A strain of aspergillus corallinus and its use

Abstract

The present application relates to the field of microorganism, discloses a strain of Aspergillus coronatus and application thereof. The Asperillus coronatus provided by the present application has a preservation number of CGMCC No.41727. The Asperillus coronatus provided by the present application can produce chymosin at a high yield, has excellent renneting activity and lower proteolytic activity, can reduce the bitterness of dairy products and improve the yield; the Asperillus coronatus provided by the present application can not only shorten the fermentation time of dairy products, improve the buttery flavor of dairy products, reduce the off-flavor of dairy products, balance the sourness and sweetness of dairy products, improve the cinnamon flavor, but also has the ability of intestinal colonization, has the potential to improve the flavor level of dairy products and become intestinal probiotics.

Description

Technical Field

[0001] This invention relates to the field of microbiology, specifically to a strain of Aspergillus cristatus and its applications. Background Technology

[0002] Rennet plays a crucial role in health products and the food industry, particularly in dairy processing. During cheese production, rennet facilitates the transformation of casein in the milk from a dissolved state to a gel state, forming the core of the product's texture. Simultaneously, it serves as a nutritional supplement and digestive enzyme, optimizing the body's digestion and absorption of nutrients. Traditionally, rennet has primarily been derived from newborn mammals (such as the abomasum of calves). However, the production of these animal-derived rennets is limited and cannot meet the increasing demand, and some consumers have reservations about animal-derived rennets.

[0003] Microbial rennet is a core direction for replacing animal-derived rennet, offering advantages such as low cost, ease of extraction, high economic benefits, and production not being limited by season or region. However, existing microbial rennets suffer from problems such as low rennet activity.

[0004] Currently, Streptococcus thermophilus ( 嗜热链球菌 Lactobacillus bulgaricus ( 保加利亚乳杆菌 ), Max Kluyveromycin ( 马克斯克鲁维酵母 While some fungi, such as Aspergillus cristatus, are commonly used in fermented dairy products (e.g., butter and cheese), no single strain of Aspergillus cristatus is suitable for use in fermented dairy products. Aspergillus cristatus is a filamentous fungus that combines food safety with bioactivity. Traditionally, it is widely recognized for its role in the fermentation of Fu brick tea. Its metabolites (such as polysaccharides, polyphenols, and enzymes) have been shown to possess antioxidant, anti-inflammatory, and metabolic-regulating functions, but these effects are mostly based on in vitro experiments or short-term interventions. Even after surviving stomach acid and bile, most probiotic strains may not be able to adapt to the intestinal microenvironment (e.g., competition with existing flora or competition for nutrients) and thus struggle to colonize, resulting in their probiotic effects being only temporary and failing to provide sustained health benefits.

[0005] Therefore, there is an urgent need to develop Aspergillus cristatus for fermented dairy products, which combines high rennet production, high rennet activity, and intestinal colonization ability. Summary of the Invention

[0006] The purpose of this invention is to overcome the above-mentioned problems existing in the prior art and to provide a strain of Aspergillus cristatus and its applications.

[0007] To achieve the above objectives, the first aspect of the present invention provides a strain of Aspergillus cristatus (… 曲霉属 冠突 The preservation number of Aspergillus cristatus is CGMCC No. 41727.

[0008] A second aspect of the present invention provides a mycelium freeze-dried powder, wherein the mycelium freeze-dried powder contains mycelium of Aspergillus cristatus with preservation number CGMCC No. 41727 and skim milk powder.

[0009] A third aspect of the present invention provides a spore powder containing spores of Aspergillus cristatus with accession number CGMCC No. 41727.

[0010] A fourth aspect of the present invention provides a method for promoting curdling, the method comprising: inoculating a fermentation agent into a dairy product raw material for fermentation, wherein the fermentation agent comprises Aspergillus cristatus with preservation number CGMCC No. 41727.

[0011] The fifth aspect of the present invention provides a method for fermenting dairy products, the method comprising: inoculating a fermentation agent into dairy product raw materials for fermentation, wherein the fermentation agent comprises Aspergillus cristatus with preservation number CGMCC No.41727.

