A gene editing method for obtaining a double-shelled bivalve adult edited body
By using the visual phenotype of the melanin synthesis gene typ2 as a target marker and electrotransfection technology in bivalves, we have achieved efficient screening of adult edited bodies and creation of germplasm materials, solving the problem of difficult adult screening in existing technologies. This method is applicable to a variety of bivalves.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- INST OF OCEANOLOGY - CHINESE ACAD OF SCI
- Filing Date
- 2025-09-26
- Publication Date
- 2026-04-24
AI Technical Summary
Existing technologies make it difficult to efficiently obtain adult edited body materials in bivalve mollusks. Microinjection is difficult, the larval development and planktonic period are long, and the seedling survival rate is low. Electroporation editing is inefficient and difficult to screen in the adult stage.
Using the melanin synthesis gene typ2, which has a visible phenotype, as a target gene marker, multiple sgRNAs targeting sites were designed. Cas9/sgRNAs edited organisms were introduced using an electrotransfection system to achieve high-throughput delivery, and adult edited organisms were screened based on their visual phenotypes.
This breakthrough overcomes the technical bottleneck of limiting gene editing in bivalve mollusks to the larval development stage, enabling efficient screening of adult edited organisms and creation of germplasm materials, applicable to a variety of bivalve mollusks.
Smart Images

Figure CN120866422B_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of gene editing technology, specifically relating to a gene editing method for obtaining adult bivalve mollusks. Background Technology
[0002] Bivalves account for approximately 55% of my country's total marine aquaculture production, and their development faces the critical challenge of needing breakthroughs in precision breeding technology. CRISPR / Cas9-based gene editing technology, with its advantages of simple design, high efficiency, and precise DNA fragment cutting, can provide a new pathway for precision breeding of bivalves. However, the application of gene editing technology in bivalves is severely lagging, facing technical challenges such as the difficulty of microinjection, long larval planktonic development, and low seedling survival rates, making it difficult to obtain adult edited body materials suitable for creating new varieties. Currently, there are two main methods for delivering CRISPR / Cas9 editors in bivalves. One is microinjection. However, because bivalfalfa fertilized eggs are much smaller than zebrafish and gastropod fertilized eggs (about 50 μm), microinjection is difficult, resulting in significant egg damage and low survival rates. Consequently, current reports only cover the larval stage [Yu H, Li H, LiQ, Xu R, Yue C, Du S. Targeted Gene Disruption in Pacific Oyster Based on CRISPR / Cas9 Ribonucleoprotein Complexes. Mar Biotechnol (NY). 2019; Li Q, YuH, Li Q. Dual sgRNA-directed tyrosinases knockout using CRISPR / Cas9 technology in Pacific oyster ( Pacific oyster ) reveals their roles in earlyshell calcification. Gene. 2024; Wang Y, Zhu X, Lian S, Li Y, Hu N, Hu X, BaoZ, Wang S. Functional Characterization of Cfap206[for Bivalve Ciliogenesis by RNAi and CRISPR / Cas9 Technologies. Frontiers in Marine Science. 2022.]. To overcome the challenges of microinjection, electroporation has become a common method for delivering CRISPR / Cas9 editors to bivalve mollusks. Electroporation can generate G0 generation edited organisms in high throughput, but its editing efficiency is significantly lower than that of microinjection, and it requires higher standards for edited organism selection. Currently, gene editing in bivalve mollusks using electroporation is still limited to the larval stage, making it difficult to obtain a large number of adult edited organisms for germplasm creation in a simple and efficient manner [Jin K, Zhang B, Jin Q, Cai Z, Wei L, Wang X, Zheng Y, Huang B, Zhang M, Qi Y, Liu Y, Wang X. CRISPR / Cas9 System-Mediated GeneEditing in the Fujian Oysters ( Angular oyster ) by Electroporation.Frontiers in Marine Science. 2021; Chan J, Zhang W, Xu Y, Xue Y, Zhang L.Electroporation-Based CRISPR / Cas9 Mosaic Mutagenesis of β-Tubulin in the Cultured Oyster, Frontiers in Marine Science (2022)). Summary of the Invention
[0003] The purpose of this invention is to provide a gene editing method for obtaining adult bivalve mollusc edits based on color-visual phenotypes and its application.
