Epigenetic editing method for improving nutritional ingredients of cow milk by activating lactation gene expression

By fusing sgRNA plasmids targeting bovine lactation trait genes with histone acetylation factor P300, transcription factor VPR, and dCas9 plasmids, an epigenetic editing system was constructed, solving the problems of high biosafety risk and high off-target rate in existing technologies, and achieving a significant increase in the nutritional content of domestic cow milk.

CN120905226APending Publication Date: 2025-11-07INST OF ZOOLOGY CHINESE ACAD OF SCI
View PDF 3 Cites 0 Cited by

Patent Information

Application Number
CN202511114352.4
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-08-08
Publication Date
2025-11-07

AI Technical Summary

Technical Problem

Existing gene editing technologies pose biosafety risks and high off-target rates in regulating lactation in livestock. Traditional gene upregulation methods are cumbersome and not safe or effective enough, and epigenetic editing systems are rarely used in livestock.

Method used

We designed sgRNA plasmids targeting bovine lactation trait genes, fused them with histone acetylation factor P300 and transcription factor VPR to dCas9 plasmids, and constructed an epigenetic editing system. By transfecting specific targets that bind to the cis-acting regions of bovine lactation trait genes, we can change the epigenetic modification status of genomic regions and achieve targeted and controllable gene expression activation.

Benefits of technology

It significantly increased the content of nutrients such as casein and triglycerides in domestic cattle milk, achieving safe and efficient gene expression regulation.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120905226A_ABST
    Figure CN120905226A_ABST
Patent Text Reader

Abstract

The invention provides an epigenetic editing method for improving nutritional ingredients of cow milk by activating lactation gene expression, and belongs to the technical field of gene engineering. According to the invention, sgRNA plasmids are respectively mixed with pCMV-dCas9-VPR-GFP and pCMV-dCas9-P300-mCherry plasmids, the mixture is mixed with a P3000 culture medium and an MEM culture medium to obtain diluted nucleic acid, lip3000 and the MEM culture medium are mixed to obtain a diluted reagent, and the diluted nucleic acid and the diluted reagent are mixed, incubated and transfected to cells. By co-transfecting an epigenetic regulation tool plasmid and a targeted sgRNA plasmid, an epigenetic editing system in the cattle cells is established, the epigenetic editing system can specifically act on a cis-action region of a cattle mammary epithelial cell lactation character gene, and the mRNA expression level of a target gene is remarkably improved, so that the content of nutritional ingredients in cow milk is effectively increased.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The application belongs to the technical field of genetic engineering, and particularly relates to an epigenetic editing method for improving the nutritional components of cow milk by activating the expression of lactation genes. BACKGROUND

[0002] The lactation of cattle is regulated by many factors, and the common lactation induction method at present is achieved by hormone induction. Research shows that many genes are involved in this process, so as long as the lactation-related genes are up-regulated, the lactation amount can be theoretically improved. The common gene up-regulation method at present is to directly copy the open reading frame of the gene, and introduce it into cells to realize the overexpression of the gene. However, such method is relatively cumbersome. Since the emergence of new gene editing technology, it has attracted much attention and has been applied to many fields such as basic scientific research, medicine and health. However, the gene editing technology represented by CRISPR needs to cut the genomic DNA, which has potential biological safety risks and high off-target rate, so that such gene expression regulation tool has great limitations in application. Therefore, the epigenetic editing system based on histone acetylation and transcription factor recruitment can more safely and effectively regulate gene expression, but the current epigenetic regulation in livestock is less studied. SUMMARY

[0003] Therefore, the purpose of the present application is to provide an epigenetic editing method for improving the nutritional components of cow milk by activating the expression of lactation genes.

[0004] In order to achieve the above-mentioned purpose of the application, the present application provides the following technical solutions.

[0005] The present application provides a sgRNA targeting the cis-acting region of the lactation trait gene of cattle, wherein the lactation trait gene of cattle includes STAT5A, STAT5B and PER2.

[0006] The nucleotide sequence of the sgRNA targeting STAT5A is shown in SEQ ID NO: 1-8.

[0007] The nucleotide sequence of the sgRNA targeting STAT5B is shown in SEQ ID NO: 9-11.

