SNP (Single Nucleotide Polymorphism) molecular marker related to pig backfat thickness and application of SNP molecular marker

Abstract

The invention is suitable for the technical field of molecular genetics, and provides an SNP molecular marker related to pig backfat thickness and application thereof. The invention studies and determines that the pig backfat thickness related molecular marker is located at the 95583333rd site (corresponding to the 701st basic group A / G mutation of SEQ ID NO: 1) of the No.18 chromosome of the international pig reference genome version 11.1, and verifies the influence effect of the molecular marker on the pig backfat thickness character. And when the basic group at the site is A, the pig has lower back fat thickness. On the basis, a molecular marker-assisted selection breeding technology for rapidly improving the backfat thickness character of the pig is established, the frequency can be increased generation by generation by optimizing the dominant allele (A), the backfat thickness of the breeding pig is remarkably reduced, the genetic improvement process of commercial pig herds containing landrace and large white pig blood lineage is accelerated, and the breeding efficiency is improved; the sales profit is increased for enterprises, the core competitiveness is improved, and the economic benefits of commercial pigs are improved.

Description

Technical Field

[0001] This invention belongs to the field of molecular genetics technology, and in particular relates to a SNP molecular marker related to backfat thickness in pigs and its application. Background Technology

[0002] Pigs, as a key species in my country's livestock industry, are an important source of animal protein for residents. In recent years, with changes in residents' dietary patterns and increased health awareness, the pork consumption market has undergone structural changes. Consumers' demand for lean pork products that are "high in protein and low in fat" has surged, making the study of backfat thickness, an important trait in pigs, increasingly crucial in the field of animal husbandry. Backfat thickness, as a core trait indicator of pig carcass, is mainly composed of lipid components such as triglycerides (TG). Its value directly reflects the pig's fat deposition capacity. It is not only an important economic trait but also has complex quantitative genetic characteristics, directly affecting the economic benefits of the pig farming industry, and has become a core breeding target for the genetic improvement of commercial pig breeds.

[0003] In the field of animal genetic improvement, single nucleotide polymorphisms (SNPs) are important genetic variations, referring to single-base differences at the same nucleotide site in the genomic DNA sequence of different individuals due to base transitions (such as C / T or G / A types) or base transversions (such as C / G, C / A, T / A, or T / G types). SNP-based genetic marker systems, combined with marker-assisted selection technology, have significantly improved the efficiency and accuracy of animal breeding programs. In recent years, SNP-based molecular marker technologies have been continuously improved, providing novel genomic selection strategies for animal breeding and driving innovation in traditional breeding methods towards precision and efficiency. Meanwhile, genome-wide association studies (GWAS), as a core method for elucidating the genetic mechanisms of complex quantitative traits, provide important genetic evidence for marker-assisted selection breeding by screening genetic variation sites significantly associated with target traits at the whole-genome scale.

[0004] However, although researchers have identified several molecular markers significantly associated with backfat thickness in pigs, these markers generally exhibit population specificity, and their stability and applicability require validation across multiple populations. This situation hinders in-depth analysis of the genetic mechanisms underlying backfat thickness in pigs and limits the development and implementation of precise and efficient breeding strategies. Therefore, this invention proposes a SNP molecular marker associated with backfat thickness in pigs and its application. Summary of the Invention

[0005] The purpose of this invention is to provide a SNP molecular marker related to backfat thickness in pigs and its application, aiming to solve the problems mentioned in the background art.

[0006] The objective of this invention is achieved through the following technical solution: A SNP molecular marker associated with backfat thickness in pigs, wherein the SNP molecular marker is located at locus 9558333 on chromosome 18 of the International Pig Reference Genome Version 11.1, and the sequence of the SNP molecular marker is shown in SEQ ID NO:1. The locus contains an A / G allele mutation (the 701st base from the 5' end of the sequence shown in SEQ ID NO:1 is A or G), and the base polymorphism at the locus leads to differences in backfat thickness in pigs.

[0007] A method for screening pig breeds with low backfat thickness includes the following steps: For the pigs to be tested, the genotypes of the SNP molecular markers described above are tested, and individuals with the AA genotype at the locus are selected as breeding pigs; The pig breeds mentioned are commercial pig herds containing both Landrace and Large White bloodlines.

