Method for rapidly detecting transgenic crops in batches
By using multi-well plate array processing and digital interpretation technology, the problems of low efficiency and inconsistent results in existing genetically modified crop testing have been solved, achieving efficient and accurate batch testing.
Patent Information
- Application Number
- CN202511384632.7
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-09-26
- Publication Date
- 2025-10-31
- Estimated Expiration
- 2045-09-26
AI Technical Summary
Existing methods for detecting genetically modified crops rely on manual operation, resulting in low detection efficiency, inability to process multiple samples simultaneously, and the inconsistency of sample pretreatment and the risk of cross-contamination affect the accuracy and consistency of test results.
The process employs a multi-well plate array, combined with mechanized grinding, batch liquid addition, and centrifugation techniques to ensure uniform sample breakage and impurity precipitation and separation. Image acquisition equipment and digital interpretation technology are used to improve detection efficiency and accuracy.
It has enabled efficient and large-scale testing of genetically modified crops, improved the throughput and reliability of results, and ensured the consistency of sample processing and the accuracy of test results.
Smart Images

Figure CN120870547A_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of plant transgenic detection technology, specifically a method for rapid, large-scale detection of transgenic crops. Background Technology
[0002] Currently, the commonly used method for on-site or preliminary screening of genetically modified crops is the test strip method based on colloidal gold immunochromatography. This method is widely used in fields, purchasing stations, and the front lines of production and processing due to its advantages of simple operation, no need for complex instruments, relatively low cost, and rapid qualitative results. The traditional test strip method typically involves: sampling the crop tissue to be tested, then manually grinding the sample in a sample bag or centrifuge tube using a hand grinder, adding a suitable buffer solution, and shaking to extract the target protein. Finally, the test strip is inserted into the untreated crude extract for reaction, and the results are determined by observing the color development of the test line and control line.
[0003] However, existing methods of this type have the following technical problems in practical applications:
[0004] Existing transgenic test strip methods rely heavily on manual operation, resulting in low detection efficiency and an inability to process multiple samples simultaneously, making them unsuitable for the growing demand for large-scale crop sample screening.
[0005] Existing technologies mainly employ manual grinding in the sample pretreatment stage. However, manual grinding is slow and it is difficult to ensure the uniformity of the grinding effect. The differences in processing between different samples and the potential risk of cross-contamination directly affect the accuracy and consistency of the final test results.
[0006] The sample processing solutions obtained by existing technologies often contain plant tissue debris and impurities. These impurities can hinder the chromatographic process of the test solution on the test strip, resulting in a cloudy background on the test strip. This makes it difficult to accurately interpret the results of the test line and control line, and seriously affects the reliability of the test.
[0007] Therefore, this invention proposes a rapid, batch detection method for genetically modified crops to address the aforementioned problems. Summary of the Invention
[0008] To address the shortcomings of existing technologies, this invention provides a method for rapid, large-scale detection of genetically modified crops, thereby resolving the problems mentioned in the background section.
[0009] To achieve the above objectives, the present invention provides the following technical solution: a method for rapid, batch detection of genetically modified crops, comprising:
[0010] Step 1: Place centrifuge tubes containing crop samples to be tested into a multi-well plate in an array to complete the batch plate arrangement of samples.
[0011] Step 2: Based on the multi-well plate, perform overall mechanized processing so that the crop samples in the centrifuge tube are simultaneously ground into powder under mechanical force;
[0012] Step 3: Using a batch liquid addition device, buffer solution is simultaneously added to the centrifuge tubes, and the powder and buffer solution are thoroughly mixed by shaking to form a sample processing solution;
[0013] Step 4: Perform overall centrifugation based on the multi-well plate, and use centrifugal force to precipitate insoluble impurities in the sample processing solution to the bottom of the centrifuge tube to obtain a clear sample supernatant.
[0014] Step 5: Insert the test strip into the clear sample supernatant of the centrifuge tube to react and read the test result;
[0015] The steps In addition, it further includes:
[0016] Sub-step Obtain the final volume of the clarified sample supernatant. Based on the minimum effective reaction volume of the selected test strip. Conditional judgment ≥ To verify whether the volume of the clarified sample supernatant meets the detection requirements;
[0017] Sub-step Under the condition that the final volume meets the detection requirements, the test strip is inserted into the supernatant of the clarified sample, the timer is started to react, and after the reaction is completed, an image acquisition device is used to acquire a digital image containing the control line area and the detection line area.
[0018] Sub-step In the digital image, the quality control line area is marked. Detection line area and background area The average pixel grayscale value within the region is calculated sequentially to obtain the grayscale value of the quality control line. grayscale value of detection line and background grayscale value ;
[0019] Sub-step The effective signal strength of the quality control line is calculated using the following formula. :
[0020] ,
[0021] in, The effective signal strength of the quality control line. This is the grayscale value of the quality control line. The background grayscale value;
[0022] Sub-step Set the minimum signal threshold for the test strip to be valid. Conditional judgment ≥ To determine whether the test is valid, test results that meet this condition can be included in the final interpretation;
[0023] Sub-step For detection results that pass the validity determination, the signal response ratio of the detection line is calculated using the following formula. :
[0024] ,
[0025] in, The signal response ratio, To detect the grayscale value of the line;
[0026] Sub-step Set a response threshold for positive results. The final condition judgment is adopted. ≥ The test results of the crop sample to be tested are read, and when the final judgment condition is met, the test result is read as positive.
[0027] Preferably, before the samples are batch-processed and plated, the process includes using a leaf punch to sample the leaves of the crop to be tested, and placing the obtained leaf discs into centrifuge tubes.
[0028] Preferably, the mechanized treatment includes: adding grinding steel balls to the centrifuge tube, subjecting the multi-well plate to liquid nitrogen freezing treatment, and then placing the multi-well plate in a tissue homogenizer for oscillatory grinding;
[0029] The oscillation grinding process has a swing frequency of 30 Hz / s and a grinding time of 45 s.
