE40 Application of a gene and its protein in improving salt tolerance of maize. BACKGROUND

[0002] Salt-alkali stress is one of the main environmental factors limiting crop growth and productivity. About 50% of irrigated land and 20% of cultivated land in the world are affected by salt-alkali stress.

[0003] Maize accounts for 40% of the national grain output and is an important food, feed and industrial raw material crop. Maize has a large demand, and ensuring stable and sufficient supply of maize is the primary task of food security. Therefore, studying the molecular mechanism of salt-alkali tolerance of maize, excavating high-quality gene resources for salt-alkali tolerance, and cultivating new varieties of salt-alkali tolerant maize are of great significance to global food security and sustainable agricultural development. SUMMARY

[0004] All references mentioned in this text are incorporated herein by reference. Unless otherwise indicated, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this application belongs. Unless otherwise indicated, all techniques used or mentioned are standard techniques commonly used by those of ordinary skill in the art. Materials, methods, and examples are illustrative only and not limiting.

[0005] The present application provides a method for producing a maize plant having a salt stress tolerance phenotype, the method comprising the steps of: ZmMATE40 The present application provides a method for producing a maize plant having a salt stress tolerance phenotype, the method comprising the steps of:

[0006] The present application provides a method for producing a maize plant having a salt stress tolerance phenotype, the method comprising the steps of:

[0007] (a) increasing the expression level of a functional gene ZmMATE40 in the maize plant;

[0008] (b) obtaining at least one seed of the maize plant produced in step (a).

[0009] Optionally, the step of increasing the expression level of a functional gene ZmMATE40 in the maize plant comprises introducing an overexpression vector of an exogenous ZmMATE40 gene into the maize plant, or using natural variation, or performing gene editing on the promoter of an endogenous ZmMATE40 gene, or modifying the 5'-UTR or 3'-UTR of an endogenous ZmMATE40 gene, or the like. ZmMATE40Add enhancers to the promoter region of a gene to increase endogenous [genes]. ZmMATE40 The expression level or protein content.

[0010] Optionally, the multinucleotide sequence of the ZmMATE40 gene is selected from one of the following groups:

[0011] (a) A polynucleotide sequence as shown in SEQ ID No: 1 or 2;

[0012] (b) Its encoding amino acid sequence is the polynucleotide sequence shown in SEQ ID No: 3;

[0013] (c) A polynucleotide sequence that can hybridize with the polynucleotide sequence described in (a) or (b) under strict hybridization conditions, and overexpression of the exogenous polynucleotide sequence in maize plants has the function of making the plants tolerant to salt stress.

[0014] (d) A polynucleotide sequence that has at least 90%, 95%, or 98% similarity to any of the polynucleotide sequences shown in (a)-(c), wherein overexpression of the exogenous polynucleotide sequence in maize plants enables the plants to tolerate salt stress; or

[0015] (e) A polynucleotide sequence complementary to any of the sequences described in (a)-(d).

[0016] Optionally, the embodiments provided in this application... ZmMATE40 Genes, including homologous genes or the same gene from different varieties that have at least 80%, 85%, 90%, 95%, 98%, or 99% sequence similarity to their polynucleotide sequences, or genes disclosed in the embodiments of this invention. ZmMATE40 The homologous gene or the same gene in different varieties has at least 90%, 95% or 98% sequence similarity in amino acid sequence, and the homologous gene, when overexpressed in the plant, has the function of making the plant tolerant to salt stress, and the homologous gene can be isolated from any plant.

[0017] Optionally, the method provided in this application can be applied to any substance containing ZmMATE40 Plants with homologous genes. Preferably, the plants include monocotyledonous plants such as corn, millet, wheat, barley, rye, rice, and sorghum, and dicotyledonous plants such as cotton, corn, peanut, sunflower, sweet potato, potato, apple, and tobacco.

[0018] The percentage of sequence similarity described in the present application can be obtained by known bioinformatics algorithms, including Myers and Miller algorithm, Needleman-Wunsch global alignment method, Smith-Waterman local alignment method, Pearson and Lipman similarity search method, Karlin and Altschul's algorithm, which are well known to those skilled in the art.