[0012] The sixth aspect of the present invention provides the use of Aspergillus cristatus as described in the first aspect in promoting curdling.

[0013] The seventh aspect of the present invention provides the application of Aspergillus cristatus as described in the first aspect in enhancing the flavor of fermented dairy products.

[0014] The beneficial effects obtained by the present invention through the above technical solution include at least the following:

[0015] (1) The Aspergillus cristatus provided by the present invention can produce high levels of rennet, has excellent rennet activity and low protein hydrolysis activity, and can reduce the bitterness of dairy products and increase yield.

[0016] (2) The Aspergillus cristatus provided by the present invention can not only shorten the fermentation time of dairy products, enhance the creamy aroma of dairy products, reduce the off-flavor of dairy products and balance the sourness and sweetness of dairy products, but also specifically enhance the cinnamon flavor and other flavor levels, and has the ability to colonize the intestines and has the potential to become a probiotic in the intestines.

[0017] Biological Preservation

[0018] The strain provided by this invention is classified and named *Aspergillus cristatus*. 冠突曲霉 It was deposited on December 23, 2024, at the China General Microbiological Culture Collection Center (CGMCC) with accession number CGMCC No. 41727 and address at No. 3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing. Attached Figure Description

[0019] Figure 1 These are photomicrographs of the sporangia of Aspergillus cristatus CCHN008;

[0020] Figure 2 These are photomicrographs of Aspergillus cristatus CCHN008 spores;

[0021] Figure 3 The results are from the curd and hydrolysis zones of CCHN008 and CICC2650. Detailed Implementation

[0022] The endpoints and any values ​​of the ranges disclosed herein are not limited to the precise ranges or values, and these ranges or values ​​should be understood to include values ​​close to these ranges or values. For numerical ranges, the endpoint values ​​of the various ranges, the endpoint values ​​of the various ranges and individual point values, and individual point values ​​can be combined with each other to obtain one or more new numerical ranges, which should be considered as specifically disclosed herein.

[0023] The inventors of this invention accidentally isolated a strain of Aspergillus cristatus with the ability to colonize the intestine during their research. 冠突曲霉 CCNH008 was accidentally discovered during further research to have a curdling effect, which can be used in fermented dairy products to improve their taste and flavor, especially to bring a special cinnamon flavor to fermented dairy products.

[0024] Based on the above findings, the first aspect of the present invention provides a strain of Aspergillus cristatus (… 冠突曲霉 The preservation number of Aspergillus cristatus is CGMCC No. 41727.

[0025] In this invention, "Aspergillus cristatus provided by this invention", "Aspergillus cristatus CCNH008", "strain CCNH008" and "CCNH008" all refer to Aspergillus cristatus with accession number CGMCC No.41727.

[0026] A second aspect of the present invention provides a mycelium freeze-dried powder, wherein the mycelium freeze-dried powder contains mycelium of Aspergillus cristatus with preservation number CGMCC No. 41727 and skim milk powder.

[0027] A third aspect of the present invention provides a spore powder containing spores of Aspergillus cristatus with accession number CGMCC No. 41727.

[0028] In this invention, the spore powder can be prepared using methods commonly used in the art, such as inoculating Aspergillus cristatus spores with accession number CGMCCNo.41727 onto a substrate for fermentation.

[0029] In this invention, the base material used to prepare the spore powder can be any substance commonly used in the art. However, the inventors of this invention have discovered in their research that, compared to other commonly used base materials, spore powder prepared using wheat bran, Pu-erh tea, green tea, black tea, white tea, Liubao tea, dark tea, or rice as a base material exhibits superior results in terms of shelf life and performance stability. Furthermore, spore powder prepared from the aforementioned base materials also possesses more beneficial acid / cholesterol resistance, stronger colonization ability, and imparts a superior flavor to fermented dairy products. Based on the above findings, the base material used for the spore powder provided by this invention is at least one of wheat bran, Pu-erh tea, green tea, black tea, white tea, Liubao tea, dark tea, or rice. In some specific embodiments of this invention, dark tea is preferred as the base material.