[0030] Preferably, the mechanized processing, after grinding into powder, includes a first centrifugation of the porous plate to collect the powder at the bottom of the centrifuge tube;
[0031] The first centrifugation was performed at a speed of 1200 rpm / min for 15 seconds.
[0032] Preferably, the oscillation process uses a vortex oscillator with an oscillation frequency of 1200 times / min and an oscillation time of 30 seconds.
[0033] The centrifugation step for obtaining the clarified sample supernatant involves a centrifugation speed of 1200 rpm / min and a centrifugation time of 15 s.
[0034] Preferably, the test strip is inserted into the supernatant of the clarified sample, reacted for 1 minute, and then removed and the test result is read.
[0035] Preferably, the steps In addition, it further includes:
[0036] Sub-step Get the total number of rows of the selected perforated plate. With total number of columns And determine the total number of crop samples to be tested in this batch. Total number of required quality control samples ;
[0037] Sub-step Based on the total number of rows With total number of columns The total number of holes in the perforated plate was calculated. Based on the following layout effectiveness evaluation formula, calculate the layout effectiveness score of this sample PCB. :
[0038] ,
[0039] in, To score the effectiveness of the layout, This represents the total number of crop samples to be tested. The total number of quality control samples. The total number of holes, through Calculated;
[0040] Sub-step Pre-set layout validity threshold Conditional judgment ≥ To determine whether the sample plate meets the minimum throughput requirement for batch processing, subsequent steps can be carried out only if this condition is met.
[0041] Sub-step For sample plates that pass the aforementioned criteria, a preset serpentine or row-by-row filling algorithm is used to generate unique well coordinates for both the crop sample to be tested and the quality control sample. To form the initial layout matrix ;
[0042] Sub-step Based on the initial layout matrix Based on the following cross-contamination risk index assessment formula, calculate the risk index for any crop sample to be tested. Cross-contamination risk index :
[0043] ,
[0044] in, For the crop sample to be tested The risk index of cross-contamination that is borne, This represents the total number of positive quality control samples among the quality control samples. This represents the inherent contamination weighting coefficient of the positive quality control sample. For the crop sample to be tested The hole position coordinates and the first Positive control samples The hole position coordinates in the initial layout matrix Euclidean distance in the middle;
[0045] Sub-step Set a safety threshold for the risk of cross-contamination. The final layout verification algorithm is adopted, and the cross-contamination risk index of all crop samples to be tested is... All conditions are met. At that time, confirm the initial layout matrix. This is the final board layout scheme;
[0046] Sub-step Based on the well coordinates determined by the final plate arrangement scheme, centrifuge tubes containing crop samples to be tested are placed into the corresponding wells in the multi-well plate to complete the batch plate arrangement operation of the samples.
[0047] Preferably, the steps In addition, it further includes:
[0048] Sub-step To obtain the initial mass of the crop sample to be tested. Based on the preset tissue toughness coefficient corresponding to the crop The target crushing threshold of the crop sample to be tested is calculated using the following formula. :
[0049] ,
[0050] in, The target crushing threshold, The initial mass of the crop sample to be tested. The coefficient of tissue toughness;
[0051] Sub-step Based on the performance coefficient of the selected tissue homogenizer Set the oscillation frequency of the grinder With grinding time The set crushing power value for this mechanized process was calculated using the following formula. :
[0052] ,
[0053] in, To set the crushing power value, For equipment performance coefficient, The frequency of the oscillation. Grinding time;
[0054] Sub-step 3. Use conditional judgment ≥ To verify whether the set grinding power value has reached the target grinding threshold, only if this condition is met can the grinding parameters be confirmed to be effective, so as to proceed to the subsequent liquid nitrogen freezing treatment;
[0055] Sub-step After liquid nitrogen freezing, the current temperature of the sample in the multi-well plate is monitored in real time before starting the tissue homogenizer. The following conditions are used to determine whether a sample has reached an effective grinding state:
[0056] ≤ ,
[0057] in, The current temperature of the sample. This refers to the critical embrittlement temperature of the crop sample.
[0058] Sub-step Once the current temperature of the sample meets the criteria for the critical embrittlement temperature, the tissue homogenizer is immediately started to perform the homogenization operation. After homogenization, the multi-well plate is centrifuged for the first time to compact the powder generated in all centrifuge tubes to the bottom of the tubes, forming a specific accumulation volume. Powder column;
[0059] Sub-step Based on the initial mass of the crop sample to be tested With respect to the packing volume of the powder column The grinding efficiency index of this grinding operation is calculated using the following formula. :
[0060] ,
[0061] in, The grinding efficiency index, The initial mass of the crop sample to be tested. This represents the packing volume of the powder column;
[0062] Sub-step Set minimum crushing quality standards The final condition is used for judgment:
[0063] ≥ The method is used to determine whether the grinding efficiency index meets the standard. When this final judgment condition is met, it is determined that the crop sample has been ground into qualified powder.