[0008] A method for marker-assisted breeding of pigs includes the following steps: When testing pigs for the genotype of the SNP molecular markers described above, individuals with the AA genotype should be prioritized for breeding to produce breeding pigs with lower backfat thickness.

[0009] The pig breeds mentioned are commercial pig herds containing both Landrace and Large White bloodlines.

[0010] Furthermore, the step of detecting the genotype of the SNP molecular marker includes: Step 1: Genomic DNA extraction; Genomic DNA was extracted from the pig samples to be tested using standard molecular biology techniques. Step 2: PCR amplification of the target region; Using primer pairs with nucleic acid sequences as shown in SEQ ID NO:2 and SEQ ID NO:3, PCR amplification was performed on the pig genomic DNA to be tested to obtain amplification products covering the target genomic region. Step 3: Sanger sequencing analysis; Sanger sequencing was performed on the PCR amplification products; Step 4: SNP genotype determination; Based on the sequencing results, the genotypes of SNP molecular markers in the pigs to be tested were determined.

[0011] A method for genetic improvement of pigs includes the following steps: Determine the genotypes of the SNP molecular markers as described above in the core breeding pig herd, select breeding pigs with AA and AG genotypes, and cull breeding pigs with GG genotypes, in order to increase the frequency of allele A in the population generation by generation, thereby reducing the backfat thickness of offspring pigs. The pig breeds mentioned are commercial pig herds containing both Landrace and Large White bloodlines.

[0012] The application of a primer pair for detecting SNP molecular markers as described above in identifying backfat thickness-related traits in pigs, screening pig breeds with low backfat thickness traits, or reducing backfat thickness in pigs to increase lean meat percentage, wherein the nucleic acid sequences of the primer pair are shown in SEQ ID NO:2 and SEQ ID NO:3; wherein the backfat thickness of the AA genotype is lower than that of the GG and GA genotypes; The pig breeds mentioned are commercial pig herds containing both Landrace and Large White bloodlines.

[0013] A kit for detecting SNP molecular markers as described above is disclosed for the application of identifying backfat thickness-related traits in pigs, screening pig breeds with low backfat thickness traits, or reducing backfat thickness in pigs to increase lean meat percentage. The kit comprises primer pairs with nucleic acid sequences as shown in SEQ ID NO:2 and SEQ ID NO:3; wherein the backfat thickness of the AA genotype is lower than that of the GG and GA genotypes. The pig breeds mentioned are commercial pig herds containing both Landrace and Large White bloodlines.

[0014] Compared with the prior art, the beneficial effects of the present invention are: 1. This invention studied and identified a molecular marker related to backfat thickness in pigs located at locus 9558333 on chromosome 18 of the International Pig Reference Genome Version 11.1 (corresponding to an A / G mutation at base 701 of SEQ ID NO:1), and verified its effect on the backfat thickness trait. When the base at this locus is A, pigs have lower backfat thickness. Based on this, this invention establishes a molecular marker-assisted selection breeding technology for rapidly improving the backfat thickness trait in pigs. By selecting the dominant allele (A), its frequency can be increased generation by generation, significantly reducing backfat thickness in breeding pigs and accelerating the genetic improvement process. This technology greatly improves the breeding efficiency of commercial pig herds containing Landrace and Large White bloodlines, increasing sales profits and enhancing core competitiveness for enterprises.

[0015] 2. This invention constructs a pig breeding system based on target SNP marker-assisted selection (MAS). For commercial pig herds containing Landrace and Large White bloodlines, it preferentially screens for the dominant allele (A) at the target locus (18:9558333), accelerating genetic progress in the pig herd. Systematic application of this technology can significantly improve the economic benefits of breeding pigs and ultimately enhance the economic benefits of commercial pigs. Attached Figure Description

[0016] Figure 1 Genome-wide association study (GWAS) plot of backfat thickness trait on chromosome 18 in commercial pig populations containing Landrace and Large White bloodlines; where: the horizontal axis represents the chromosome number of the pig; the vertical axis represents -log 10 ( p ).

[0017] Figure 2 Box plot of backfat thickness breeding value for individuals with different genotypes at SNP locus 18:9558333.