[0030] A fourth aspect of the present invention provides a method for promoting curdling, the method comprising: inoculating a fermentation agent into a dairy product raw material for fermentation, wherein the fermentation agent comprises Aspergillus cristatus with preservation number CGMCC No. 41727.

[0031] The fifth aspect of the present invention provides a method for fermenting dairy products, the method comprising: inoculating a fermentation agent into dairy product raw materials for fermentation, wherein the fermentation agent comprises Aspergillus cristatus with preservation number CGMCC No.41727.

[0032] Preferably, the dairy raw materials include at least one of liquid milk, solid milk, and powdered milk.

[0033] Preferably, the fermentation conditions include a temperature of 10-45°C.

[0034] Preferably, the fermentation conditions also include a pH of 5-9.

[0035] Preferably, the fermentation conditions also include a time of 1 hour to 10 days.

[0036] Furthermore, the inventors of this invention have discovered that the Aspergillus cristatus with accession number CGMCC No.41727 provided by this invention can not only be used alone for dairy product fermentation, but also has good compatibility with commercial microbial agents with fermentation effects. It can be combined with commercial strains (such as lactic acid bacteria) for fermentation, thereby further improving the fermentation effect of dairy products.

[0037] Based on the above findings, the fermentation agent may also include at least one of Lactobacillus delbrueckii subsp. bulgaricus, Streptococcus salivarius subsp. thermophilus, Lactococcus lactis subsp. diacetyl, Lactococcus lactis subsp. milk fat, and Lactococcus lactis subsp. lactic acid.

[0038] The sixth aspect of the present invention provides the use of Aspergillus cristatus as described in the first aspect in promoting curdling.

[0039] The seventh aspect of the present invention provides the application of Aspergillus cristatus as described in the first aspect in enhancing the flavor of fermented dairy products.

[0040] Preferably, the flavor is cinnamon.

[0041] The present invention will be described in detail below through examples. Unless otherwise specified, the reagents and materials used in the following examples are all commercially available products purchased from regular chemical or biological reagent / material suppliers, and all reagents are of analytical grade.

[0042] CICC2650: Aspergillus cristatus ( 冠突曲霉 Purchased from the China Industrial Microbial Culture Collection Center;

[0043] Malt extract sporulation medium: 130 g / L malt extract powder, 0.1 g / L chloramphenicol, 15 g / L agar, pH 5.6 ± 0.2;

[0044] Potato liquid medium (PDB medium): 6.0 g / L potato extract powder, 20 g / L glucose, natural pH; add agar to obtain potato agar medium (PDA medium).

[0045] Casein medium: by weight, 0.25% peptone, 1% glucose, 0.1% yeast extract, 1% casein, 2% agar, 5% skim milk, with the remainder being water, pH=7.0, sterilized at 95℃ for 15 min;

[0046] Absorbance was measured using a visible light spectrophotometer.

[0047] Example 1

[0048] The inventors accidentally isolated a strain of Aspergillus from fermented food, such as Figure 1 and Figure 2 As shown, most colonies observed during cultivation were round or oval, with a few irregularly shaped colonies. The thickness of the colony edge was slightly less than that of the central area. After 2-3 days of cultivation, the colonies were generally white or pale yellow, with the edge exhibiting a white, radiating, fluffy appearance, while the central area remained yellow. After 4-5 days of cultivation, the colony edge turned yellow or dark yellow, while the central area became dark yellow or blackish-brown. At this point, the colony color showed a concentric gradient effect from the edge to the center, gradually deepening in color. After 6-7 days of cultivation, the colonies turned blackish-brown or olive-colored, and the culture medium was also stained olive-colored or brownish-red. The colony structure was relatively dense, with the main characteristic being cleistothecia; the colony texture was felt-like, with radial grooves on the surface, and the reverse side was blackish-brown. This strain was named CCNH008.

[0049] The ITS sequence of CCNH008 is shown in SEQ ID NO.1. Comparison with data from NCBI shows that... 曲霉属 冠突 It has 99.43% homology.