[0064] Preferably, the steps In addition, it further includes:
[0065] Sub-step Based on the initial mass of the crop sample to be tested And based on the preset target pyrolysis concentration of the analyte. The cleavage efficiency coefficient with the selected buffer solution The required standard liquid volume for centrifuge tubes can be calculated using the following formula. :
[0066] ,
[0067] in, Standard dosage The initial mass of the crop sample to be tested; For the target pyrolysis concentration, This is the pyrolysis efficiency coefficient;
[0068] Sub-step Set the effective working volume of the centrifuge tube. Optimal reaction volume with the test strip Conditional judgment ≤ and ≥ To verify whether the standard liquid addition volume is within the effective volume range;
[0069] Sub-step Based on the specific surface area coefficient of the powder Fluid viscosity coefficient of the buffer solution The minimum oscillation energy threshold required to achieve a thorough mixing of the powder and buffer solution is calculated using the following formula. :
[0070] ,
[0071] in, The minimum oscillation energy threshold, For the correction factor of the hybrid system, This is the specific surface area coefficient of the powder. The viscosity coefficient of the buffer solution;
[0072] Sub-step Set the oscillation frequency of the vortex oscillator used for oscillation processing. With oscillation time Based on the inherent energy conversion factor of the equipment The actual oscillation energy provided by this oscillation process is calculated using the following formula. :
[0073] ,
[0074] in, The actual oscillation energy, As an energy conversion factor, The oscillation frequency is... Oscillation time;
[0075] Sub-step Conditional judgment ≥ To determine whether the actual oscillation energy reaches the minimum oscillation energy threshold, the oscillation processing parameters can be confirmed to be effective only if this condition is met.
[0076] Sub-step After the standard liquid addition volume and the oscillation processing parameters have been verified, the standard liquid addition volume of buffer solution is simultaneously added to the centrifuge tube using a batch liquid addition device, and the effective oscillation processing parameters are immediately used for oscillation to obtain a mixed liquid.
[0077] Sub-step After the oscillation process is completed, the light scattering turbidity value of the mixed liquid is measured. Set a standard clarification limit When the condition is met, a judgment is made. ≤ At that time, the mixed liquid will be finally confirmed as a qualified sample processing solution.
[0078] Preferably, the steps In addition, it further includes:
[0079] Sub-step , obtain from steps The average particle size of insoluble impurities in the formed sample processing solution With impurity density Obtain the fluid density of the sample processing solution. With fluid viscosity The sedimentation characteristic coefficient of the insoluble impurities is calculated according to the following formula. :
[0080] ,
[0081] in, The characteristic coefficient of settlement. The average particle size of insoluble impurities. For impurity density, The fluid density of the sample processing solution. The viscosity of the sample processing solution;
[0082] Sub-step Set the maximum acceptable turbidity corresponding to the ideal clarity of the supernatant for subsequent test strip reactions. Based on the aforementioned settlement characteristic coefficient The minimum separation factor required to bring the sample treatment solution to the maximum acceptable turbidity is calculated using the following formula. :
[0083] ,
[0084] in, The minimum separating factor, To correct the constant, The distance from the liquid surface to the center of rotation. This is the distance from the bottom of the centrifuge tube to the center of rotation.
[0085] Sub-step Set the centrifuge speed With centrifugation time To obtain the effective rotational radius of the centrifuge rotor The set separation factor for this centrifugation operation is calculated using the following formula. :
[0086] ,
[0087] in, To set the separation factor, For the effective rotation radius, The speed of the centrifuge. Centrifugation time;
[0088] Sub-step Conditional judgment ≥ To determine whether the set separation factor has reached the minimum separation factor, only when this condition is met can the centrifugation parameters be confirmed as valid and the centrifugation operation be started.
[0089] Sub-step The multi-well plate was centrifuged as a whole under the effective centrifugation parameters to obtain a post-centrifugation liquid containing supernatant and bottom precipitate, and the actual turbidity of the supernatant was measured. ;
[0090] Sub-step Set a risk threshold for sediment resuspension. Based on the deceleration angle acceleration of the centrifuge Compared with the actual turbidity of the supernatant The precipitation stability index of the centrifugation operation is calculated using the following formula. :
[0091] ,
[0092] in, The precipitation stability index, The deceleration angle acceleration of the centrifuge;
[0093] Sub-step The final condition judgment is adopted. ≤ and ≥ When both the actual turbidity of the supernatant and the precipitation stability index meet the judgment criteria, the supernatant is finally confirmed as a qualified clarified sample supernatant.
[0094] This invention provides a rapid, batch-based method for detecting genetically modified crops. It offers the following advantages:
[0095] 1. This invention adopts an integrated operation process that places independent centrifuge tubes in a multi-well plate to form an array, and uses a tissue homogenizer, batch liquid addition equipment and centrifuge to process all samples simultaneously. This achieves a significant improvement in detection throughput and efficiency. Compared with the existing technology that relies on manual operation one by one, this invention solves the problem of low detection efficiency and inability to process multiple samples simultaneously, which makes it difficult to meet the needs of large-scale crop sample screening.
[0096] 2. The present invention adopts a technical solution of mechanized batch grinding using liquid nitrogen freezing combined with a tissue grinder, which achieves the technical effect of ensuring that all samples are fully and uniformly crushed into powder under the same standard. Compared with the manual grinding method in the prior art, it solves the shortcomings of slow processing speed, difficulty in ensuring uniformity of grinding effect and the risk of cross-contamination, which directly affect the accuracy and consistency of the final test results.
[0097] 3. This invention employs a technique of centrifuging the multi-well plate as a whole after the sample processing solution is formed and before the test strip reaction. This effectively separates and precipitates insoluble impurities such as plant tissue debris, resulting in a clear sample supernatant. Compared to the prior art, which directly uses a sample processing solution containing impurities for detection, this invention solves the problem that impurities hinder the chromatography process of the test solution on the test strip, leading to turbid background color on the test strip and making it difficult to accurately interpret the results of the test line and control line, thus seriously affecting the reliability of the detection. Attached Figure Description
[0098] Figure 1 This is a flowchart of the present invention;
[0099] Figure 2 It is the powder obtained by grinding the corn leaf sample in Example 1 in a 96-well plate;
[0100] Figure 3 This is the reaction result after adding the test strip to the corn leaf sample from Example 1;
[0101] Figure 4 These are the test results of 12 groups of corn leaf powder samples from Example 1, obtained using test strips.