[0019] Those skilled in the art should know that there are single nucleotide polymorphisms (SNP) between different varieties of the same plant, that is, the nucleotide sequences of the same gene often have individual base differences, but there are many varieties of the same crop, and the inventors cannot list them one by one, and the sequences of representative varieties in corn crops are only provided in the embodiments of the present application. Therefore, those skilled in the art should know that the nucleotide sequences of different varieties of the same gene and the nucleotide sequences of the same gene disclosed in the present application have SNP, and the method and application of using the overexpression to make the plants obtain salt stress tolerance traits are also within the protection scope of the present application. ZmMATE40

[0020] Optionally, the overexpression vector described in the present application further comprises a promoter operably linked to the nucleotide sequence of the functional gene and improving the expression amount of the functional gene.

[0021] Optionally, the promoter is a cauliflower mosaic virus CaMV 35S, a corn ubiquitin promoter, or a rice Actin1 promoter, and the like overexpression promoters. Optionally, the promoter can also be an inducible promoter or a tissue organ specific expression promoter.

[0022] Optionally, those skilled in the art know that the embodiments of the present application disclose ZmMATE40 the function of the gene, and any method of using the variation existing in nature to improve the expression amount of the endogenous ZmMATE40 gene in the plant to promote the salt stress tolerance of corn should also be covered in the protection scope of the present application.

[0023] Optionally, the present application also provides a feed, meal, protein or oil product made of corn, characterized in that the feed, meal, protein or oil product contains an overexpression construct of the exogenous ZmMATE40 gene. The construct is a part of the T-DNA region on the overexpression vector, including the promoter that makes the exogenous ZmMATE40 gene overexpress in the introduced plant, the exogenous ZmMATE40 gene 、 terminator and the like elements.

[0024] ​Optionally, the methods described in the embodiments of this application for transferring nucleotide sequences, vectors, constructs, or expression cassettes into plants, introducing them into plants, or transforming plants all refer to transferring the target nucleotide sequence, construct, vector, or expression cassette into recipient cells or recipient plants through conventional transgenic methods or methods of hybridization with target transgenic plants. Any transgenic method known to those skilled in the art can be used to transform recombinant expression vectors into plant cells to produce transgenic plants or mutants of the embodiments of this application. Transformation methods may include direct or indirect transformation methods. Specifically, the transformation methods include, but are not limited to, polyethylene glycol-induced DNA uptake, liposome-mediated transformation, gene gun introduction, electroporation, microinjection, and Agrobacterium-mediated plant transformation methods.

[0025] Compared with the prior art, this application has the following beneficial effects:

[0026] (1) This application provides a method for producing maize plants and its application, by improving the quality of maize plants. ZmMATE40 By controlling gene expression levels, plants with superior agronomic traits that enable salt stress tolerance can be obtained. The aforementioned genes, methods, and applications provide new germplasm resources and breeding strategies for maize breeding, which are of great significance to global food security and sustainable agricultural development.

[0027] (2) It was clarified that corn Techniques Gene overexpression and mutation functions provide new genetic resources for crop species;

[0028] (3) By overexpressing or suppressing genes, breeding materials with application value can be obtained, providing new ideas for crop breeding and the study of gene action mechanism networks.

[0029] Definition of terms involved in this invention

[0030] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains. While any methods, apparatus, and materials similar to or equivalent to those described herein may be used in the practice or testing of this invention, preferred methods, apparatus, and materials are now described.

[0031] In the context of this application, the terms "polynucleotide" or "nucleotide" mean deoxyribonucleotides, deoxyribonucleosides, ribonucleosides, or ribonucleotides and their polymers in single-stranded or double-stranded form. Unless specifically limited, the term covers nucleic acids containing known analogs of natural nucleotides, which have similar binding properties to a reference nucleic acid and are metabolized in a manner similar to naturally occurring nucleotides.

[0032] In this application, the term "homologous gene" refers to two or more gene sequences with a sequence similarity of 80%, including orthologous genes (also known as vertical homologous genes, positive homologous genes, or directed evolutionary homologous genes), transverse homologous genes (also known as paralogous genes, paralogous homologous genes, or parallel evolutionary homologous genes), and / or heterologous genes.

[0033] The term "sequence similarity" refers to the degree of similarity between two sequences. It is a quantitative concept used to compare the similarity between different sequences, thereby discovering and analyzing the association between the two sequences. Sequence similarity can be used to compare gene sequences, protein sequences, DNA sequences, etc.

