Preparation method and application of macronuclear magnetic ferritin

Abstract

The invention provides a preparation method and application of macronuclear magnetic ferritin, and the method is as follows: synthetic ferritin is subjected to multiple biomimetic mineralization, large-particle-size nanoparticles are formed in the ferritin, and finally, the macronuclear magnetic ferritin is obtained through separation and purification. The average particle size of the macronuclear magnetic ferritin prepared by the method is not less than 7nm, the magnetocaloric performance is remarkably improved, and the magnetic hyperthermia curative effect taking the magnetic ferritin as a thermal medium can be enhanced.

Description

TECHNICAL FIELD

[0001] The application belongs to the technical field of biomimetic synthesis of magnetic nanomaterials, and particularly relates to a preparation method of large-nucleus magnetic ferritin and application thereof. BACKGROUND

[0002] The magnetic hyperthermia of tumor was first proposed by Gilchrist et al. in 1957, who found that magnetic iron oxide microparticles could inductively generate heat to destroy the lymphoma tissue of a dog, proving that magnetic nanomaterials could be selectively placed in the tumor site, and under the action of an external alternating magnetic field, the temperature of the tumor tissue was raised to destroy tumor cells, thereby achieving a therapeutic effect.

[0003] The heat generation performance of magnetic nanoparticles is a key factor determining the effect of magnetic hyperthermia. In recent years, scientists have explored the application of magnetic nanoparticles in the field of tumor magnetic hyperthermia from the aspects of size, structure, composition and the like. However, although magnetic nanoparticle-mediated magnetic hyperthermia has been widely studied in the treatment of tumors in the laboratory stage, there are still many problems or challenges in future clinical research and application. At present, the magnetic nanomaterials used for clinical magnetic hyperthermia have the bottleneck problems of low concentration in the tumor site, low magnetic-heat conversion efficiency, and low targeting delivery efficiency. At the same time, their biocompatibility, monodispersity and tumor targeting mostly depend on the hydrophilic materials or surface modifiers coated on their surfaces, which to some extent increases the complexity of the material synthesis process. In addition, most of the magnetic nanomaterials used for magnetic hyperthermia research are synthesized by chemical methods, and the controllability and stability of the synthesis process are poor, resulting in large batch-to-batch differences in chemically synthesized magnetic nanomaterials. Therefore, how to make the magnetic nanomaterials better target and stably aggregate in the tumor site under the safe external magnetic field strength, inductively and uniformly and stably generate heat on tumor cells, achieve better hyperthermia effect, and cause minimal damage to healthy tissues and organs, this task still has many difficulties to be solved, and the development of magnetic nanomaterials suitable for magnetic hyperthermia has a long way to go.

[0004] Ferritin is a kind of iron storage protein, which is widely distributed in animals, plants and bacteria, and plays a crucial role in iron storage and cellular iron homeostasis. It is composed of a protein shell and an inorganic iron core. The protein shell is 12 nm in outer diameter and 8 nm in inner diameter, and is self-assembled by multiple polypeptide subunits (usually 24). In the past few decades, ferritin has been used as an excellent biomimetic template for the synthesis of magnetic cores (Fe3O4 or γ-Fe2O3) in the ferritin cage to form a composite material, i.e. magnetic ferritin. This material synthesis method, which uses ferritin as a nano-reactor to simulate the process of biomineralization under artificial control, is called biomimetic mineralization. The magnetic ferritin synthesized by biomimetic mineralization is a kind of magnetic nanomaterial with many excellent material characteristics, such as uniform size and shape, good water solubility, monodispersity and biocompatibility. The protein shell on the surface of magnetic ferritin is easy to be chemically modified and genetically engineered, and is widely used for drug delivery; the magnetic core can be used for nuclear magnetic resonance imaging contrast and magnetic hyperthermia research. In addition, compared with other magnetic nanomaterials, whether synthesized by traditional chemical methods or biological magnetic nanomaterials, magnetic ferritin has a unique feature, i.e. natural tumor targeting. Magnetic ferritin can bind to the transferrin receptor 1 (TfR1 / CD71) on the surface of tumor cells without additional modification. Tumor cells have a higher demand for iron elements, and the expression of CD71 on the surface of cells is higher than that of normal cells. Ferritin, as an iron storage protein, transports iron by binding to CD71, which is the molecular basis of tumor targeting of magnetic ferritin nanomaterials. In addition, studies have found that the vascular endothelial cells also have a high expression of CD71 on the surface, and magnetic ferritin nanomaterials can cross the blood vessel wall and cross the blood-brain barrier through CD71-mediated transcytosis. Therefore, magnetic ferritin is a magnetic nanomaterial with tumor targeting and blood-brain barrier crossing dual functions, and has great potential in tumor magnetic hyperthermia.