[0004] To achieve the above objectives, the technical solution adopted by the present invention is as follows:
[0005] A gene editing method for obtaining adult bivalve edited bodies involves using target genes with visible phenotypes and non-lethal early development as markers, designing target site sgRNAs based on the markers, and then constructing Cas9 / sgRNA edited bodies using an electroporation system to achieve gene editing in bivalve mollusks and obtain adult edited bodies.
[0006] The visual phenotype described is an adult visual phenotype.
[0007] To elaborate further,
[0008] Melanin synthesis genes that exhibit a visible phenotype in the Pacific oyster and are non-lethal during early development.typ2 As a target gene marker, sgRNAs targeting the sites shown in SEQ ID NO:2-4 were designed based on the marker. The sgRNAs and Cas9 protein were then mixed to form a complex. The complex was introduced into fertilized eggs through an electroporation system to achieve gene editing of oysters and obtain edited adult organisms.
[0009] The application of the gene editing method for obtaining adult bivalve edited bodies, and the application of the method in the preparation of germplasm materials of bivalve edited bodies.
[0010] The application of the prepared bivalve edited germplasm material in screening adult bivalve mollusks.
[0011] To go further,
[0012] 1. Targeting the melanin synthesis gene in the Pacific oyster. tyrosinase-like protein 2 / typ2 As a target gene marker, and based on typ2 Three sgRNAs were designed; the sgRNAs and Cas9 protein were mixed at a concentration (ng / μL) ratio of 0.33:0.33:0.34:1 to prepare an sgRNA-Cas9 protein complex; the sgRNA-Cas9 protein complex was introduced into fertilized eggs using an electroporation system to achieve... typ2 Long segment deletion mutations in genes;
[0013] 2. After gene editing, fertilized eggs are cultured to adulthood, and a mosaic mutant phenotype with melanin synthesis defects is observed. Based on this, the adult edited organisms can be screened rapidly for germplasm material creation. DNA is extracted from the adult edited organisms with visible phenotypic defects, the target fragment is amplified by PCR, and the size of the target band is observed by gel electrophoresis to identify the mutant band with long fragment deletions, which can quickly detect genotype mutations.
[0014] Compared with the prior art, the advantages of the present invention are as follows:
[0015] The editing method of this invention is based on the selection of melanin synthesis-related genes that determine the visible phenotype of oyster appearance. tyrosinase-like protein 2 / typ2 Using Cas9 / sgRNAs as target gene screening markers and increasing gene editing efficiency through multiple sgRNA target sites, high-throughput delivery of Cas9 / sgRNA edited bodies is achieved using an electrotransfection system. Adults with clearly visible phenotypes are selected for genotypic and phenotypic analysis. This invention overcomes the technical bottleneck of existing bivalve gene editing methods, which are limited to the larval development stage and face difficulties in screening adult edited bodies. It provides a new technical system for the creation of bivalve edited body germplasm materials and can be used for F1 generation breeding and germplasm material creation. Furthermore, in addition to oysters, this method is also applicable to other bivalve mollusks with small fertilized eggs, difficult microinjection, and high larval mortality rates. Attached Figure Description
[0016] Figure 1 The long oyster provided in the embodiments of the present invention typ2 gene sgRNA design site map.
[0017] Figure 2 The long oyster provided in the embodiments of the present invention typ2 A comparison of shell color phenotypes in gene-edited adults with melanin synthesis defects.
[0018] Figure 3 The long oyster provided in the embodiments of the present invention typ2 Genotypic mutations detected in gene-edited adults, where 'a' represents wild-type and edited organisms. typ2 Agarose gel electrophoresis bands of the gene, b represents wild-type and edited variants. typ2 Gene sequencing peak diagram (WT: wild type; mKO: mosaic mutant). Detailed Implementation
[0019] Unless otherwise stated, the terms used in this invention generally have the meanings commonly understood by those skilled in the art.
[0020] The present invention will now be described in further detail with reference to specific embodiments and data. These embodiments are merely illustrative and are not intended to limit the scope of the invention in any way.