[0102] Figure 5 This refers to 12 groups of corn leaf samples from Example 1. Results verified using molecular markers. Detailed Implementation
[0103] To enable those skilled in the art to understand the present invention, the technical solutions of the present invention will be clearly and completely described below with reference to the accompanying drawings of the embodiments of the present invention. Obviously, the described embodiments are some, but not all, of the embodiments of the present invention. Other embodiments obtained by those skilled in the art based on the embodiments of the present invention without creative effort should fall within the scope of protection of the present invention.
[0104] The present invention will now be described in detail with reference to the accompanying drawings:
[0105] Example 1:
[0106] Please see the appendix Figure 1This invention provides a method for rapid, large-scale detection of genetically modified crops, comprising:
[0107] Step 1: Place centrifuge tubes containing crop samples to be tested into a multi-well plate in an array to complete the batch plate arrangement of samples.
[0108] Step 2: Based on the multi-well plate, the entire process is mechanically processed so that the crop samples in the centrifuge tube are simultaneously ground into powder under mechanical force.
[0109] Step 3: Using a batch liquid addition device, buffer solution is added to the centrifuge tube simultaneously. The powder and buffer solution are thoroughly mixed by shaking to form a sample processing solution.
[0110] Step 4: Perform overall centrifugation based on the multi-well plate. Use centrifugal force to precipitate insoluble impurities in the sample processing solution to the bottom of the centrifuge tube to obtain a clear sample supernatant.
[0111] Step 5: Insert the test strip into the clear sample supernatant in the centrifuge tube to react and read the test result;
[0112] step In addition, it further includes:
[0113] Sub-step Get the total number of rows of the selected perforated plate. With total number of columns And determine the total number of crop samples to be tested in this batch. Total number of required quality control samples ;
[0114] Sub-step Based on the total number of rows With total number of columns Calculate the total number of holes in the perforated plate. Based on the following layout effectiveness evaluation formula, calculate the layout effectiveness score of this sample PCB. :
[0115] ,
[0116] in, To score the effectiveness of the layout, This represents the total number of crop samples to be tested. The total number of quality control samples. The total number of holes, through Calculated;
[0117] Sub-step Pre-set layout validity threshold Conditional judgment ≥ To determine whether the sample plate meets the minimum throughput requirement for batch processing, subsequent steps can be carried out only if this condition is met.
[0118] Sub-step For sample plates that pass the conditional judgment, a preset serpentine or row-by-row filling algorithm is used to generate unique well coordinates for the crop samples to be tested and the quality control samples. To form the initial layout matrix ;
[0119] Sub-step Based on the initial layout matrix Based on the following cross-contamination risk index assessment formula, calculate the risk index for any crop sample to be tested. Cross-contamination risk index :
[0120] ,
[0121] in, For the crop sample to be tested The risk index of cross-contamination that is borne, This represents the total number of positive quality control samples among the quality control samples. This represents the inherent contamination weighting coefficient of the positive quality control sample. For the crop sample to be tested The hole position coordinates and the first Positive control samples The hole position coordinates in the initial layout matrix Euclidean distance in the middle;
[0122] Sub-step Set a safety threshold for the risk of cross-contamination. The final layout verification algorithm is adopted, and the cross-contamination risk index of all crop samples to be tested is used. All conditions are met. At that time, confirm the initial layout matrix. This is the final board layout scheme;
[0123] Sub-step Based on the well coordinates determined by the final plate layout plan, centrifuge tubes containing crop samples to be tested are placed into the corresponding wells in the multi-well plate to complete the batch plate layout operation of the samples.
[0124] step In addition, it further includes:
[0125] Sub-step To obtain the initial mass of the crop sample to be tested. Based on the preset tissue toughness coefficient corresponding to the crop The target crushing threshold of the crop sample to be tested is calculated using the following formula. :
[0126] ,
[0127] in, The target crushing threshold, The initial mass of the crop sample to be tested. The coefficient of tissue toughness;
[0128] Sub-step Based on the performance coefficient of the selected tissue homogenizer Set the oscillation frequency of the grinder With grinding time The set crushing power value for this mechanized process was calculated using the following formula. :
[0129] ,
[0130] in, To set the crushing power value, For equipment performance coefficient, The frequency of the oscillation. Grinding time;
[0131] Sub-step 3. Use conditional judgment ≥ To verify whether the set grinding power value has reached the target grinding threshold, only if this condition is met can the grinding parameters be confirmed to be effective, so as to proceed to the subsequent liquid nitrogen freezing treatment;
[0132] Sub-step After liquid nitrogen freezing, the current temperature of the samples in the multi-well plate was monitored in real time before starting the tissue homogenizer. The following conditions are used to determine whether a sample has reached an effective grinding state:
[0133] ≤ ,
[0134] in, The current temperature of the sample. This refers to the critical embrittlement temperature of the crop sample.
[0135] Sub-step Once the sample's current temperature meets the criteria for the critical embrittlement temperature, the tissue homogenizer is immediately started to perform the homogenization operation. After homogenization, the multi-well plate is centrifuged for the first time to compact the powder generated in all centrifuge tubes to the bottom of the tubes, forming a specific packing volume. Powder column;
[0136] Sub-step Based on the initial mass of the crop sample to be tested With respect to the packing volume of the powder column The grinding efficiency index of this grinding operation is calculated using the following formula. :
[0137] ,
[0138] in, The grinding efficiency index, The initial mass of the crop sample to be tested. This represents the packing volume of the powder column;
[0139] Sub-step Set minimum crushing quality standards The final condition is used for judgment:
[0140] ≥ The grinding efficiency index is used to determine whether the grinding efficiency index meets the standard. When this final judgment condition is met, the crop sample is considered to have been ground into qualified powder.