[0034] The term "strict hybridization conditions" as used in this application refers to conditions of low ionic strength and high temperature known in the art. Typically, under strict conditions, the detectability of a probe hybridizing with its target sequence is significantly higher than that with other sequences (e.g., at least twice the background level). Strict hybridization conditions are sequence-dependent and will vary under different environmental conditions; longer sequences hybridize specifically at higher temperatures. Target sequences that are 100% complementary to the probe can be identified by controlling the strictness of hybridization or washing conditions. Detailed guidance on nucleic acid hybridization can be found in relevant literature (Tijssen, ...). in Biochemistry and Molecular Biology-Hybridization with Nucleic Probes, Figure 1 (Overview of principles of hybridization and the strategy of nucleic acid assays. 1993). More specifically, the stringent conditions are typically chosen to be below the melting point (T0) of the specific sequence at a specified ionic strength pH. m Approximately 5-10℃. m The temperature at which 50% of the probe complementary to the target sequence hybridizes to the target sequence under equilibrium conditions (at specified ionic strength, pH, and nucleic acid concentration) (because the target sequence is present in excess, therefore at T...). mUnder equilibrium conditions, 50% of the probes are occupied. Stringent conditions can be conditions in which the salt concentration is less than about 1.0 M sodium ion concentration, typically about 0.01 to 1.0 M sodium ion concentration (or other salts) at pH 7.0 to 8.3 and the temperature is at least about 30°C for short probes (including, but not limited to, 10 to 50 nucleotides) and at least about 60°C for long probes (including, but not limited to, greater than 50 nucleotides). Stringent conditions can also be achieved with the addition of destabilizing agents such as formamide. For selective or specific hybridization, a positive signal can be at least twice background hybridization, and in some cases 10 times background hybridization. Exemplary stringent hybridization conditions can be as follows: 50% formamide, 5 x SSC and 1% SDS, at 42°C, or 5 x SSC, 1% SDS at 65°C, with wash in 0.2 x SSC and 0.1% SDS at 65°C. The washes can be for 5, 15, 30, 60, 120 minutes or more.

[0035] The term "recombinant expression vector" is one or more DNA vectors used to effect transformation of a plant; these vectors are often referred to in the art as binary vectors. Binary vectors, along with vectors having helper plasmids, are most commonly used for Agrobacterium-mediated transformation. Binary vectors typically include: cis-acting sequences required for T-DNA transfer, a selectable marker engineered to be expressible in plant cells, a heterologous DNA sequence to be transcribed, etc.

[0036] The term "hybridization" is broad hybridization, which refers to the process of combining gametes from different populations or genotypes to produce a hybrid, including both close hybridization and distant hybridization, according to the different genetic relationships of the parents.

[0037] The "mutation" described in the present application refers to a "loss-of-function mutation" or a "loss-of-function mutation", which is a mutation in the coding sequence of a gene that causes the function of the gene product (usually a protein) to decrease or completely disappear. The loss-of-function mutation can be caused by, for example, truncation of the gene product (due to frameshift or nonsense mutation), and the phenotype associated with the allele having the loss-of-function mutation can be recessive or dominant.

[0038] "Overexpression", also known as "overexpression", refers to the process of operably linking the full-length sequence of the target gene to a constitutive promoter, an inducible promoter or a tissue-specific promoter, and transferring it into a plant by transformation technology, so that the gene product accumulates in the plant in large quantities. BRIEF DESCRIPTION OF DRAWINGS

[0039] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.

[0040] ZmMATE40 yes Figure 2 Screening of candidate genes.

[0041] ZmMATE40 Salt treatment Figure 3 The influence of gene transcription levels in different tissues, where Coleoptile refers to the coleoptile; Primary root DZ (Differentiation zone) refers to the differentiation zone of the primary root; Primary root EZ and MZ (Elongation zone and Meristematic zone) refer to the elongation zone and meristematic zone of the primary root; Pooled leaves refer to mixed leaves; Topmost leaves refer to the topmost leaves.

[0042] ZmMATE40 yes ZmMATE40 Schematic diagrams of gene editing vectors and overexpression vectors, where (a) is... ZmMATE40 A schematic diagram of the CRISPR / Cas9 vector, (b) is... Figure 4 (c) is a schematic diagram of the overexpression vector and the gene editing target sequence location and gene editing mutant material type.