[0008] The nucleotide sequence of the sgRNA targeting PER2 is shown in SEQ ID NO: 12-15.

[0009] A sgRNA plasmid includes the sgRNA and a sgRNA backbone plasmid, and the nucleotide sequence of the sgRNA backbone plasmid is shown in SEQ ID NO: 16.

[0010] The present application also provides a preparation method of the sgRNA plasmid, which includes the following steps:

[0011] The sgRNA backbone plasmid is cut by Bbs I endonuclease, and the cut sgRNA backbone plasmid and the sgRNA are connected by T4 DNA ligase to obtain the sgRNA plasmid.

[0012] The application further provides application of the sgRNA or the sgRNA plasmid in increasing the content of nutritional components in cow milk.

[0013] Preferably, the method comprises the following steps:

[0014] 1) taking the dCas9-VPR plasmid as an original carrier, replacing the Ac5 promoter on the dCas9-VPR plasmid with a CMV promoter, and connecting P2A and GFP in sequence behind the VPR on the dCas9-VPR plasmid to construct a pCMV-dCas9-VPR-GFP plasmid;

[0015] 2) taking the dCas9-P300 plasmid as an original carrier, connecting P2A and mCherry in sequence behind the P300 on the dCas9-P300 plasmid to construct a pCMV-dCas9-P300-mCherry plasmid;

[0016] 3) mixing the sgRNA plasmid with the pCMV-dCas9-VPR-GFP plasmid and the pCMV-dCas9-P300-mCherry plasmid respectively to obtain two kinds of plasmid mixtures, mixing the two kinds of plasmid mixtures with P3000 and MEM medium respectively to obtain two kinds of diluted nucleic acids, mixing lipo3000 with MEM medium to obtain a dilution reagent, mixing the two kinds of diluted nucleic acids and the dilution reagent, and incubating to obtain a transfection complex, and transfecting the transfection complex into cells.

[0017] Preferably, the nucleotide sequence of the pCMV-dCas9-VPR-GFP plasmid in step 1) is shown as SEQ ID NO: 17, and the nucleotide sequence of the pCMV-dCas9-P300-mCherry plasmid in step 2) is shown as SEQ ID NO: 18.

[0018] Preferably, the mass ratio of the sgRNA plasmid to the pCMV-dCas9-VPR-GFP plasmid in step 3) is 1:1-3, and the mass ratio of the sgRNA plasmid to the pCMV-dCas9-P300-mCherry plasmid is 1:1-3.

[0019] The volume ratio of the lipo3000 to the MEM medium is 3.75-7.5 μL:125 μL, and the incubation time is 15 min.

[0020] Preferably, the cells include bovine mammary epithelial cells BMEC and bovine mammary epithelial cells MAC-T; and the cells are transfected when they grow to 70-90%.

[0021] Preferably, the nutritional components include casein and triglyceride.

[0022] Compared with the prior art, the present application has the following beneficial effects:

[0023] The present application takes the key gene for controlling the lactation traits of domestic cattle as a target to design the sgRNA plasmid targeting the cis-acting region of the lactation traits gene of cattle, adopts the histone acetylation factor P300 and the transcription factor recruiting factor VPR to be respectively fused and expressed with the dCas9 plasmid, constructs an epigenetic editing system, changes the epigenetic modification state of the specific genomic region by transfecting the cis-acting region of the specific gene targeting the lactation traits gene of domestic cattle, performs directional and controllable gene expression activation, the mRNA expression amount of the target gene is significantly increased, and the content of the nutritional components in the milk of domestic cattle is significantly increased. BRIEF DESCRIPTION OF DRAWINGS

[0024] Figure 1 It is the chromatin open region of the upstream promoter of the STAT5A gene;

[0025] Figure 2 It is the chromatin open region of the upstream promoter of the STAT5B gene;

[0026] Figure 3 It is the chromatin open region of the upstream promoter of the PER2 gene;

[0027] Figure 4 It is a schematic diagram of the sgRNA backbone plasmid;

[0028] Figure 5 It is a schematic diagram of the pCMV-dCas9-VPR-GFP plasmid;

[0029] Figure 6 It is a schematic diagram of the pCMV-dCas9-P300-mCherry plasmid;