[0141] step In addition, it further includes:
[0142] Sub-step Based on the initial mass of the crop sample to be tested And based on the preset target pyrolysis concentration of the analyte. The cleavage efficiency coefficient with the selected buffer solution The required standard liquid volume for centrifuge tubes can be calculated using the following formula. :
[0143] ,
[0144] in, Standard dosage The initial mass of the crop sample to be tested; For the target pyrolysis concentration, This is the pyrolysis efficiency coefficient;
[0145] Sub-step Set the effective working volume of the centrifuge tube. Optimal reaction volume with test strip Conditional judgment ≤ and ≥ To verify whether the standard liquid addition volume is within the effective volume range;
[0146] Sub-step Based on the specific surface area coefficient of powder Fluid viscosity coefficient with buffer solution The minimum oscillation energy threshold required to achieve a thorough mixing of the powder and buffer solution is calculated using the following formula. :
[0147] ,
[0148] in, The minimum oscillation energy threshold, For the correction factor of the hybrid system, This is the specific surface area coefficient of the powder. The viscosity coefficient of the buffer solution;
[0149] Sub-step Set the oscillation frequency of the vortex oscillator used for oscillation processing. With oscillation time Based on the inherent energy conversion factor of the equipment The actual oscillation energy provided by this oscillation process is calculated using the following formula. :
[0150] ,
[0151] in, The actual oscillation energy, As an energy conversion factor, The oscillation frequency is... Oscillation time;
[0152] Sub-step Conditional judgment ≥ To determine whether the actual oscillation energy has reached the minimum oscillation energy threshold, the oscillation processing parameters can be confirmed to be effective only if this condition is met.
[0153] Sub-step After the standard liquid addition volume and shaking treatment parameters have been verified, the standard liquid addition volume of buffer solution is added to the centrifuge tube simultaneously using a batch liquid addition device, and the mixture is immediately shaken using effective shaking treatment parameters to obtain a mixed liquid.
[0154] Sub-step After the oscillation treatment was completed, the light scattering turbidity value of the mixed liquid was measured. Set a standard clarification limit When the condition is met, a judgment is made. ≤ At that time, the mixed liquid will be finally confirmed as a qualified sample processing solution.
[0155] step In addition, it further includes:
[0156] Sub-step , obtain from steps The average particle size of insoluble impurities in the resulting sample processing solution With impurity density Obtain the fluid density of the sample processing solution. With fluid viscosity The sedimentation characteristic coefficient of insoluble impurities can be calculated using the following formula. :
[0157] ,
[0158] in, The characteristic coefficient of settlement. The average particle size of insoluble impurities. For impurity density, The fluid density of the sample processing solution. The viscosity of the sample processing solution;
[0159] Sub-step Set the maximum acceptable turbidity corresponding to the ideal clarity of the supernatant for subsequent test strip reactions. Based on the settlement characteristic coefficient The minimum separation factor required to achieve the maximum acceptable turbidity of the sample treatment solution is calculated using the following formula. :
[0160] ,
[0161] in, The minimum separating factor, To correct the constant, The distance from the liquid surface to the center of rotation. This is the distance from the bottom of the centrifuge tube to the center of rotation.
[0162] Sub-step Set the centrifuge speed With centrifugation time To obtain the effective rotational radius of the centrifuge rotor The set separation factor for this centrifugation operation is calculated using the following formula. :
[0163] ,
[0164] in, To set the separation factor, For the effective rotation radius, The speed of the centrifuge. Centrifugation time;
[0165] Sub-step Conditional judgment ≥ To determine whether the set separation factor has reached the minimum separation factor, only when this condition is met can the centrifugation parameters be confirmed as valid and the centrifugation operation be started.
[0166] Sub-step The multi-well plate was centrifuged as a whole under effective centrifugation parameters to obtain the post-centrifugation liquid containing the supernatant and the bottom precipitate. The actual turbidity of the supernatant was measured. ;
[0167] Sub-step Set a risk threshold for sediment resuspension. Based on the deceleration angle acceleration of the centrifuge Compared with the actual turbidity of the supernatant The precipitation stability index of the centrifugation operation is calculated using the following formula. :
[0168] ,
[0169] in, The precipitation stability index, The deceleration angle acceleration of the centrifuge;
[0170] Sub-step The final condition judgment is adopted. ≤ and ≥ When the actual turbidity and precipitation stability index of the supernatant both meet the judgment criteria, the supernatant will be finally confirmed as a qualified clarified sample supernatant.
[0171] step In addition, it further includes:
[0172] Sub-step Obtain the final volume of the clarified sample supernatant. Based on the minimum effective reaction volume of the selected test strip. Conditional judgment ≥ To verify whether the volume of the supernatant of the clarified sample meets the detection requirements;
[0173] Sub-step Under the condition that the final volume meets the detection requirements, the test strip is inserted into the supernatant of the clear sample, the timer is started to react, and after the reaction is completed, the image acquisition device is used to acquire a digital image containing the control line area and the detection line area.
[0174] Sub-step In digital images, the quality control line area is marked. Detection line area and background area The average pixel grayscale value within the region is calculated sequentially to obtain the grayscale value of the quality control line. grayscale value of detection line and background grayscale value ;
[0175] Sub-step The effective signal strength of the quality control line is calculated using the following formula. :
[0176] ,
[0177] in, The effective signal strength of the quality control line. This is the grayscale value of the quality control line. The background grayscale value;
[0178] Sub-step Set the minimum signal threshold for the test strip to be valid. Conditional judgment ≥ To determine whether the test is valid, test results that meet this condition can be included in the final interpretation;
[0179] Sub-step For test results that pass the validity determination, the signal response ratio of the detection line is calculated using the following formula. :
[0180] ,
[0181] in, The signal response ratio, To detect the grayscale value of the line;
[0182] Sub-step Set a response threshold for positive results. The final condition judgment is adopted. ≥ The test results of the crop samples to be tested are read, and when the final judgment condition is met, the test result is read as positive.