[0021] This invention selects melanin synthesis-related genes that determine the visible phenotype of oysters. typ2 As a target gene screening marker, based on the high-throughput exogenous macromolecule delivery technology based on the electrotransfection system, and in conjunction with the establishment of a high-throughput adult edit body based on the shell color visual phenotype, this invention breaks through the technical bottleneck of existing bivalve gene editing being limited to the larval development stage and the difficulty in screening adult edit bodies, and provides a new technology system for the creation of bivalve edit body germplasm materials.
[0022] Example 1
[0023] The CRISPR / Cas9 gene knockout method for rapidly obtaining genotypic and phenotypic mutations involves the following steps:
[0024] (1) Melanin synthesis-related genes that determine the visual phenotype of oyster appearance based on selection tyrosinase-like protein 2 / typ2 Constructing long oysters typ2 The three sgRNAs of the gene ( Figure 1 );
[0025] Oyster typ2 The coding region sequence is as shown in SEQ ID NO:1:
[0026] SEQ ID NO:1:
[0027] atgatcacaaattactcttaccttttttttttggtttggctttatgcctaccctttt 60
[0028] ttcggaaaagttcaggagatacaaacacccatagagctgcaggaatgttttttctataaa 120
[0029] tctttaaatacgagcgtagctgaagttcccggaaagttaatcgaagatttctgtctccgg 180
[0030] aaatactccctttcacagtatgaggaaaatacacagaagaacatcagtgcagagggagtt 240
[0031] cgttatttagaatccctttaccgtcagattgatgcggagacacaactgaccagaaaaaag 300
[0032] cgtcagaccaccgctacatggcgtgtaagaagcgagattagaacactatctgcagtacaa 360
[0033] cggaacaggattttcggttgcttaaatcgactaaaaagagattttgtaagtacatttgaa 420
[0034] aatctaatgcaaatatatttactttattatgtcaccttgtcaataaaagatgttaaatat 480
[0035] attatgcacactgccattaaaatgggttttttaaaattctttaaagttcttcccttagtt 540
[0036] tattgattaaattcaaaataaatgtacaaaattataactttattcttatttcagacaaat 600
[0037] cgatcggacaagaagtatttacgacttaattgggtcattgcactctggacaagctgccaca 660
[0038] gctgatgcataatgggcccggattcttggtagacatgcactatatgtgctagcgtaagt 720
[0039] ttcattgaaatcgctaaactgttttcaaatatataaaaaaaaataaagttttttatttt 780
[0040] ttctgatgtctgttgtctgtacttacagattggaaacagcttgtcgaacacccatcccat 840
[0041] actgggacttcatgatggacggagcaatgaatcgacttcttcagctatttggtcaa 900
[0042] atactttctttggaaatggaaatgggccagtaaggacaggttctgtgggcaactgggtga 960
[0043] cgccccaaatactcccatcatcagaaatgttggtgcaggtataaagaaagaatcgtctt 1020
[0044] attaatttacacgacactcaataattttcaagttaattatttaaatgtttggttgt 1080
[0045] tttacattccagatacaagttacgcaatcatttaaatgcttaattttttttttta 1140
[0046] ttaaaggtggtgttcgattacccagacgagat gccctcagagctcttatgagcagaacta 1200
[0047] ggacaagcgaaattaccgaaccgcaaccggcaatgagtgtgttttcttattgaagttcacc 1260
[0048] ataatgccgttcataaccacatagatggtcatttttcagcccttgatacctcgacctttg 1320
[0049] atcctgttttctggttcctacattcaatgttccattatatgtggtacatgtttaaaaaca 1380
[0050] atcaaagagcaagaggagttgacccccaacgtgattatccaagaggaccaaatgttcctc 1440
[0051] agggtcatgaatttttccaaagagtaaactttatgccttttgtacgaccaatgacaaatt 1500
[0052] tggagacattctctgatagatatgatagaatcgtacgttacactccattacctagatgcc 1560
[0053] caacgtgtggaggaagtccatacttagtctgccttcaaggagtatgtgtagctcgatcaa 1620
[0054] gaggaactggaaacattcctagtttagtcagacgaccaacaggtttgcgacgcgttagaa 1680
[0055] ctattgttcgcggcaaacgtagtgcaaatatcgataataattcagttatgttacagagcc 1740
[0056] atgctgaagctctttcagcgttggatagatcttacacgaacacactcatgattaatggtc 1800
[0057] attatactcctaaagaatgggtttatttgaatgtacgtgtaatatatgaacgcccaaaaa 1860
[0058] gtgatgttttcaactcaacagttgatgcccgtgatatgtatgatccttcaagtttttacg 1920