[0043] Zmmate40 Wild-type corn and Zmmate40 Phenotypic and phenotypic data statistical analysis of homozygous gene-edited mutant materials and overexpression materials under salt stress conditions, (a) is Zmmate40 (a) Phenotype of mutant material under salt stress; (b) Phenotype of overexpression material under salt stress; (c) Phenotype of mutant material under salt stress. Figure 5 (d) Measurement of plant height and biomass-related indicators of mutant materials under salt stress; where Zmmate40 represents mutant material. ， ZmMATE40-OE represents overexpressed material.

[0044] Zmmate40 Wild-type corn and ZmMATE40 Changes in the expression of chloride ion transport-related genes in gene-edited materials under salt stress. Detailed Implementation

[0045] For the purpose of facilitating the understanding of the present application, a more comprehensive description will be given below. However, the present application can be realized in many different forms and is not limited to the embodiments described herein. On the contrary, the purpose of providing these embodiments is to make the disclosure of the present application more thorough and comprehensive.

[0046] The experimental methods used in the following examples are conventional methods unless otherwise specified; the materials, reagents, etc. used are commercially available unless otherwise specified; quantitative tests are set up with more than 3-5 replicates unless otherwise specified.

[0047] Example 1, Mining salt-tolerant genes ZmMATE40

[0048] Described in the present application Figure 1 The position of the gene on the corn genome is Zm00001eb106010, the genomic DNA sequence is shown as SEQ ID NO: 1, the coding region DNA sequence is shown as SEQ ID NO: 2, and the protein amino acid sequence is shown as SEQ ID NO: 3.

[0049] In order to mine salt-tolerant related genes, 368 materials were subjected to salt tolerance identification, and the correlation between survival rate under high salt stress and genotype was analyzed by using molecular markers, and a plurality of SNP sites significantly associated with salt tolerance were screened (results are shown as ZmMATE40 , wherein one is a DTX / MATE family transporter gene specifically highly expressed in corn roots, ZmMATE40 .

[0050] Example 2, ZmMATE40 More sensitive to salt in the root meristem and differentiation zone

[0051] In order to verify the tissue specificity of ZmMATE40 , the seeds of B73 corn material were placed in 150 mM NaCl aqueous solution, and a group was placed in water as a control, and the long shoots of 4 days after salt treatment, the meristem zone (Meristematic zone MZ), the elongation zone (Elongation zone EZ) and the differentiation zone (Differentiation zone DZ) of the primary root of 7 days, the one core of 9 days and the fourth leaf and its corresponding control of 14 days were taken respectively, and the Figure 2 fluorescent quantitative PCR experiment of the gene was carried out, and the specific primers are: Fw: CAACACCGGCATCCAGTCC (SEQ ID NO: 4); Rv: TAGGAGTACTGCGCGCTTG (SEQ ID NO: 5).

[0052] Rv: TAGGAGTACTGCGCGCTTG (SEQ ID NO: 5).

[0053] The results of the fluorescent quantitative PCR are shown in ZmMATE40 Figure 1, ZmMATE40 The expression is observed in various tissues, and the expression in the root meristem and differentiation zone is significantly increased under salt stress. ZmMATE40 The results show that the expression in the root of the corn seedling is induced by salt signal, and it is inferred that ZmMATE40 may be involved in the response of plants to salt stress. ZmMATE40

[0054] Example 3, ZmMATE40 Obtaining of gene editing material and overexpression material

[0055] Based on the gene structure characteristics of Figure 3 , a CRISPR / Cas9 gene editing vector and an overexpression vector were respectively constructed, and a commercial agency (name: Unime Biotechnology Co., Ltd.) was entrusted to perform genetic transformation with corn inbred line B73 as the receptor. The gene editing vector is shown in (a) of Figure 3 , and the overexpression vector is shown in (b) of Zmmate40 . The target site sequence of the gene editing is:

[0056] Target 1 sequence: GTCGTCGCCGGTCTTGCGGC (SEQ ID NO: 6);

[0057] Target 2 sequence: GCATCCAGTCCCTCGCCTAC (SEQ ID NO: 7).