[0018] Figure 3 The figure shows the phenotypic differences in backfat thickness among pigs of different genotypes; (A) represents the AA genotype (single-peak T base); (B) represents the GG genotype (single-peak C base); and (C) represents the AG genotype (bimodal C and T base). Detailed Implementation

[0019] In order to provide a clearer understanding of the technical features, objectives and beneficial effects of the present invention, the technical solution of the present invention will now be described in detail below, but it should not be construed as limiting the scope of implementation of the present invention.

[0020] The specific implementation of the present invention will be described in detail below with reference to specific embodiments.

[0021] Unless otherwise specified, the experimental methods used in the following examples are conventional methods.

[0022] Experimental pig herd: This experiment used a commercial pig herd containing Landrace and Large White bloodlines, totaling 439 individuals as research subjects.

[0023] Example 1: The process of measuring factors affecting backfat thickness; (1) Test materials; This invention uses 439 commercial pigs of Landrace and Large White lineage as experimental subjects. Backfat thickness data were collected by performing slaughter measurements on these 439 pigs.

[0024] (2) Phenotypic trait determination; After the pigs are slaughtered, the backfat thickness at the loin-sac junction is measured using vernier calipers, and the corresponding data is recorded.

[0025] (3) Sample collection; The obtained pork tissue samples were immersed in a 75% ethanol solution and then stored in a -20°C refrigerator for later use.

[0026] Example 2: The invention process of gene markers; (1) Genomic DNA extraction: Genomic DNA was extracted from the above pork tissue samples according to the standard operating procedure of the DNA extraction kit. The concentration and purity of the extracted DNA samples were detected by ultraviolet spectrophotometer. The DNA concentration was above 50 ng / μL, the purity A260 / 280 value was about 1.8~2.0, and the A260 / 230 ratio was about 1.7~1.9, which met the requirements of subsequent experiments. The extracted samples were stored in a -20℃ refrigerator.

[0027] (2) Pig whole genome 50K SNP genotyping: Genotyping of samples was performed using a 50K chip. Autosomal SNPs were retained, and the obtained genotyping data were quality controlled using PLINK software, including the removal of SNPs with a minor allele frequency (MAF) < 5% and a genotyping rate < 90%. Missing genotypes were filled using BEAGLE (version 5.4; beagle.29Oct24.c8e.jar) software. A total of 45,487 SNPs were retained for subsequent analysis.

[0028] (3) Genome-wide association analysis (GWAS): 439 commercial pigs of Landrace and Large White ancestry were studied. Phenotypic analysis of this population showed that the average backfat thickness (BF) was 19.36 mm. The heritability (h) of this trait was estimated. 2 The estimated value is 0.374, indicating that the backfat thickness trait is greatly influenced by genetic factors, and there is a basis for improving the trait through molecular marker-assisted selection.

[0029] Using breeding value as the response variable, GWAS analysis was performed using the BLINK (Bayesian-information and Linkage-disequilibrium Iteratively Nested Keyway model) model from the GAPIT software package in R. The top three principal components with the largest corresponding eigenvalues ​​were used as covariates to control for population structure.

[0030] GWAS analysis identified three SNPs significantly associated with backfat thickness. Among them, the QTL at nucleotide position 9558333 on chromosome 18 of the International Swine Reference Genome Version 11.1 (18:9558333, corresponding to base position 701 of SEQ ID NO:1 (A / G mutation), denoted as g.9558333 A>G) was the most significantly associated site. Figure 1 () p =2.73×10 -12(Table 1). At this locus, the mean breeding value of individuals with the AA genotype was -0.651, lower than that of individuals with the AG (0.294) and GG (0.759) genotypes (Table 1). Box plot analysis was performed on the estimated backfat thickness of individuals with different genotypes (AA, AG, GG) at this locus using R software. Figure 2 The results showed that individuals with the AA genotype had lower backfat thickness than those with the GG and GA genotypes. These results indicate that the A allele is the dominant allele for the backfat thickness trait. This finding demonstrates that this molecular marker can significantly influence the backfat thickness trait in commercial pig herds containing Landrace and Large White bloodlines. Marker-assisted selection at this SNP locus can reduce population backfat thickness and accelerate the breeding process for this trait in pigs.

[0031] Table 1. Correlation analysis of SNP site 18:9558333 of molecular marker with backfat thickness trait.