[0005] In 2000, Babincová et al. first proposed the method of applying magnetic ferritin to magnetic hyperthermia. Human magnetic ferritin, due to its tumor targeting and ability to cross the blood-brain barrier, is expected to develop into an excellent medium for magnetic hyperthermia. However, due to the size limitation of the protein cavity, the low heat generation efficiency is the key factor restricting the application of magnetic ferritin in tumor magnetic hyperthermia. The laboratory predecessors have established a relatively mature biomimetic mineralization path of magnetic ferritin, and on this basis, the size of the core of the magnetic ferritin will be modified to improve its magnetic hyperthermic performance. SUMMARY

[0006] The purpose of the present application is to provide a preparation method of large-nucleus magnetic ferritin and its application.

[0007] In one aspect, the present application provides a method for preparing large-nucleus magnetic ferritin, which comprises synthesizing ferritin, subjecting the ferritin to multiple biomimetic mineralization to form large-particle-size nanoparticles in the interior of the ferritin, and finally separating and purifying the large-nucleus magnetic ferritin.

[0008] In one embodiment, the average particle size of the large-nucleus magnetic ferritin is not less than 7 nm, for example, 7.5 nm or 7.72 nm.

[0009] In one embodiment, the average particle size of the large-nucleus magnetic ferritin is not less than 7.5 nm.

[0010] In one embodiment, the average particle size of the large-nucleus magnetic ferritin is 7.5 nm or 7.72 nm.

[0011] In one embodiment, the large-nucleus magnetic ferritin is obtained through multiple biomimetic mineralization, wherein the multiple biomimetic mineralization refers to not less than two times of biomimetic mineralization (for example, two times, three times, four times or five times).

[0012] In one embodiment, the large-nucleus magnetic ferritin is obtained through two times of biomimetic mineralization.

[0013] In one embodiment, the large-nucleus magnetic ferritin is obtained through three times of biomimetic mineralization.

[0014] In one embodiment, the large-nucleus magnetic ferritin is obtained through four times of biomimetic mineralization.

[0015] In one embodiment, the process of biomimetic mineralization comprises adding ferrous salt and oxidizing agent into a solution of ferritin to react, controlling the pH value to be 7-11 and the temperature to be 25-90°C, forming large-particle-size nanoparticles in the interior of the ferritin; the adding speed of ferrous salt is between 10-200 ions per minute per ferritin, and the theoretical number of iron atoms introduced into each protein molecule can be between 100-20000; the concentration of oxidizing agent is that the ratio of the number of molecules of H2O2 added each time to the number of atoms of ferrous ions added is 3:1; the protein concentration is ≥0.25 mg / ml; then centrifuging, removing the precipitate, and concentrating.

[0016] In one embodiment, the process of biomimetic mineralization comprises adding ferrous salt and oxidizing agent into a solution of ferritin to react, controlling the pH value to be 8.5 and the temperature to be 65°C, forming large-particle-size nanoparticles in the interior of the ferritin; the adding speed of ferrous salt is 80 ions per minute per ferritin, and the theoretical number of iron atoms introduced into each protein molecule is 5000; the concentration of oxidizing agent is that the ratio of the number of molecules of H2O2 added each time to the number of atoms of ferrous ions added is 3:1; the protein concentration is ≥0.25 mg / ml; then centrifuging, removing the precipitate, and concentrating.

[0017] In one embodiment, the ferritin is selected from human ferritin, plant ferritin or bacterial ferritin.

[0018] In one embodiment, the ferritin is recombinant human ferritin.

[0019] In one embodiment, the recombinant human ferritin comprises H chain of recombinant human ferritin, L chain of recombinant human ferritin, assembly of H chain and L chain of recombinant human ferritin, mutant or fusion protein of H chain of recombinant human ferritin, or mutant or fusion protein of L chain of recombinant human ferritin.