[0059] atggcggaaaagaattaggtatcaataatcgtgttttatacaaacaaagatgtgaaccgt 1980
[0060] cgggttctggggccacaaaagtctttgttcaatccgatggtttaaattatcacggaagat 2040
[0061] acaaagaattcgccattttagacgaacgccaagctgtatcttctgcaattgtccaagttg 2100
[0062] ctgtacgaaaaccgtctgatgaaaacagtaacgcatatctttctgcttatgatagttgtg 2160
[0063] gccgagtttgtcgaccagtatgttccgtacaaaaagggtcttcatctgcgtacaaagctt 2220
[0064] gttcaggaagttttaagattacaaatgaatatccattgatgtacaggaaaagttatgagt 2280
[0065] cggccatcagttctctttggcatcttagtttagatggcaaaggaccattgtttacaaatc 2340
[0066] atttctcctctattacttttatttgtgaccaccaaaatttatggccttggtcgaaatag 2399
[0067] sgRNA sequence 1: 5'-GGGAAATCTTCGATTAACTTTC-3' (SEQ ID NO:2);
[0068] sgRNA sequence 2: 5'-GGACAGGTTTCTGTGGCAAC-3' (SEQ ID NO:3);
[0069] sgRNA sequence 3: 5'-GGGATCAAAGGTCGAGGTATCA-3' (SEQ ID NO:4).
[0070] (2) Introduction of exogenous editor into fertilized eggs
[0071] The above-designed total amount of different sgRNAs was mixed with Cas9 protein at a concentration ratio (ng / μL) of 1:1 to prepare sgRNA and Cas9 protein complexes. The three different sgRNAs were mixed at equal concentrations. Then, 70 μL of an electroporation system containing the sgRNA & Cas9 protein complex was prepared and transferred into 30 μL of fertilized eggs under electroporation conditions of 40V / 50ms. The electroporation system containing the sgRNA & Cas9 protein complex consisted of electroporation buffer plus the sgRNA & Cas9 protein complex, with a protein complex concentration of 30 ng / μL and an electroporation buffer of 33‰ artificial seawater.
[0072] (3) Larval culture
[0073] After electroporation, fertilized eggs were incubated in natural seawater at 26°C with continuous micro-aeration at a density of 20-30 eggs / mL. After 20 hours of incubation, D-type larvae were selected using a 300-mesh sieve to remove slow-developing and deformed larvae. The larvae were then transferred to a 100-liter plastic container filled with natural seawater for further cultivation at 24–26°C. The filtered seawater was changed every other day, with half the volume replaced each time, and the temperature difference between the replacement and replacement water not exceeding 2°C. The larvae were fed three times daily, with an appropriate amount of *Isochrysis galbana* added daily based on larval density changes. Isochrysis galbana Combined with feeding Chaetoceros muelleri ( Chaetoceros muelleri During the late stage of larval development to the apical larval stage, feeding with flat algae ( Platymonas sp. The aeration, water changes, and feeding processes were kept consistent (the culture method followed conventional procedures). Finally, the gene-edited oyster larvae developed into eyespot larvae, extending their distinctive appendages. They were then placed in an appropriate amount of bay fan attachment substrate. After the larvae completed their attachment and metamorphosis, they were temporarily raised for about 15 days before being transferred to offshore hanging cage culture.
[0074] (4) Screening of edited adult phenotypes
[0075] Five-month-old gene-edited adult oysters were screened to obtain edited variants (mKOs) with visualized phenotypes; that is, changes in the black and white shell color of the oyster, such as... Figure 2 As shown, the wild-type parent has a black shell, as indicated above. typ2 After gene editing, the edited organism has a defect in melanin synthesis, which changes the shell color, making the edited organism white.