[0030] Figure 7 It is a transfection flowchart;

[0031] Figure 8 It is the mRNA expression amount of the STAT5A gene in the BMEC cell line treated by different sgRNAs targeting the STAT5A gene;

[0032] Figure 9 It is the mRNA expression amount of the PER2 gene in the BMEC cell line treated by different sgRNAs targeting the PER2 gene;

[0033] Figure 10 mRNA expression of STAT5A and PER2 genes in BMEC cell lines treated by sgRNA plasmid mixture;

[0034] Figure 11 total casein and triglyceride content of STAT5A and PER2 genes in BMEC cell lines treated by sgRNA plasmid mixture;

[0035] Figure 12 mRNA expression of STAT5A gene in MAC-T cell lines treated by sgRNAs targeting STAT5A gene;

[0036] Figure 13 mRNA expression of STAT5B gene in MAC-T cell lines treated by sgRNAs targeting STAT5B gene;

[0037] Figure 14 mRNA expression of PER2 gene in MAC-T cell lines treated by sgRNAs targeting PER2 gene;

[0038] Figure 15 mRNA expression of STAT5A, STAT5B and PER2 genes in MAC-T cell lines treated by sgRNA plasmid mixture;

[0039] Figure 16 total casein and triglyceride content of STAT5A, STAT5B and PER2 genes in MAC-T cell lines treated by sgRNA plasmid mixture. DETAILED DESCRIPTION

[0040] The present application provides an sgRNA targeting the cis-acting region of bovine lactation trait genes, including STAT5A, STAT5B and PER2.

[0041] The nucleotide sequence of the sgRNA targeting STAT5A is shown in SEQ ID NO: 1-8,

[0042] The SEQ ID NO: 1 is specifically GAAGGAGAGAGCAACGCAGA,

[0043] The SEQ ID NO: 2 is specifically CCCGCAAGGCCTGTAGGCAG,

[0044] The SEQ ID NO: 3 is specifically GAGAGCGACCGAGGCTGGGA,

[0045] The SEQ ID NO: 4 is specifically GAGGAGGAAATCGCTGCTCT,

[0046] The SEQ ID NO: 5 is specifically CCGGACCGCCCGGCACGACC,

[0047] The SEQ ID NO: 6 is specifically AGCGGTGGCCGAGCCGTCCA,

[0048] The SEQ ID NO: 7 is specifically CACCGTCTTTCTTCCCGCAC,

[0049] The SEQ ID NO: 8 is specifically AGTCCACGCCTGTGACGAGA,

[0050] The nucleotide sequence of the sgRNA targeting STAT5B is shown as SEQ ID NO: 9-11,

[0051] The SEQ ID NO: 9 is specifically GAGGCAGCTGACCTTTTGGA,

[0052] The SEQ ID NO: 10 is specifically CTTCTTCCTGTAACAGTGCA,

[0053] The SEQ ID NO: 11 is specifically TCTGCCGCTATCCTGGCTGC,

[0054] The nucleotide sequence of the sgRNA targeting PER2 is shown as SEQ ID NO: 12-15,

[0055] The SEQ ID NO: 12 is specifically CCGCCGCCAATGGCGGGCGC,

[0056] The SEQ ID NO: 13 is specifically TGACAGCGGCGAGTCCGCGC,

[0057] The SEQ ID NO: 14 is specifically GCTTTCGGCCGCAGCGGCGG,

[0058] The SEQ ID NO: 15 is specifically GCCGCGCGCGGATCGTCCAG.

[0059] The application also provides an sgRNA plasmid, which comprises the sgRNA and an sgRNA backbone plasmid, and the nucleotide sequence of the sgRNA backbone plasmid is shown as SEQ ID NO: 16, and is specifically

[0060]

[0061] The application further provides a preparation method of the sgRNA plasmid, comprising the following steps:

[0062] The sgRNA backbone plasmid is cut by Bbs I endonuclease, and the sgRNA backbone plasmid after enzyme cutting and the sgRNA are connected by T4 DNA ligase to obtain the sgRNA plasmid.

[0063] The application further provides application of the sgRNA or the sgRNA plasmid in increasing the content of nutritional components in cow milk.