[0020] In one embodiment, the ferritin comprises H chain of recombinant human ferritin, L chain of recombinant human ferritin, assembly of H chain and L chain of recombinant human ferritin, mutant or fusion protein of H chain of recombinant human ferritin, mutant or fusion protein of L chain of recombinant human ferritin, recombinant plant ferritin, mutant of recombinant plant ferritin, fusion protein of recombinant plant ferritin, bacterial ferritin, mutant of bacterial ferritin, or fusion protein of bacterial ferritin.

[0021] In one embodiment, the ferritin is H chain of recombinant human ferritin.

[0022] In one embodiment, the preparation method comprises the following steps:

[0023] 1) cloning and constructing DNA sequence of human ferritin on plasmid with recombinant human ferritin as template;

[0024] 2) transforming or co-transforming bacteria with recombinant plasmid containing human ferritin, adding isopropyl-β-D-thiogalactoside to activate T7 promoter, and inducing expression;

[0025] 3) releasing protein by ultrasonic disruption after expression;

[0026] 4) separating and purifying protein;

[0027] 5) adding ferrous salt and oxidizing agent to solution of ferritin to react, controlling pH value at 7-11, controlling temperature at 25-90°C, forming large-particle-size nanoparticles inside ferritin; adding ferrous salt at a speed of 10-200 ions per minute per ferritin, and finally the number of theoretical iron atoms per protein molecule can be between 100-20000; the concentration of oxidizing agent is that the ratio of the number of molecules of H2O2 added each time to the number of atoms of ferrous ions added is 3:1; the concentration of protein is ≥0.25 mg / ml; then centrifuging, removing precipitate, and concentrating; this step is repeated at least once, for example, once, twice, three times, four times;

[0028] 6) The large magnetic ferritin is obtained after molecular sieve purification.

[0029] In one embodiment, the step 5 is a process of biomimetic mineralization, i.e. the large magnetic ferritin is obtained after more than two times of biomimetic mineralization (e.g. two times, three times, four times, five times).

[0030] In one embodiment, the step 5 is a process of biomimetic mineralization, i.e. the large magnetic ferritin is obtained after two times of biomimetic mineralization.

[0031] In one embodiment, the step 5 is a process of biomimetic mineralization, i.e. the large magnetic ferritin is obtained after three times of biomimetic mineralization.

[0032] In one embodiment, the step 5 is a process of biomimetic mineralization, i.e. the large magnetic ferritin is obtained after four times of biomimetic mineralization.

[0033] In one embodiment, after step 1, the coding sequence is sequenced to ensure the correct DNA sequence.

[0034] In one embodiment, in step 2, when the bacteria are propagated to an OD value of 0.6-0.8, IPTG is added to activate the T7 promoter, and expression is induced at 30°C.

[0035] In one embodiment, in step 2, when the bacteria are propagated to an OD value of 0.7, IPTG is added to activate the T7 promoter, and expression is induced at 30°C.

[0036] In one embodiment, in step 3, the bacteria are resuspended in PBS buffer solution for ultrasonic disruption to release the protein.

[0037] In one embodiment, in step 2, the bacteria are Escherichia coli.

[0038] In one embodiment, in step 4, the protein is separated by chromatography, ammonium sulfate precipitation, ion exchange or molecular exclusion chromatography.

[0039] In one embodiment, the method of step 4 is: centrifugation at 20000G at 4°C for 20 min to collect the supernatant; heating the supernatant at 75°C for 20 min; centrifugation at 20000G at 4°C for 20 min to collect the supernatant.

[0040] In one embodiment, in step 5, the ferrous salt is a water-soluble ferrous salt: ferrous sulfate, ferrous ammonium sulfate or ferrous chloride; the oxidizing agent is hydrogen peroxide; and the ferritin solution refers to a 0.5mg / mL NaCl solution containing ferritin.

[0041] In one embodiment, in step 5, the ferrous salt is ferrous sulfate, and the concentration of the ferrous sulfate is 50 mM; the oxidant is hydrogen peroxide, and the concentration of the hydrogen peroxide is 16.67 mM.

[0042] In one embodiment, in step 5, the pH is controlled at 8-8.5; and the temperature is controlled at 37℃ or 65℃.

[0043] In one embodiment, the magnetic nanoparticles formed inside the large nuclear magnetic ferritin are Fe3O4.