[0058] Two Zmmate40-1 loss-of-function homozygous gene editing mutants were obtained, which were named Zmmate40-2 and ZmMATE40-OE1 , respectively. Two overexpression materials were obtained, which were named ZmMATE40-OE-2 and Figure 3 . The mutation type of the gene editing mutant is shown in (c) of Zmmate40-1 . Among them, Zmmate40-2 The mutation type of is a frameshift mutation caused by the deletion of 168 bp between target 1 (Target 1) and target 2 (Target 2); ZmMATE40 The mutation type of is a frameshift mutation caused by the deletion of 32 bp at target 1 (Target 1) and the deletion of 5 bp at target 2 (Target 2).

[0059] Example 4, ZmMATE40 Salt stress phenotype of homozygous gene editing material and overexpression material

[0060] In order to verify Figure 4 ​To determine whether the plants responded to salt stress, the inventors subjected the gene-edited mutant materials, overexpression materials, and corresponding control materials to salt stress treatment. Salt treatment was conducted during the germination period of maize seeds. Specifically, the soil was first thoroughly soaked with 100 mmol / L NaCl, and then every 5 days, 100 mmol / L NaCl was poured into the bottom of the seedling trays. The water was drained 12 hours after each pour, and this treatment was continued for 20 days, with continuous observation and recording.

[0061] The specific results are as follows: mmate40-1 As shown in (a)-(d), after treatment with 100 mmol / L NaCl for 20 days, Z mmate40-2 and Z ZmMATE40 The growth of homozygous gene-edited mutant materials was significantly worse than that of wild-type materials, with significantly lower plant height and biomass. However, overexpression materials showed the opposite trend, exhibiting significantly lower growth compared to wild-type materials. ZmMATE40 The plant height and biomass of the gene-overexpressing material were significantly higher than those of the wild type. These results indicate that... ZmMATE40 Genes positively regulate the salt tolerance of maize. Zmmate40 Gene overexpression can enhance the salt stress tolerance of maize.

[0062] Example 5 Zmmate40-1 Homozygous gene-edited mutant materials lead to chloride ion homeostasis imbalance under salt stress

[0063] To verify whether ZmMATE40 enhances salt tolerance by mediating chloride ion transport, the inventors compared salt stress conditions. Zmmate40-1 The expression patterns of chloride ion transport genes in the roots of gene-edited mutants and their corresponding wild-type (WT#1) were selected. ZmActin Gene-edited mutants and their genetically consistent wild-type (WT) plants were selected. Seedlings were cultured under normal conditions for 5 days, then subjected to salt stress treatment in 100 mM NaCl water for 12 h. Root samples were collected for RNA extraction and qRT-PCR experiments. Subsequently, housekeeping genes (…) were used to… ZmCLCs As an internal reference, it targets the chloride ion transport gene family ( Figure 5 Members designed specific primers (primer sequences are shown in Table 1) and performed quantitative real-time fluorescence PCR (qRT-PCR) reactions. The qRT-PCR analysis results showed (results are shown in Table 1). ZmCLCs As shown), most chloride ion transport genes in gene-edited mutant materials ZmCLCs(Zm00001eb235240, Zm00001eb389440, Zm00001eb155530, Zm00001eb184370, Zm00001eb199520, Zm00001eb244120, Zm00001eb252970) expression was significantly down-regulated, only two chloride ion transport genes ZmMATE40 (Zm00001eb034010, Zm00001eb423070) expression was significantly up-regulated, and three chloride ion transport genes (Zm00001eb053800, Zm00001eb068640, Zm00001eb146040) did not change. This result shows ZmMATE40 After the gene is edited, the plant root system under salt stress causes imbalance of chloride ion homeostasis, reduces salt tolerance, and hinders development. The present embodiment proves SEQ ID NO The gene may respond to salt stress by regulating the chloride ion transport network.