[0064] In the application, the following steps are included:

[0065] 1) taking the dCas9-VPR plasmid as an original carrier, replacing the Ac5 promoter on the dCas9-VPR plasmid with a CMV promoter, and connecting P2A and GFP in sequence behind the VPR on the dCas9-VPR plasmid to construct a pCMV-dCas9-VPR-GFP plasmid;

[0066] 2) taking the dCas9-P300 plasmid as an original carrier, connecting P2A and mCherry in sequence behind the P300 on the dCas9-P300 plasmid to construct a pCMV-dCas9-P300-mCherry plasmid;

[0067] 3) mixing the sgRNA plasmid with the pCMV-dCas9-VPR-GFP plasmid and the pCMV-dCas9-P300-mCherry plasmid respectively to obtain two kinds of plasmid mixtures, mixing the two kinds of plasmid mixtures with P3000 and MEM medium respectively to obtain diluted nucleic acids, mixing lipo3000 with MEM medium to obtain a diluted reagent, mixing the two kinds of diluted nucleic acids and the diluted reagent, incubating to obtain a transfection complex, and transfecting the transfection complex into cells.

[0068] In the application, the dCas9-VPR plasmid is taken as an original carrier, the Ac5 promoter on the dCas9-VPR plasmid is replaced with a CMV promoter, and P2A and GFP are connected in sequence behind the VPR on the dCas9-VPR plasmid to construct a pCMV-dCas9-VPR-GFP plasmid. The nucleotide sequence of the pCMV-dCas9-VPR-GFP plasmid is shown as SEQ ID NO: 17, and specifically is

[0069]

[0070]

[0071]

[0072] In the present application, the dCas9-P300 plasmid is used as the original carrier, and P2A and mCherry are sequentially connected behind P300 on the dCas9-P300 plasmid to construct the pCMV-dCas9-P300-mCherry plasmid. The nucleotide sequence of the pCMV-dCas9-P300-mCherry plasmid is shown as SEQ ID NO: 18, and specifically

[0073]

[0074]

[0075]

[0076]

[0077] In the present application, the sgRNA plasmid is mixed with the pCMV-dCas9-VPR-GFP plasmid and the pCMV-dCas9-P300-mCherry plasmid respectively to obtain two kinds of plasmid mixtures, the plasmid mixtures are mixed with P3000 and MEM medium to obtain two kinds of diluted nucleic acids, lipo3000 is mixed with MEM medium to obtain a diluted reagent, the two kinds of diluted nucleic acids and the diluted reagent are mixed and incubated to obtain a transfection complex, and the transfection complex is transfected into cells. The mass ratio of the sgRNA plasmid to the pCMV-dCas9-VPR-GFP plasmid is preferably 1:1-3, and further preferably 1:2; the mass ratio of the sgRNA plasmid to the pCMV-dCas9-P300-mCherry plasmid is preferably 1:1-3, and further preferably 1:2; the volume ratio of the lipo3000 to the MEM medium is preferably 3.75-7.5 μL: 125 μL, and further preferably 5 μL: 125 μL; the incubation time is preferably 15 min; the cells include bovine mammary epithelial cells BMEC and bovine mammary epithelial cells MAC-T; and the cells are transfected when they grow to 70-90%.

[0078] In the present application, the nutritional components include casein and triglyceride.

[0079] The technical solutions provided by the present application will be described in detail below in combination with examples, but they should not be understood as limiting the scope of protection of the present application.