[0183] By introducing layout effectiveness assessment, cross-contamination risk index calculation, and automated layout algorithms, the traditional random sample placement is transformed into a data-driven, optimizable scientific plate placement process. This ensures the utilization rate of multi-well plates from the source, meets the basic requirements of high throughput, and most importantly, greatly improves the reliability of overall plate testing results and batch-to-batch repeatability by quantifying and avoiding the potential contamination risk of positive control samples to ordinary samples.
[0184] By accurately calculating the target crushing threshold and the set crushing power value, and by real-time monitoring of the critical embrittlement temperature of the sample, the standardization and quality control of the mechanical grinding process are achieved. Furthermore, the final crushing efficiency index is used for quantitative verification, which completely solves the core technical pain point of inconsistent sample pretreatment quality caused by different operations in traditional methods.
[0185] By theoretically calculating and verifying the standard liquid addition volume and minimum oscillation energy, we ensured a high degree of consistency in the biochemical aspects of all sample reaction systems, thus ensuring the efficiency and sufficiency of subsequent target analyte lysis. Furthermore, by introducing the detection of light scattering turbidity as a process quality control point, we ensured that the sample processing solution was in a qualified and consistent state before entering the next centrifugation step.
[0186] The centrifugation clarification process is transformed from an experience-based operation into a purification step based on precise control of fluid mechanics and centrifugal dynamics. This ensures that the clarity of the obtained supernatant is sufficient to meet the testing requirements. Furthermore, through quantitative assessment of precipitation stability, it is guaranteed that the supernatant will not be recontaminated during transfer or handling, providing a decisive guarantee for obtaining test results with a clear background.
[0187] By employing image acquisition and grayscale value calculation, the traditional test strip result reading, which relies on subjective judgment by the human eye, is transformed into an objective and quantitative digital interpretation method. The validity of the test is determined by the signal intensity of the quality control line, and normalization is performed by the signal response ratio to eliminate the ambiguity of human interpretation and individual differences. Combined with a preset positive response threshold, the final test results are accurate, reliable, and have high consistency and traceability.
[0188] Example 2:
[0189] Please see the appendix Figure 2 - Appendix Figure 5 This invention provides a method for rapid, large-scale detection of genetically modified crops, comprising:
[0190] S1. Buffer preparation: Take 1000ml of water with a graduated cylinder, add 20g of SEB4 powder buffer, shake well for 30 seconds, and let stand at room temperature.
[0191] S2. Sampling: Leaves were collected from 96 plants in the inbred line XB1621 insect-resistant transgenic maize inbred backcross population. Eight wells of each plant leaf sample were taken using a leaf puncher and placed into 1.2ml centrifuge tubes. According to the sample numbering diagram, the samples were placed in the corresponding wells of the 96-well deep well plate.
[0192] S3. Add steel ball to silicone cap, add 1 steel ball to each 1.2ml centrifuge tube using a 96-well deep plate steel ball separator, then cover with silicone cap and compact with centrifuge tube rack.
[0193] S4. Liquid nitrogen freezing: Place the 96-well deep-hole plate with the silicone cap on into a foam box filled with liquid nitrogen and freeze for 2 minutes.
[0194] S5. Grinding: Place the frozen 96-well deep well plate symmetrically into the sample chamber of the tissue homogenizer, cover with the sample sealing cap, fix the bolts, cover with the homogenizer cap, set the vibration frequency to 30Hz, time to 45s, and grind.
[0195] S6. After centrifugation and settling, remove the ground sample from the grinder and centrifuge it in a horizontal centrifuge for 15 seconds at 1200 rpm / min. Figure 2 As shown, open the rubber cap and let it stand at room temperature for 5 minutes;
[0196] S7. Add buffer, open the 96-well deep well plate cap, add 300 μL of buffer using a liquid processing workstation, cover the 96-well silicone cap, press on the blank 96-well PCR plate, and vortex at 1200 rpm for 30 seconds.
[0197] S8. Centrifuge for 15 seconds at a speed of 1200 rpm / min.
[0198] S9. Add the BT cry1Ab / cry1Ac test strip, slowly insert the test strip into the centrifuge tube, keeping the liquid level below the maximum liquid level mark indicated on the test strip, and remove the test strip after 1 minute.
[0199] S10. Read the results. Positive result: Both the T line and C line of the test strip show visible color development, indicating that the sample contains genetically modified components. The result is stated as "Genetically modified components were detected in the sample, and the test result is positive".
[0200] Negative result: This means that no visible color development is observed in the T line and visible color development is observed in the C line, indicating that the sample does not contain genetically modified components. "No genetically modified components were detected in the sample, and the test result is negative."
[0201] S11. Result verification: Samples A1, B2, C3, D4, E5, F6, G7, H8, G9, F10, E11, and D12 from the 96-well plate were extracted, and the test strip results were read in the following order: positive, negative, positive, positive, positive, positive, negative, positive, negative, positive, positive, negative.
[0202] S12. Extract DNA from the above 12 groups of samples, and then verify the amplification using the insect-resistant gene ND207. The marker sequence is:
[0203] ND207_F: AACGTGAACAAGGGTGAAGCTCTACG;
[0204] ND207_R:AGTCCAGGATGGGCTTCATGTACTC.
[0205] The results of the detection using the insect-resistant gene ND207 molecular marker were positive, negative, positive, positive, positive, positive, negative, positive, negative, positive, negative, positive, positive, negative, consistent with the results of the test strip.
[0206] Although embodiments of the invention have been shown and described, it will be understood by those skilled in the art that various changes, modifications, substitutions and alterations can be made to these embodiments without departing from the principles and spirit of the invention, the scope of which is defined by the appended claims and their equivalents.