[0076] (5) Genotype verification of edited organisms obtained by screening for visible shell color phenotypes
[0077] Samples were taken from 5-month-old adult *Crassostrea gigas* oysters that had undergone gene editing. Mantle samples were collected for genotyping. DNA was extracted from the samples using a chemical lysis method. The lysis buffer formulation was as follows: 10 μL 1M potassium chloride; 6 μL 10% NP-40; 5 μL 20 mg / ml proteinase K; 2.2 μL 0.9M tris(hydroxymethyl)aminomethane hydrochloride (pH 8.0); 0.6 μL Tween-20; 0.4 μL 0.5M EDTA (pH 8.0), and the volume was adjusted to 200 μL. 100 μL of lysis buffer was used for each reaction. The mantle membranes of each edited adult oyster were collected into a centrifuge tube, and 100 μL of lysis buffer was added. The mixture was incubated at 55°C for 2 h, with vortexing every 30 min to ensure complete lysis. Lysis was terminated by incubating at 98°C for 5 min to obtain genomic DNA.
[0078] The following primer pairs were used to amplify sites containing the target gene:
[0079] Typ2_GT_F1: 5'-ATGATCACAAATTACTCTTACCTTT-3' (SEQ ID NO: 5);
[0080] Typ2_GT_R1: 5'-CTATTTCGACCAAGGCCATA-3' (SEQ ID NO: 6).
[0081] PCR program settings: 95℃ for 5 min; 95℃ for 30 s, 52℃ for 30 s, 72℃ for 2 min, 35 cycles; 72℃ for 10 min. Agarose gel electrophoresis showed a decrease in the length of the target gene fragment. Figure 3 As shown in Figure a, the PCR product was purified by gel extraction, ligated, transformed, and single clones were selected and sent to a sequencing company for sequencing. A 915bp deletion was detected by F1 / R1 amplification and sequencing results. The deletion mutant peak is shown in Figure a. Figure 3 As shown in b.
[0082] In summary, the technical system for constructing adult bivalve edited bodies using the method of this invention is based on the selection of melanin synthesis-related genes that determine the visible phenotype of oyster appearance. typ2 Using Cas9 / sgRNAs as target gene screening markers and increasing gene editing efficiency through multiple sgRNA target sites, high-throughput delivery of Cas9 / sgRNA edited organisms is achieved via electrotransfection. Adults with clearly visible phenotypes are selected for genotypic and phenotypic analysis to obtain gene-edited bivalve mollusks. This invention can detect phenotypic and genotypic mutations in adults and can be used for rapid screening of edited organism germplasm materials. This invention overcomes the technical bottleneck of existing bivalve mollusk gene editing methods, which are limited to the larval development stage and make adult selection of edited organisms difficult, providing a new technological system for the creation of bivalve mollusk edited organism germplasm materials.
[0083] The above description is merely a preferred embodiment of the present invention and is not intended to limit the invention in any other way. Any person skilled in the art may make changes or modifications to the above-disclosed technical content to create equivalent embodiments. However, any simple modifications, equivalent changes, and modifications made to the above embodiments based on the technical essence of the present invention without departing from the scope of the present invention shall still fall within the protection scope of the present invention.
Claims
1. A gene-editing method for obtaining adult bivalve mollusks, characterized in that: Melanin synthesis genes that exhibit a visible phenotype in the Pacific oyster and are non-lethal during early development. typ2 As a target gene marker, sgRNAs targeting the sites shown in SEQ ID NO:2-4 were designed based on the marker. The sgRNAs and Cas9 protein were then mixed to form a complex. The complex was introduced into fertilized eggs through an electroporation system to achieve gene editing of oysters and obtain edited adult organisms.
2. The gene editing method for obtaining adult bivalve mollusks according to claim 1, characterized in that: The visual phenotype described is an adult visual phenotype.
3. The application of the gene editing method for obtaining adult bivalve edit bodies as described in claim 1 in the screening of bivalve edit body germplasm materials.
Citation Information
Patent Citations
Electroporation gene editing method of crassostrea gigas beta-tubulin gene and application
CN114703231A