[0032] Example 3: Amplification and sequencing of the target DNA sequence; (1) Primer design; The DNA sequence of SEQ ID NO:1 on pig chromosome 18 was downloaded from the Ensembl website (http: / / asia.ensembl.org / index.html). Primers were designed using SnapGene software, and the sequences are as follows: P001-F: 5'-TCCATTTGCCTCGAGAAGTGGC-3' (as shown in SEQ ID NO:2); P002-R: 5'-GTCACTCCTCCAGGAACTGGT-3' (as shown in SEQ ID NO:3); This primer pair can be used for subsequent SNP genotyping, providing a tool for molecular marker-assisted selection.

[0033] The DNA sequence of SEQ ID NO:1 is as follows: TCCATTTGCCTCGAGAAGTGGCCCTAGAAAAGGCAAAAAGACAAAAAATAAAATAAAAAAATAATCCATCCAGTCTATAGCATTTGATACAGCAGCACAAGCTGATCAAAGCAATATTATTTGGATGGGATAAATGTTTAAATGGGTGGACCTTGGGAGTTCCTGTTGTGGCTCAGCAGTAGTGAACCCAGCTAGTATCCATGAGGATGTGGGTTCAATTCCTGGCCTCACTTGATGGGTTAAATATGCAGCATTGCCATGAGCTGTGGCATAGGCTGGCAGCTGCAGCTCTGATTGACCCCTAGACTGGGAACTTCCATATGCTGCATGTGCAGCCCTAAGCAAAAGAAAAAAAAAGGGTGGACTTTAAGAAAGCAGATTGCCCTCCATAATATGGGTGGGCCTGACACAATCAGTTGATGGCCTTAAGAAAAAGACCAATCACTCTTGAGGAAGAGGGAAATCTGCCAGCAGACTGCCTTCAGGCTCGAGCTGCAACAGCAGCTCTTCCCTGGGTCTCCAGCCTATCAGCCTACCTTGCAGATTTTTGGCTTTGTCAAAAGCCAAATACACACACACACACACACACACACACAAAATTCAGGGGACGATGGGGACCCCCTAAAGTTTCATGAGCAGGTCAGTGTAGATCAGTGAGTTGTTTTAGGAAGATGCTCTGAGCTGAACTGGAGGAATGAGA r(A / G).

[0034] Note: Mutation sites are marked with r and underlined, and alleles (A / G) are in parentheses; primer design positions are shown in bold at the beginning and end of the sequence.

[0035] (2) PCR amplification; The reaction mixture consisted of 25 μL of DNA template, 8 μL of double-distilled water, 13 μL of 2×Phanta Flash Master Mix, and 1 μL each of primers P001-F and P002-R. The PCR conditions were: 98℃ pre-denaturation for 30 s, 98℃ denaturation for 10 s, 62℃ annealing for 5 s, and 72℃ extension for 7 s, for 30 cycles, followed by a final extension at 72℃ for 1 min. The mixture was then stored at 4℃.

[0036] (3) DNA sequencing; Reverse single-reaction sequencing is performed on gene fragments, and the sequenced data is compared with the NCBI genome sequence to identify mutations at corresponding SNP sites. Because it is reverse sequencing, if the sequencing result for site g.9558333 shows a single T base, such as... Figure 3As shown in (A), its genotype is AA; if the detection result of this locus is a single peak of C bases, as shown in (A), its genotype is AA. Figure 3 As shown in (B), its genotype is GG; if the detection result at this site is a bimodal C and T base pair, as shown in (B), then the genotype is GG. Figure 3 As shown in (C), its genotype is AG individual.

[0037] Example 4: Analysis of the A>G effect of SNP site g.9558333 on molecular markers; According to Table 1 and Figure 2 The statistical results showed that the mean backfat thickness phenotype of individuals with the dominant allele (AA) at the SNP locus g.9558333 A>G was 18.22 mm, with an estimated breeding value of -0.65, which was significantly lower than that of the GG genotype (mean phenotype 20.82 mm, estimated breeding value 0.759). This indicates that the AA genotype has a positive genetic effect on reducing backfat thickness, and the A allele at this locus is the dominant allele for the backfat thickness trait.