[0050] SEQ ID NO.1:

[0051] TAGGGGGTGCGGGGTCTCTGGGTCACCTCCCATCCGTGTCTATCTGTACCCTGTTGCTTCGGCGTGGCCACGGCCCGCCGGAGACTAACATTTGAACGCTGTCTGAAGTTTGCAGTCTGAGTTTTTAGTTAA ACAATCGTTAAAACTTTCAACAACGGATCTCTTGGTTCCGGCATCGATGAAGAACGCAGCGAAATGCGATAATTAATGTGAATTGCAGAATTCAGTGAATCATCGAGTCTTTGAACGCACATTGCGCCCC TGGTATTCCGGGGGGCATGCCTGTCCGAGCGTCATTGCTGCCCTCAAGCACGGCTTGTGTGTTGGGCTTCCGTCCCTGGCAACGGGGACGGGCCCAAAAGGCAGTGGCGGCACCATGTCTGGTCCTCGAGC GTATGGGGCTTTGTCACCCGCTCCCGTAGGTCCAGCTGGCAGCTAGCCTCGCAACCAATCTTTTTAACCAGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCCGGAGGAA

[0052] Example 2

[0053] The pure strain CCNH008 was inoculated onto casein agar plates and incubated at 30°C for 3-5 days. The size of the white curd ring and hydrolysis ring were observed. A control group, CICC2650, was also included. Each group had five replicates. Figure 3 As shown, the average diameter of the curd ring for CCNH008 is 22.5 mm, and the average diameter of the hydrolysis ring is 3 mm, while the average diameter of the curd ring for CICC2650 is 12 mm, and the average diameter of the hydrolysis ring is 8.5 mm. A larger curd ring indicates stronger rennet activity in the strain. A larger hydrolysis ring means higher protein hydrolysis activity. Excessive protein hydrolysis activity can lead to over-hydrolysis of proteins in cheese, generating bitter peptides and affecting the palatability of the cheese.

[0054] Example 3

[0055] CCNH008 bacterial powder was inoculated into PDB medium (inoculation amount was 0.02 g bacterial powder / mL medium) and cultured at 30℃ and 120 r / min on a shaker for 24 h to obtain activated seed solution. Then, it was inoculated into sterilized medium at a 3 vol% inoculation amount and cultured at 30℃ and 120 r / min on a shaker for 1, 3, 5 and 7 days to obtain the enzyme solution to be tested at different culture times.

[0056] Skim milk powder was dissolved in 0.01 mol / L CaCl2 solution to prepare a 100 g / L skim milk solution, and left at room temperature for 30 min. It was then incubated at 35℃ for 5 min. At 35℃, 0.2 mL of the enzyme solution to be tested was added to 2 mL of the skim milk solution, quickly mixed, and the time t (in seconds) required for the flocculent aggregates to just appear was recorded. The curd activity was calculated according to the formula. The amount of rennet required to coagulate 1 mL of 100 g / L skim milk within 40 min is defined as one Soxhelt unit (SU). The curd activity is the number of Soxhelt units per mL of the enzyme solution to be tested (in SU / mL). Where n is the enzyme dilution factor (n=1 in this example). The curd activity of CICC2650 was also measured using the same method. The curd activity was calculated using the following formula, and the results are shown in Table 1.

[0057] Curd activity (SU / mL) = (2400 × 5n) / 0.5t.

[0058] Table 1

[0059]

[0060] Example 4

[0061] CCNH008 and CICC2650 were activated to the second generation on PDA medium, then transferred to malt extract sporulation medium and cultured for 10-15 days. The plates were washed with physiological saline and the mycelium was filtered off to prepare 10... 8 CFU / mL spore suspension. The spore suspension was inoculated into PDB medium and cultured for 4 days. The supernatant was collected to obtain crude enzyme solution A (unit: mL). The precipitated mycelium was dried and weighed to obtain dry weight B (unit: g, each A / B mL of crude enzyme solution corresponds to 1 g of mycelium).

[0062] Xylanase activity: At 50℃, under alkaline (pH=9.0), acidic (pH=4.8), or neutral (pH=6.0) conditions, the amount of enzyme required per gram of bacteria per minute to decompose xylan to produce 1 nmol of reducing sugar is defined as one unit of alkaline, acidic, or neutral xylanase activity. A standard curve was established between the concentration of reducing sugar (xylanase degradation product) and the absorbance at 540 nm. The xylanase activity of the test strain was calculated by measuring the rate of increase of the absorbance of the reaction solution at 540 nm, expressed in nmol / (min × g mycelial dry weight). The results are shown in Table 2.