[0044] In another aspect, the present application provides a large nuclear magnetic ferritin obtained by the above method.

[0045] In one embodiment, the magnetic heating performance of the large nuclear magnetic ferritin is improved.

[0046] In one embodiment, the magnetic heating performance of the large nuclear magnetic ferritin is improved compared with that of the common magnetic ferritin. Preferably, the common magnetic ferritin is prepared by only one biomimetic mineralization. Preferably, the average particle size of the common magnetic ferritin is less than 7 nm.

[0047] In one embodiment, under the action of an alternating magnetic field, the large nuclear magnetic ferritin has a higher temperature rising speed per unit time than the common magnetic ferritin.

[0048] In another aspect, the present application provides the use of the large nuclear magnetic ferritin in the preparation of magnetic nanoparticles or therapeutic substances.

[0049] In one embodiment, the large nuclear magnetic ferritin is used in improving the magnetic heating performance of the magnetic ferritin.

[0050] In one embodiment, the large nuclear magnetic ferritin is used in magnetic hyperthermia therapy.

[0051] Advantages of the invention

[0052] The present application provides a preparation method of a large nuclear magnetic ferritin and the use thereof, wherein the average particle size of the large nuclear magnetic ferritin is not less than 7 nm, and the magnetic heating performance is significantly improved.

[0053] The following drawings and examples are only used to illustrate the present application, and are not intended to limit the scope of the present application. According to the following detailed description of the preferred embodiments and drawings, various objects and advantages of the present application will become apparent to those skilled in the art. BRIEF DESCRIPTION OF DRAWINGS

[0054] Figure 1 . The electron microscope result of the magnetic ferritin of Fe5000 after four mineralizations.

[0055] Figure 2 . Magnetic iron protein projection electron microscope analysis chart of one-time iron 15000 and three-time iron 5000.

[0056] Figure 3 . Hydration particle size analysis chart.

[0057] Figure 4 . 300K hysteresis loop.

[0058] Figure 5 . ZFC-FC curve.

[0059] Figure 6 . Temperature rise result chart of multiple mineralization and one-time iron magnetic iron protein under 485.5 kHz, 49 kA / m alternating magnetic field. DETAILED DESCRIPTION

[0060] The present application is further described below in conjunction with the examples. The following description is merely the best mode for practicing this application and is not intended to limit this application in any way. Any skilled person may modify or vary the following examples using the disclosed technical content to make equivalent embodiments. Any simple modification or equivalent variation of the following examples, which does not deviate from the technical essence of the present application, falls within the protection scope of the present application.

[0061] Example 1, Multimetallic synthesis of large nuclear magnetic ferritin

[0062] The present example is a technical improvement based on patent CN102115746A. Patent CN102115746A is prepared by one-time mineralization of magnetic iron protein. The present example is obtained by multiple biomimetic mineralization of large nuclear magnetic iron protein.

[0063] The steps of obtaining large nuclear magnetic iron protein in the present example are as follows:

[0064] 1. Expression of ferritin

[0065] The ferritin in the present example is recombinant human ferritin H chain. The DNA sequence of the ferritin is shown in SEQ ID No. 1, and the amino acid sequence is shown in SEQ ID No. 2. In addition, the ferritin can also be the L chain of recombinant human ferritin, the assembly of H chain and L chain of recombinant human ferritin, plant ferritin, bacterial ferritin, etc.