[0038] In individual pigs, marker-assisted selection by screening for the dominant allele (A) at this SNP locus can target and reduce backfat thickness in commercial pigs, increase lean meat percentage, and thus improve the economic benefits of the pig farming industry. The specific screening steps are as follows: Genomic DNA was extracted from the pig samples to be tested using standard molecular biology techniques. PCR amplification was performed using primer pairs SEQ ID NO:2 and SEQ ID NO:3; The amplification products were subjected to Sanger sequencing to determine the SNP genotype at the 9,558,333rd nucleotide site on chromosome 18 in the pig genome to be tested. Prioritizing individuals with the AA genotype for breeding can produce pigs with lower back fat thickness.

[0039] In addition, in the core breeding pig population, individuals with the GG genotype at nucleotide position 9558333 on chromosome 18 according to the International Swine Reference Genome Version 11.1 were culled, while individuals with the AA and AG genotypes were retained to increase the frequency of allele A in the population generation by generation, thereby reducing the backfat thickness of offspring pigs.

[0040] This invention provides a new molecular marker for marker-assisted selection in pigs by detecting the mutation site at position 701 in the SEQ ID NO:1 sequence and analyzing the association between its genotype and backfat thickness trait. This has important application significance for promoting precision breeding.

[0041] The above are merely preferred embodiments of the present invention. It should be noted that those skilled in the art can make several modifications and improvements without departing from the concept of the present invention, and these should also be considered within the scope of protection of the present invention. These modifications and improvements will not affect the effectiveness of the implementation of the present invention or the practicality of the patent.

Claims

1. A SNP molecular marker associated with backfat thickness in pigs, characterized in that, The SNP molecular marker is located at position 9558333 on chromosome 18 of the International Pig Reference Genome Version 11.

1. The sequence of the SNP molecular marker is shown in SEQ ID NO:

1. The site has an A / G allele mutation, and the base polymorphism at the site leads to the difference in backfat thickness in pigs.

2. A method for screening pig breeds with low backfat thickness, characterized in that, Includes the following steps: The genotype of the SNP molecular marker as described in claim 1 is detected in the pigs to be tested, and individuals with the AA genotype at the locus are selected as breeding pigs.

3. A method for marker-assisted breeding of pigs, characterized in that, Includes the following steps: When testing the genotype of the SNP molecular marker as described in claim 1, individuals with the AA genotype are preferentially selected for breeding to produce breeding pigs with lower backfat thickness.

4. The method according to claim 2 or 3, characterized in that, The steps for detecting the genotype of the SNP molecular marker include: Step 1: Genomic DNA extraction; Genomic DNA was extracted from the pig samples to be tested using standard molecular biology techniques. Step 2: PCR amplification of the target region; Using primer pairs with nucleic acid sequences as shown in SEQ ID NO:2 and SEQ ID NO:3, PCR amplification was performed on the pig genomic DNA to be tested to obtain amplification products covering the target genomic region. Step 3: Sanger sequencing analysis; Sanger sequencing was performed on the PCR amplification products; Step 4: SNP genotyping; Based on the sequencing results, the genotypes of SNP molecular markers in the pigs to be tested were determined.

5. A method for genetic improvement of pigs, characterized in that, Includes the following steps: The genotypes of the SNP molecular markers as described in claim 1 are determined in the core breeding pig herd. Breeding pig individuals with AA and AG genotypes are selected, while breeding pig individuals with GG genotypes are culled, so as to increase the frequency of allele A in the population generation by generation, thereby reducing the backfat thickness of offspring pigs.

6. The application of a primer pair for detecting the SNP molecular marker as described in claim 1 in identifying backfat thickness-related traits in pigs, screening pig breeds with low backfat thickness traits, or reducing backfat thickness in pigs to increase lean meat percentage, characterized in that... The nucleic acid sequences of the primer pairs are shown in SEQ ID NO:2 and SEQ ID NO:3; wherein, the back fat thickness of the AA genotype is lower than that of the GG and GA genotypes.

7. The application of a kit for detecting the SNP molecular marker as described in claim 1 in identifying backfat thickness-related traits in pigs, screening pig breeds with low backfat thickness traits, or reducing backfat thickness in pigs to increase lean meat percentage, characterized in that... The kit includes primer pairs with nucleic acid sequences as shown in SEQ ID NO:2 and SEQ ID NO:3; wherein the back fat thickness of the AA genotype is lower than that of the GG and GA genotypes.

Images