Claims
1. A method for rapid, large-scale detection of genetically modified crops, characterized in that, include: Step 1: Place centrifuge tubes containing crop samples to be tested into a multi-well plate in an array to complete the batch plate arrangement of samples. Step 2: Based on the multi-well plate, perform overall mechanized processing so that the crop samples in the centrifuge tube are simultaneously ground into powder under mechanical force; Step 3: Using a batch liquid addition device, buffer solution is simultaneously added to the centrifuge tubes, and the powder and buffer solution are thoroughly mixed by shaking to form a sample processing solution; Step 4: Perform overall centrifugation based on the multi-well plate, and use centrifugal force to precipitate insoluble impurities in the sample processing solution to the bottom of the centrifuge tube to obtain a clear sample supernatant. Step 5: Insert the test strip into the clear sample supernatant of the centrifuge tube to react and read the test result; The steps In addition, it further includes: Sub-step Obtain the final volume of the clarified sample supernatant. Based on the minimum effective reaction volume of the selected test strip. Conditional judgment ≥ To verify whether the volume of the clarified sample supernatant meets the detection requirements; Sub-step Under the condition that the final volume meets the detection requirements, the test strip is inserted into the supernatant of the clarified sample, the timer is started to react, and after the reaction is completed, an image acquisition device is used to acquire a digital image containing the control line area and the detection line area. Sub-step In the digital image, the quality control line area is marked. Detection line area and background area The average pixel grayscale value within the region is calculated sequentially to obtain the grayscale value of the quality control line. grayscale value of detection line and background grayscale value ; Sub-step The effective signal strength of the quality control line is calculated using the following formula. : , in, The effective signal strength of the quality control line. This is the grayscale value of the quality control line. The background grayscale value; Sub-step Set the minimum signal threshold for the test strip to be valid. Conditional judgment ≥ To determine whether the test is valid, test results that meet this condition can be included in the final interpretation; Sub-step For detection results that pass the validity determination, the signal response ratio of the detection line is calculated using the following formula. : , in, The signal response ratio, To detect the grayscale value of the line; Sub-step Set a response threshold for positive results. The final condition judgment is adopted. ≥ The test results of the crop sample to be tested are read, and when the final judgment condition is met, the test result is read as positive.
2. The method for rapid batch detection of genetically modified crops according to claim 1, characterized in that, Before the samples are batched and plated, the process includes using a leaf punch to sample the leaves of the crop to be tested, and placing the obtained leaf discs into centrifuge tubes.
3. The method for rapid batch detection of genetically modified crops according to claim 1, characterized in that, The mechanized process includes: adding grinding steel balls to the centrifuge tube, freezing the multi-well plate with liquid nitrogen, and then placing the multi-well plate in a tissue homogenizer for oscillation and grinding. The oscillation grinding process has a swing frequency of 30 Hz / s and a grinding time of 45 s.
4. The method for rapid batch detection of genetically modified crops according to claim 3, characterized in that, The mechanized processing, after grinding into powder, includes a first centrifugation of the porous plate to collect the powder at the bottom of the centrifuge tube; The first centrifugation was performed at a speed of 1200 rpm / min for 15 seconds.
5. The method for rapid batch detection of genetically modified crops according to claim 1, characterized in that, The oscillation process uses a vortex oscillator with an oscillation frequency of 1200 times / min and an oscillation time of 30 seconds. The centrifugation step for obtaining the clarified sample supernatant involves a centrifugation speed of 1200 rpm / min and a centrifugation time of 15 s.
6. The method for rapid batch detection of genetically modified crops according to claim 1, characterized in that, The test strip is inserted into the supernatant of the clarified sample, reacted for 1 minute, and then removed and the test result is read.
7. The method for rapid batch detection of genetically modified crops according to claim 1, characterized in that, The steps In addition, it further includes: Sub-step Get the total number of rows of the selected perforated plate. With total number of columns And determine the total number of crop samples to be tested in this batch. Total number of required quality control samples ; Sub-step Based on the total number of rows With total number of columns The total number of holes in the perforated plate was calculated. Based on the following layout effectiveness evaluation formula, calculate the layout effectiveness score of this sample PCB. : , in, To score the effectiveness of the layout, This represents the total number of crop samples to be tested. The total number of quality control samples. The total number of holes, through Calculated; Sub-step Pre-set layout validity threshold Conditional judgment ≥ To determine whether the sample plate meets the minimum throughput requirement for batch processing, subsequent steps can be carried out only if this condition is met. Sub-step For sample plates that pass the aforementioned criteria, a preset serpentine or row-by-row filling algorithm is used to generate unique well coordinates for both the crop sample to be tested and the quality control sample. To form the initial layout matrix ; Sub-step Based on the initial layout matrix Based on the following cross-contamination risk index assessment formula, calculate the risk index for any crop sample to be tested. Cross-contamination risk index : , in, For the crop sample to be tested The risk index of cross-contamination that is borne, This represents the total number of positive quality control samples among the quality control samples. This represents the inherent contamination weighting coefficient of the positive quality control sample. For the crop sample to be tested The hole position coordinates and the first Positive control samples The hole position coordinates in the initial layout matrix Euclidean distance in the middle; Sub-step Set a safety threshold for the risk of cross-contamination. The final layout verification algorithm is adopted, and the cross-contamination risk index of all crop samples to be tested is... All conditions are met. At that time, confirm the initial layout matrix. This is the final board layout scheme; Sub-step Based on the well coordinates determined by the final plate arrangement scheme, centrifuge tubes containing crop samples to be tested are placed into the corresponding wells in the multi-well plate to complete the batch plate arrangement operation of the samples.