[0066] The DNA sequence (SEQ ID No. 1) of the ferritin (recombinant human ferritin H chain) of the present example is CCATGGCATGTGAGCGGTACAATTCCCCTCTAGAAATAATTTTGTTTAACTTTAAGAAGGAGATATACAT ATGACGACCGCGTCCACC TCGCAGGTGCGCCAGAACTACCACCAGGACTCAGAGGCCGCCATCAACCGCCAGATCAACCTGGAGCTCTACGCCTCCTACGTTTACCTGTCCATGTCTTACTACTTTGACCGCGATGATGTGGCCTTGAAGAACTTTGCCAAATACTTTCT TCACCAATCTCATGAGGAGAGGGAACATGCTGAGAAACTGATGAAGCTGCAGAACCAACGAGGTGGCCGAATCTTC CTTCAGGATATCAAGAAACCAGACTGTGATGACTGGGAGAGCGGGCTGAATGCGATGGAGTGTGCATTACATTTGG AAAAAAATGTGAATCAGTCACTACTGGAACTGCACAAACTGGCCACTGACAAAAATGACCCCCATTTGTGTGACTT CATTGAGACACATTACCTGAATGAGCAGGTGAAAGCCATCAAAGAATTGGGTGACCACGTGACCAACTTGCGCAAG ATGGGAGCGCCCGAATCCGGCTTGGCGGAATATCTCTTTGACAAGCACACCCTGGGAGACAGTGATAATGAAAGCT AA GGATCCGCGGATCCGGCTGCTAACAAAGCCCGAAAGGAAGCTGAGTTGGCTGCTGCCACCGCTGAGCAATAACTAGCATAACCCCTTGGGGCCTCTAAACGGGTCTTGAGGGGTTTTTTGCTGAAAGGAGGAACTATATCCGGATATCCCGCAAGAGGCCCGGCAGTACCGGCATAACCAAGCCTATGCCTACAGCATCCAGGGTGACGGTGCCGAGGATGACGATGAGCGCATTGTTAGATTTCATACACGGTGCCTGACTGCGTTAGCAATTTAACTGTGAT; (wherein, the underlined part is ORF)

[0067] The amino acid sequence of the ferritin (recombinant human ferritin H chain) of the present embodiment (SEQ ID No. 2): MTTASTSQVRQNYHQDSEAAINRQINLELYASYVYLSMSYYFDRDDVALKNFAKYFLHQSHEEREHAEKLMKLQNQRGGRIFLQDIKKPDCDDWESGLNAMECALHLEKNVNQSLLELHKLATDKNDPHLCDFIETHYLNEQVKAIKELGDHVTNLRKMGAPESGLAEYLFDKHTLGDSDNES*.

[0068] 1.1LB solid plate (containing ampicillin) three-zone streaking activated expression of ferritin of E. coli; single colony is picked to 4 ml of LB liquid medium (with ampicillin) and cultured for 8-10 h to logarithmic phase; 1% inoculation is transferred to 200 ml of LB liquid medium (with ampicillin) and cultured for 8-10 h to logarithmic phase; 4% inoculation is transferred to 500 ml of LB liquid medium (with ampicillin), and when the expression strain grows to an OD value of 0.6-0.8, 1 mM IPTG (isopropyl-β-D-thiogalactoside) is added to induce expression, and induction is performed at 30°C for 12-14 h.

[0069] 1.2 8000 rpm, 6 min centrifugation at 4°C to collect the bacterial cells, resuspended in PBS; the bacterial cells are washed by centrifugation again, and the operation is repeated twice; finally, the bacterial cells are resuspended in PBS solution.

[0070] 1.3 Add 1 mM EDTA (pH 8.0) and 100 μg / ml lysozyme to the bacterial cells to a final concentration, and incubate at 37°C for 1 hour to dissolve the cell wall; use ultrasonic waves to break the cells, and centrifuge at 20,000 G at 4°C for 20 minutes to collect the supernatant.

[0071] 1.4 Heat the supernatant at 75°C for 20 minutes to remove impurities, and centrifuge at 20,000 G at 4°C for 20 minutes to collect the supernatant.

[0072] 1.5 Filter the supernatant through a 0.22 μm filter to remove bacteria, and store at 4°C.

[0073] 2. Synthesis and purification of large nuclear magnetic ferritin

[0074] 2.1 Use a desalting column to replace the PBS solution with a 0.1 M NaCl solution, and determine the protein concentration; concentrate the protein to a concentration of more than 10 mg / mL.

[0075] 2.2 Prepare oxygen-free water by vacuumizing deionized water to remove oxygen. Prepare a 0.1 M NaCl solution, filter through a 0.22 μm filter, and vacuumize to remove oxygen to prepare oxygen-free NaCl solution for use.

[0076] 2.3 Prepare a 50 mM ferrous ammonium sulfate, 16.67 mM hydrogen peroxide, and 200 mM sodium hydroxide solution in an anaerobic glove box using oxygen-free water.

[0077] 2.4 Add oxygen-free 0.1 M NaCl solution to the protein solution to a final concentration of 0.5 mg / mL.

[0078] 2.5 Start heating to a target temperature of 65°C, and adjust the pH of the protein solution to 8.5 using sodium hydroxide through a pH titrator.