[0063] Table 2

[0064]

[0065] Example 5

[0066] CCNH008 was inoculated onto plates containing PDA medium. Once yellow spores covered the plates, they were washed with sterile physiological saline to obtain the seed culture. The resulting 10... 8 CFU / mL seed culture was inoculated into sterilized PDB medium at an inoculum of 5 vol%, and cultured at 30℃ and 250 rpm for 120 h. Mycelia were collected by centrifugation, and the wet weight of the mycelia was weighed. Skim milk solution (12 wt% skim milk powder) was added at a weight ratio of 1:1. The mixture was then freeze-dried and pulverized in a freeze dryer at -80℃ to obtain freeze-dried mycelial powder.

[0067] CCNH008 was activated to the second generation on PDA medium, then transferred to malt extract sporulation medium and cultured for 10-15 days. The plates were washed with physiological saline, and the mycelium was filtered off, retaining the spores, to prepare 10... 8 CFU / mL spore suspension. Black tea substrate was sterilized at 121℃ for 15 min. The spore suspension was inoculated onto the sterilized substrate and fermented at 30℃ for 12 days. After drying, the spores were sieved using an automatic sieving machine to obtain spore powder with a concentration of 10. 10 CFU / g.

[0068] Example 6

[0069] The mycelial freeze-dried powder and spore powder of CICC2650 were prepared according to the method in Example 5. The gastric acid resistance and bile salt resistance of the mycelial freeze-dried powder and spore powder of CCNH008 and CICC2650 were evaluated according to T / CNHFA435-2024 "Test Method for Gastric Juice Tolerance of Probiotics". In the gastric acid resistance test, the pH was 3 and the incubation time was 2 hours; in the bile salt resistance test, the bile salt content was 0.2 wt% and the incubation time was 4 hours. OD values ​​were measured before and after the experiments. 600 .

[0070] Survival rate = Post-experimental OD 600 / OD before experiment600 ×100%.

[0071] The survival rates of the mycelial freeze-dried powders of CCNH008 and CICC2650 in the gastric acid resistance test were 95.58% and 90.33%, respectively, and the survival rates in the bile salt resistance test were 85.55% and 69.36%, respectively. The survival rates of the spore powders of CCNH008 and CICC2650 in the gastric acid resistance test were 100% and 93.1%, respectively, and the survival rates in the bile salt resistance test were 100% and 95.35%, respectively. It can be found that the gastric acid resistance and bile salt resistance of the mycelial freeze-dried powder and spore powder of CCNH008 are better than those of CICC2650 (p<0.05).

[0072] Example 7

[0073] Based on the fact that the gastric acid resistance and bile salt resistance of the spore powder in Example 6 were significantly better than those of the mycelium lyophilized powder, a further gavage experiment was conducted on mice using the spore powder to verify its intestinal colonization ability. Three experimental groups were set up, with 50 mice in each group, of strain C57BL / 6, 7-9 weeks old male mice.

[0074] 1) Normal group: PBS buffer was administered by gavage once a day for 2 weeks.

[0075] 2) Low-dose group: Low-dose CCNH008 spores dissolved in PBS buffer were administered by gavage once daily, with a final concentration of 10. 7 CFU / kgBW (BW: mouse body weight).

[0076] 3) High-dose group: Administered once daily by gavage high-dose CCNH008 spores dissolved in PBS buffer, with a final concentration of 10. 8 CFU / kgBW.

[0077] After two consecutive weeks of gavage, feces were collected every 2-4 days. The entire experiment lasted for 30 days (i.e., gavage was administered on days 1-14 without collecting feces; gavage was not administered on days 15-30, but feces were collected).