8. The method for rapid batch detection of genetically modified crops according to claim 1, characterized in that, The steps In addition, it further includes: Sub-step To obtain the initial mass of the crop sample to be tested. Based on the preset tissue toughness coefficient corresponding to the crop The target crushing threshold of the crop sample to be tested is calculated using the following formula. : , in, The target crushing threshold, The initial mass of the crop sample to be tested. The coefficient of tissue toughness; Sub-step Based on the performance coefficient of the selected tissue homogenizer Set the oscillation frequency of the grinder With grinding time The set crushing power value for this mechanized process was calculated using the following formula. : , in, To set the crushing power value, For equipment performance coefficient, The frequency of the oscillation. Grinding time; Sub-step 3. Use conditional judgment ≥ To verify whether the set grinding power value has reached the target grinding threshold, only if this condition is met can the grinding parameters be confirmed to be effective, so as to proceed to the subsequent liquid nitrogen freezing treatment; Sub-step After liquid nitrogen freezing, the current temperature of the sample in the multi-well plate is monitored in real time before starting the tissue homogenizer. The following conditions are used to determine whether a sample has reached an effective grinding state: ≤ , in, The current temperature of the sample. This refers to the critical embrittlement temperature of the crop sample. Sub-step Once the current temperature of the sample meets the criteria for the critical embrittlement temperature, the tissue homogenizer is immediately started to perform the homogenization operation. After homogenization, the multi-well plate is centrifuged for the first time to compact the powder generated in all centrifuge tubes to the bottom of the tubes, forming a specific accumulation volume. Powder column; Sub-step Based on the initial mass of the crop sample to be tested With respect to the packing volume of the powder column The grinding efficiency index of this grinding operation is calculated using the following formula. : , in, The grinding efficiency index, The initial mass of the crop sample to be tested. This represents the packing volume of the powder column; Sub-step Set minimum crushing quality standards The final condition is used for judgment: ≥ The method is used to determine whether the grinding efficiency index meets the standard. When this final judgment condition is met, it is determined that the crop sample has been ground into qualified powder.
9. The method for rapid batch detection of genetically modified crops according to claim 1, characterized in that, The steps In addition, it further includes: Sub-step Based on the initial mass of the crop sample to be tested And based on the preset target pyrolysis concentration of the analyte. The cleavage efficiency coefficient with the selected buffer solution The required standard liquid volume for centrifuge tubes can be calculated using the following formula. : , in, Standard dosage The initial mass of the crop sample to be tested; For the target pyrolysis concentration, This is the pyrolysis efficiency coefficient; Sub-step Set the effective working volume of the centrifuge tube. Optimal reaction volume with the test strip Conditional judgment ≤ and ≥ To verify whether the standard liquid addition volume is within the effective volume range; Sub-step Based on the specific surface area coefficient of the powder Fluid viscosity coefficient of the buffer solution The minimum oscillation energy threshold required to achieve a thorough mixing of the powder and buffer solution is calculated using the following formula. : , in, The minimum oscillation energy threshold, For the correction factor of the hybrid system, This is the specific surface area coefficient of the powder. The viscosity coefficient of the buffer solution; Sub-step Set the oscillation frequency of the vortex oscillator used for oscillation processing. With oscillation time Based on the inherent energy conversion factor of the equipment The actual oscillation energy provided by this oscillation process is calculated using the following formula. : , in, The actual oscillation energy, As an energy conversion factor, The oscillation frequency is... Oscillation time; Sub-step Conditional judgment ≥ To determine whether the actual oscillation energy reaches the minimum oscillation energy threshold, the oscillation processing parameters can be confirmed to be effective only if this condition is met. Sub-step After the standard liquid addition volume and the oscillation processing parameters have been verified, the standard liquid addition volume of buffer solution is simultaneously added to the centrifuge tube using a batch liquid addition device, and the effective oscillation processing parameters are immediately used for oscillation to obtain a mixed liquid. Sub-step After the oscillation process is completed, the light scattering turbidity value of the mixed liquid is measured. Set a standard clarification limit When the condition is met, a judgment is made. ≤ At that time, the mixed liquid will be finally confirmed as a qualified sample processing solution.
10. The method for rapid batch detection of genetically modified crops according to claim 1, characterized in that, The steps In addition, it further includes: Sub-step , obtain from steps The average particle size of insoluble impurities in the formed sample processing solution With impurity density Obtain the fluid density of the sample processing solution. With fluid viscosity The sedimentation characteristic coefficient of the insoluble impurities is calculated according to the following formula. : , in, The characteristic coefficient of settlement. The average particle size of insoluble impurities. For impurity density, The fluid density of the sample processing solution. The viscosity of the sample processing solution; Sub-step Set the maximum acceptable turbidity corresponding to the ideal clarity of the supernatant for subsequent test strip reactions. Based on the aforementioned settlement characteristic coefficient The minimum separation factor required to bring the sample treatment solution to the maximum acceptable turbidity is calculated using the following formula. : , in, The minimum separating factor, To correct the constant, The distance from the liquid surface to the center of rotation. This is the distance from the bottom of the centrifuge tube to the center of rotation. Sub-step Set the centrifuge speed With centrifugation time To obtain the effective rotational radius of the centrifuge rotor The set separation factor for this centrifugation operation is calculated using the following formula. : , in, To set the separation factor, For the effective rotation radius, The speed of the centrifuge. Centrifugation time; Sub-step Conditional judgment ≥ To determine whether the set separation factor has reached the minimum separation factor, only when this condition is met can the centrifugation parameters be confirmed as valid and the centrifugation operation be started. Sub-step The multi-well plate was centrifuged as a whole under the effective centrifugation parameters to obtain a post-centrifugation liquid containing supernatant and bottom precipitate, and the actual turbidity of the supernatant was measured. ; Sub-step Set a risk threshold for sediment resuspension. Based on the deceleration angle acceleration of the centrifuge Compared with the actual turbidity of the supernatant The precipitation stability index of the centrifugation operation is calculated using the following formula. : , in, The precipitation stability index, The deceleration angle acceleration of the centrifuge; Sub-step The final condition judgment is adopted. ≤ and ≥ When both the actual turbidity of the supernatant and the precipitation stability index meet the judgment criteria, the supernatant is finally confirmed as a qualified clarified sample supernatant.
Citation Information
Patent Citations
Method for rapidly detecting transgenic product with nucleic acid chromatography
CN108828230A