[0079] 2.6 When the temperature reaches the set temperature, start the pump liquid program, and stabilize the pH at 8.5 through the pH titrator. Control the ferrous ion liquid addition rate to be 80 ions per ferritin per minute, and the ratio of the number of ferrous ions to the number of hydrogen peroxide molecules added to the reaction system each time is 3:1, and the protein concentration is ≥0.25 mg / mL. Under this stoichiometry, the nanoparticles synthesized inside the ferritin are Fe3O4.

[0080] 2.7 When the pump liquid reaches the stoichiometry of 5000 iron atoms per ferritin theoretically added, terminate the pump liquid program. Continue the reaction for 10 minutes, stop heating, and end the reaction.

[0081] 2.8 20000G centrifugation for 30 min, remove the precipitate; use ultrafiltration tube to concentrate the reaction solution to a certain concentration, add 0.1M NaCl solution to wash the magnetic ferritin twice, and concentrate the washed magnetic ferritin solution to a protein concentration of about 10mg / ml. Repeat the operation from 2.4 to carry out the second mineralization of ferritin.

[0082] 2.9 Repeat the operation of 2.4-2.8 three times until the precipitate after centrifugation increases significantly, and the size of the Fe3O4 core in the magnetic ferritin no longer increases significantly. The target material, large core magnetic ferritin, is obtained, with an inner core particle size of ≥7.5nm and an average particle size of 7.72nm. The inner core particle size of this large core magnetic ferritin is generally not less than 7nm, which can be significantly distinguished from the inner core particle size of ordinary magnetic ferritin or magnetic ferritin obtained by one-time biomimetic mineralization (the inner core particle size of ordinary magnetic ferritin or magnetic ferritin obtained by one-time biomimetic mineralization is generally about 4.5nm, but more than 6nm).

[0083] 2.10 Further purification of the material by molecular sieving.

[0084] The magnetic ferritin samples were characterized by transmission electron microscopy, dynamic light scattering (DLS), and low-temperature magnetic measurement system, and the results are as follows:

[0085] We carried out four mineralizations of each ferritin with 5000 Fe / HFn (the samples are named NO1, NO2, NO3, and NO4, respectively). TEM transmission electron microscopy results show that each biomimetic mineralization of 5000 Fe / HFn can grow the ferrite core of the magnetic ferritin. The average particle size and actual iron input of the magnetic ferritin after four mineralizations of 5000 Fe / HFn are shown in Table 1, and the electron microscopy results are shown in Figure 1 It is worth noting that during the fourth mineralization, the average particle size of the magnetic ferritin increased limitedly, the precipitate after mineralization increased significantly, and the protein yield decreased. Therefore, it can be considered that the size of the ferrite core has reached saturation during the third mineralization.

[0086] Table 1 Average particle size and actual iron input of magnetic ferritin after four mineralizations of 5000 Fe / HFn

[0087]

[0088] During the biomimetic mineralization, the one-time input of 15000 Fe / HFn and the three-time input of 5000 Fe / HFn were compared. Transmission electron microscopy results show that the ferrite core size of the magnetic ferritin with three-time input of 5000 Fe / HFn is larger than that of the magnetic ferritin with one-time input of 15000 Fe / HFn. Particle size analysis results show that the average particle size of the magnetic ferritin after three mineralizations (7.72nm) is 1.79nm larger than that of the magnetic ferritin with one-time input (5.93nm), and the results are as follows:Figure 2 The results are shown in FIG. 1 (a) and FIG. 1 (b). Figure 2 The results are shown in FIG. 1 (a) and FIG. 1 (b). Figure 3 The results are shown in FIG. 1 (a) and FIG. 1 (b). Figure 4 The results are shown in FIG. 1 (a) and FIG. 1 (b). Figure 5 The results are shown in FIG. 1 (a) and FIG. 1 (b). Figure 5 The results are shown in FIG. 1 (a) and FIG. 1 (b).

[0089] 3. Magnetic heating performance test

[0090] 3.1 ICP-OES was used to measure the iron content of the magnetic ferritin solution, and the magnetic ferritin was diluted to 1 mg (Fe) / ml with PBS for standby.

[0091] 3.2 Open the circulating cooling water, start the magnetic heating instrument, set the alternating magnetic field frequency to 485.5 kHz and the field strength to 49 kA / m, put 1 mg (Fe) / ml magnetic ferritin into the coil, and after the measurement temperature is stable, start to apply alternating magnetic field to measure the temperature change of the protein solution; PBS is used as blank to deduct background value.