[0078] During the study, the content of *Aspergillus cristatus* in fecal samples was periodically measured using the plating method to determine the colonization status of CCNH008 in the mouse intestines. Some mice were sacrificed, and small intestine, ileum, and colon tissues, as well as the contents of different intestinal segments, were collected. The CCNH008 content (number of viable CCNH008 bacteria per gram of sample, 1 g CFU / g sample) was measured to evaluate the colonization effect of CCNH008 in the intestines. The CCNH008 content results are shown in Table 3. The intestinal samples from the normal control group mice did not contain CCNH008.

[0079] Table 3

[0080]

[0081] The results are shown in Table 3. CCNH008 was continuously excreted in the feces within 16 days after the gavage procedure (i.e., days 15-30 of the experiment), indicating that CCNH008 was present and colonized in the body during these 16 days. CCNH008 was present in the mucosa and its contents, which means that CCNH008 has the ability to colonize in the intestine.

[0082] Example 8

[0083] Fermentation agents: CICC2650 mycelium freeze-dried powder (A1), CICC2650 mycelium spore powder (A2), CCNH008 mycelium freeze-dried powder (A3) and CCNH008 spore powder (A4).

[0084] Fresh light cream was pasteurized (95°C, 30s), and then inoculated with a starter culture at a ratio of 1% (w / v) (the amount of starter culture was such that the viable count in the light cream was 1.3 × 10⁻⁶). 7 (CFU / mL). Fermentation was carried out at 13℃ until the pH of the fermentation system reached 4.5-5.0, and the fermentation time was 24 hours to obtain light cream (fermentation broth). The viable cell count and pH of the fermentation broth were then determined.

[0085] Post-fermentation fermentation: Place the fermentation liquid in a 4℃ refrigerator and let it stand for 24 hours.

[0086] Stirring to remove cheese: After the refrigerated ripening is completed, the fermentation product is stirred at 10℃ and 750rpm for 30 minutes to make the fat particles aggregate into clumps. After filtration, it is washed twice with cold water (4℃) to remove buttermilk. The washed product is then pressed using a press to remove water and shape it to obtain fermented butter. The water and fat content is measured and it is stored in the refrigerator at 4℃.

[0087] As shown in Table 4, the number of viable bacteria in the freeze-dried mycelium powder (A3) and spore powder (A4) of CCNH008 after 24 hours of fermentation was more than twice that of CICC2650, and the moisture content and fat content were also significantly higher than those of CICC2650 (p<0.05).

[0088] Table 4

[0089]

[0090] Twenty experienced sensory evaluators served as evaluators. Samples were randomly numbered, and a sensory evaluation method combining fermented butter applied to shortbread cookies and raw spread bread slices was used to score the aroma and taste of the butter. The average score after removing the highest and lowest scores was taken as the result. The detailed scoring rules are shown in Table 5, and the scoring results are shown in Table 6.

[0091] Table 5

[0092]

[0093] Table 6

[0094]

[0095] Compared to CICC2650, fermented butter made with CCNH008 has a distinct cinnamon flavor, a unique taste that is easily accepted by consumers. Furthermore, CCNH008 significantly enhances the creamy aroma and balances the acidity and sweetness.

[0096] Furthermore, solid-phase microextraction (SPME) was used for sample pretreatment, and the volatile flavor components of the fermented butter prepared from A1, A2, A3, and A4 were detected by gas chromatography-mass spectrometry (GC-MS). SPME conditions: Approximately 5g of the sample was accurately weighed and added to a 20mL headspace vial, an appropriate amount of internal standard solvent 4-octanol was added, and a 50 / 30μm DVB / CAR / PDMS extraction head was used. The extraction temperature was 65℃, and the extraction time was 60min.

[0097] GC conditions: HP-INNOWax (60m×0.25mm×0.25μm) column; carrier gas: He, flow rate: 2mL / min; injector temperature: 250℃, splitless; detector temperature: 280℃; temperature program: initial 40℃, hold for 2 min; increase to 180℃ at 3℃ / min, hold for 3 min; increase to 230℃ at 5℃ / min, hold for 5 min.

[0098] MS conditions: EI ionization source, electron energy 70 eV, ion source temperature 250 °C, mass scan range 29-350 amu, interface temperature 250 °C.