[0064] Table 1

[0065] Gene Location Forward Primer (SEQ ID NO) Reverse Primer (SEQ ID NO) chr8:173055544..173062086 CAGTGGTCGAACAACGGGTA (SEQ ID NO: 8) ATCAAGGGCAACGTAGGCAA (SEQ ID NO: 9) Zm00001eb235240 GGGATCGTCGGCTTCTTCAT (SEQ ID NO: 10) 5:108542804..108572765 CACTACCTTGACAGCGAGGG (SEQ ID NO: 11) Zm00001eb389440 TACTTCAACAACGACCGCGA (SEQ ID NO: 12) 9:112544247..112547750 CTGAAGAAGGTGCGCCAAAG (SEQ ID NO: 13) Zm00001eb155530 ACGCCTCAGATGCCACTTAC (SEQ ID NO: 14) 3:210338368..210345013 ​ CAACTGGAAACGCAGGCAAT (SEQ ID NO: 15) Zm00001eb184370 4:140633471..140635684 AGTGTACCCTGCTTTGGGTG (SEQ ID NO: 16) AACAGCAGCCCCAATCATCA (SEQ ID NO: 17) Zm00001eb199520 4:204232675..204237107 CTGAGCGAGATCGAAGGCAT (SEQ ID NO: 18) GTTGCACCGAAACCTTGACC (SEQ ID NO: 19) Zm00001eb244120 5:177701921..177710664 AACGGCACATCGACTGAGTT (SEQ ID NO: 20) GCCAAGTAGGGCAAAAAGGC (SEQ ID NO: 21) Zm00001eb252970 5:211724920..211730886 GAGATCACCCCAAGGCTGAC (SEQ ID NO: 22) GCTTATGACTAACCGCACGC (SEQ ID NO: 23) Zm00001eb034010 1:187960227..187966468 GCAAATGGGTGTGCGGAAAT (SEQ ID NO: 24) AAGGTAGAGTGGCAGCTCAG (SEQ ID NO: 25) Zm00001eb423070 10:121555096..121568805 TCCTATGGGCTACCTTGGCT (SEQ ID NO: 26) GGAACTCATTCTCGGTGCCA (SEQ ID NO: 27) Zm00001eb053800 1:269855601..269882701 CGTTGGCGAAGGTGTACAAT (SEQ ID NO: 28) GTTCAGCAAGCCCCTTACAC (SEQ ID NO: 29) Zm00001eb068640 2:6108814..6115505 GGTGGCAGATGCGTTCAATG (SEQ ID NO: 30) AACCACAGGGAAACCGTTGT (SEQ ID NO: 31) Zm00001eb146040 3:177560742..177565229 GATCTTAGCGCCCAGTACCC (SEQ ID NO: 32) CCAGTTCCAAGTGAGGCCAT (SEQ ID NO: 33)

[0066] The above-described embodiments only express several embodiments of the present application, and the description is more specific and detailed, but it cannot be understood as limiting the scope of the patent of the application. It should be noted that for ordinary skilled persons in the art, without departing from the concept of the present application, a number of modifications and improvements can be made, which are within the scope of protection of the present application. Therefore, the scope of protection of the patent of the present application should be subject to the appended claims.

Claims

1. A method of producing a maize plant, comprising, The corn plant has a phenotype of salt stress tolerance, the method comprising steps of: overexpressing ZmMATE40 gene in corn plant; obtaining at least one seed of the corn plant produced in the above step; the polynucleotide sequence of the ZmMATE40 gene is selected from one of the following group of sequences: (a) the polynucleotide sequence as shown in SEQ ID No: 1 or 2; or (b) the polynucleotide sequence encoding the amino acid sequence as shown in SEQ ID No: 3; or (c) the polynucleotide sequence complementary to the polynucleotide sequence of any one of (a)-(b).

2. The method of claim 1, wherein the overexpression comprises introducing an overexpression vector of functional gene ZmMATE40 into corn plant.

3. The method of claim 2, wherein the overexpression vector further comprises a promoter operably linked to the functional gene nucleotide sequence and increasing the expression amount of the functional gene.

4. The method of claim 3, wherein the promoter is CaMV 35S, Ubiquitin, or Actin1.

5. Use of the method of any one of claims 1-4 in the production of salt stress tolerant corn plant.

6. A feed, meal, protein or oil product made from corn, characterized in that, The feed, meal, protein or oil product contains an overexpression construct of exogenous ZmMATE40 gene, the polynucleotide sequence of the ZmMATE40 gene is selected from one of the following group of sequences: (a) the polynucleotide sequence as shown in SEQ ID No: 1 or 2; or (b) the polynucleotide sequence encoding the amino acid sequence as shown in SEQ ID No: 3; or (c) the polynucleotide sequence complementary to the polynucleotide sequence of any one of (a)-(b).

Images