[0092] 3.3 Results: Under the action of 485.5 kHz, 49 kA / m alternating magnetic field, the temperature of the multi-mineralized magnetic ferritin (three times of iron 5000) increased by 7℃ within 5 minutes, which was 3℃ higher than that of the one-time iron magnetic ferritin (one-time iron 15000), as shown in FIG. 3. Figure 6 The experimental results confirmed that the multi-mineralization method can effectively increase the size of the magnetic ferritin iron oxide core, and further improve its magnetic heating performance.

[0093] While the specific embodiments of the application have been described in detail, those skilled in the art will appreciate that various modifications and alterations to the details can be made within the scope of the application as disclosed in the teachings of the present application. The entire disclosure of the application is set out in the accompanying claims and any equivalents thereof.

Claims

1. A method for preparing macronuclear magnetic ferritin, characterized in that, The method is as follows: the synthesized ferritin undergoes multiple biomimetic mineralization processes to form large-diameter nanoparticles inside the ferritin, and finally, it is separated and purified to obtain macronuclear magnetic ferritin. The average particle size of the macronuclear magnetic ferritin is not less than 7 nm, and the macronuclear magnetic ferritin is obtained through multiple biomimetic mineralization processes.

2. The preparation method according to claim 1, characterized in that, The biomimetic mineralization process is as follows: ferrous salt and oxidant are added to the ferritin solution for reaction, with the pH value controlled at 7-11 and the temperature controlled at 25-90℃, forming large-diameter nanoparticles inside the ferritin; the ferrous salt is added at a rate of 10-200 ions per minute per ferritin molecule, and the theoretical number of iron atoms added to each protein molecule can be between 100 and 20,000; the concentration of the oxidant is such that the ratio of the number of H2O2 molecules added each time to the number of ferrous ion atoms added is 3:1; the protein concentration is ≥0.25mg / ml.

3. The preparation method according to claim 1, characterized in that, The ferritin in question is recombinant human ferritin.

4. The preparation method according to claim 3, characterized in that, The preparation method comprises the following steps: 1) Using recombinant human ferritin as a template, the DNA sequence of human ferritin was cloned and constructed into a plasmid; 2) Transform or co-transform bacteria with recombinant plasmids containing human ferritin, add isopropyl-β-D-thiogalactoside to activate the T7 promoter, and induce expression; 3) After expression, the protein is broken down by sonication to release it; 4) Separate and purify the protein; 5) Add ferrous salt and oxidant to the ferritin solution to react, controlling the pH to 7-11 and the temperature to 25-90℃, to form large-diameter nanoparticles inside the ferritin; the ferrous salt is added at a rate of 10-200 ions per ferritin per minute, and the theoretical number of iron atoms added to each protein molecule can be between 100 and 20,000; the concentration of oxidant is 3:1, with the ratio of H2O2 molecules added to ferrous ion atoms; the protein concentration is ≥0.25 mg / ml; this step is repeated at least once, for example, once, twice, three times, or four times; 6) Macronuclear magnetic ferritin was obtained after molecular sieve purification; Step 5 is a biomimetic mineralization process, that is, the macronucleus magnetic ferritin is obtained through multiple biomimetic mineralization processes, which means no less than two biomimetic mineralization processes.

5. The preparation method according to claim 4, characterized in that, In step 5, the ferrous salt is a water-soluble ferrous salt: ferrous sulfate, ferrous ammonium sulfate, or ferrous chloride.

6. The preparation method according to claim 4, characterized in that, In step 5, the oxidant is hydrogen peroxide.

7. The preparation method according to claim 4, characterized in that, In step 5, the pH is controlled at 8.5 and the temperature is controlled at 65℃.

8. A macronuclear magnetic ferritin, characterized in that, The macronuclear magnetic ferritin is obtained using the preparation method described in any one of claims 1-7.

9. The macronuclear magnetic ferritin according to claim 8, characterized in that, The magnetocaloric properties of the macronuclear magnetic ferritin are improved.

10. The use of the macronuclear magnetic ferritin according to any one of claims 8-9 in the preparation of magnetic nanoparticles or therapeutic substances, or in magnetothermal therapy.

Images