[0099] The acquired mass spectra were searched using the NIST11.L spectral library, and manual spectral analysis was performed using retention time, CAS number, and English name to determine the volatile flavor components of the fermented butter. Characteristic aroma components were evaluated using the odor activity value (OAV) method to assess the contribution of each volatile component to the overall aroma of the sample. OAV is the ratio of the concentration (C) of each aroma component to its sensory threshold (T): OAV = C / T, where the threshold is mainly derived from previously reported data. An OAV ≥ 0.1 indicates a modifying effect on the overall flavor; an OAV ≥ 1 indicates a significant contribution to the overall flavor. Within a certain range, a higher OAV value indicates a greater contribution of the substance to the overall flavor. The thresholds of each aroma component and their corresponding aroma descriptions are shown in Table 7, and the aroma measurement results for different groups are shown in Table 8.

[0100] The results showed that the fermented butter products prepared by CCNH008 had cinnamon acid flavor compounds that were not present in CICC2650, and the contribution of flavor compounds involved in its sweet and grassy aromas was higher than that of CICC2650.

[0101] Table 7

[0102]

[0103] Table 8

[0104]

[0105] Example 9

[0106] (1) The raw milk was standardized to make the weight ratio of fat to protein 1.6:1 to obtain raw milk; the raw milk was homogenized at 20 MPa, pasteurized (heated at 62℃ for 35 min), and cooled to 32℃ to obtain fermentation raw material;

[0107] Fermentation agents: CICC2650 mycelium freeze-dried powder (B1), CICC2650 mycelium spore powder (B2), CCNH008 mycelium freeze-dried powder (B3) and CCNH008 spore powder (B4).

[0108] (2) Inoculate the starter at 3 vol% into the fermentation material, stir for 2 min, and ferment at 30°C until complete curdling. Record the time required for the material to solidify during fermentation (keep fermenting until complete curdling).

[0109] (3) Add 0.04 g / kg of rennet to fermented milk, stir for 2 min, let stand for 0.5 h to obtain curd blocks;

[0110] (4) Heat the curd block to 40°C, immediately cut it into 1cm×1cm×1cm cubes with a cheese knife, stir continuously for 5 minutes, drain the whey, vacuum pack after shaping, and store at 4°C.

[0111] The cheeses in each group were scored according to the criteria in Table 9. The scoring results of cheeses made with different leavening agents are shown in Table 10.

[0112] Table 9

[0113]

[0114] Table 10

[0115]

[0116] As shown in Table 10, all scores of CCNH008 are better than those of CICC2650.

[0117] The preferred embodiments of the present invention have been described in detail above; however, the present invention is not limited thereto. Within the scope of the inventive concept, various simple modifications can be made to the technical solutions of the present invention, including combinations of various technical features in any other suitable manner. These simple modifications and combinations should also be considered as the content disclosed in the present invention and are all within the protection scope of the present invention.

Claims

1. A strain of Aspergillus cristatus ( Aspergillus cristatus ), characterized in that, The preservation number of the *Aspergillus cristatus* is CGMCC No. 41727.

2. A mycelium freeze-dried powder, characterized in that, The mycelium freeze-dried powder contains the mycelium of Aspergillus cristatus as described in claim 1 and skim milk powder.

3. A spore powder, characterized in that, The spore powder contains spores of Aspergillus cristatus as described in claim 1.

4. A method for promoting curdling, characterized in that, The method includes: inoculating a fermentation agent into a dairy raw material for fermentation, wherein the fermentation agent includes Aspergillus cristatus as described in claim 1.

5. A method for fermenting dairy products, characterized in that, The method includes: inoculating a fermentation agent into a dairy raw material for fermentation, wherein the fermentation agent includes Aspergillus cristatus as described in claim 1; The dairy raw materials include at least one of liquid milk, solid milk and powdered milk; The fermentation conditions include: a temperature of 10-45℃, a pH of 5-9, and a time of 1 hour to 10 days.

6. The use of Aspergillus cristatus according to claim 1 in the preparation of products that promote curdling.

7. The use of Aspergillus cristatus according to claim 1 in the preparation of products that enhance the flavor of fermented dairy products.

8. The application according to claim 7, wherein, The flavor is described as cinnamon.

Images