[0080] Example 1

[0081] 1. Construction of sgRNA plasmid

[0082] The literature reported lactation key genes STAT5A, STAT5B, PER2 were targeted, the reference sequence was derived from the reference genome ARS-UCD2.0 (https: / / www.ncbi.nlm.nih.gov / datasets / taxonomy / 9913 / ) of NCBI, and the chromatin open region of the upstream promoter was found through the bovine genome bioinformatics database (https: / / data.faang.org / genome_browser) (as shown in Figures 1-3 ), through BLAST comparison with the whole genome, sgRNAs with lower predicted off-target probability (as shown in Table 1) were selected as candidates, and the method designed by Zhang Feng (https: / / doi.org / 10.1038 / nprot.2013.143) was used to construct the sgRNA original skeleton plasmid preserved in the laboratory (nucleotide sequence as shown in SEQ ID NO: 16), and the schematic diagram of the sgRNA skeleton plasmid is as shown in Figure 4 , specifically: 1) the sgRNA skeleton plasmid was cut by Bbs I endonuclease; 2) the sgRNA upstream and downstream primers were ordered and synthesized, both were diluted to 10 μM, 10 μL of each was mixed, then Nuclease Free water was added to 50 μL, the annealing program was: 95℃ 5min; 0.1s / cycle (-2℃ / cycle, to 85℃); 0.1s / cycle (-0.1℃ / cycle, to 25℃); 4℃ storage for standby; 3) the enzyme-cut sgRNA skeleton and the annealed sgRNA were mixed, and T4 DNA ligase was used for ligation, after transformation, single clone selection was performed, and the correct ones were sequenced to obtain high-concentration endotoxin-free sgRNA plasmid which could be used for transfection by using Tian Gen large endotoxin-free plasmid extraction kit.

[0083] Table 1 sgRNA sequences targeting lactation key genes STAT5A, STAT5B, PER2

[0084] STAT5A-gRNA1 GAAGGAGAGAGCAACGCAGA (SEQ ID NO: 1) STAT5A-gRNA2 CCCGCAAGGCCTGTAGGCAG (SEQ ID NO: 2) STAT5A-gRNA3 GAGAGCGACCGAGGCTGGGA (SEQ ID NO: 3) STAT5A-gRNA4 GAGGAGGAAATCGCTGCTCT (SEQ ID NO: 4) STAT5A-gRNA5 CCGGACCGCCCGGCACGACC (SEQ ID NO: 5) STAT5A-gRNA6 AGCGGTGGCCGAGCCGTCCA (SEQ ID NO: 6) STAT5A-gRNA7 CACCGTCTTTCTTCCCGCAC (SEQ ID NO: 7) STAT5A-gRNA8 AGTCCACGCCTGTGACGAGA (SEQ ID NO: 8) STAT5B-gRNA1 GAGGCAGCTGACCTTTTGGA (SEQ ID NO: 9) STAT5B-gRNA2 CTTCTTCCTGTAACAGTGCA (SEQ ID NO: 10) STAT5B-gRNA3 TCTGCCGCTATCCTGGCTGC (SEQ ID NO: 11) PER2-gRNA1 CCGCCGCCAATGGCGGGCGC (SEQ ID NO: 12) PER2-gRNA2 TGACAGCGGCGAGTCCGCGC (SEQ ID NO: 13) PER2-gRNA3 GCTTTCGGCCGCAGCGGCGG (SEQ ID NO: 14) PER2-gRNA4 GCCGCGCGCGGATCGTCCAG (SEQ ID NO: 15)

[0085] 2. Construction of pCMV-dCas9-VPR-GFP plasmid and pCMV-dCas9-P300-mCherry plasmid

[0086] (1) Construction of pCMV-dCas9-VPR-GFP plasmid

[0087] The commercial dCas9-VPR plasmid was purchased from Fuhui Biotechnology Co., Ltd. The Ac5 promoter was replaced with the CMV promoter, and P2A and GFP were connected behind VPR. The pCMV-dCas9-VPR-GFP plasmid was synthesized by Nanjing Kings River Biotechnology Co., Ltd. and was ready for use after sequencing.

[0088] The nucleotide sequence of the pCMV-dCas9-VPR-GFP plasmid is shown as SEQ ID NO: 17, and the schematic diagram of the pCMV-dCas9-VPR-GFP plasmid is shown as Figure 5 .

[0089] (2) Construction of pCMV-dCas9-P300-mCherry plasmid

[0090] The commercial dCas9-P300 plasmid was purchased from Changsha Ruining Biotechnology Co., Ltd. P2A and mCherry were connected behind P300. The pCMV-dCas9-P300-mCherry plasmid was synthesized by Nanjing Kings River Biotechnology Co., Ltd. and was ready for use after sequencing.

[0091] The nucleotide sequence of the pCMV-dCas9-P300-mCherry plasmid is shown as SEQ ID NO: 18, and the schematic diagram of the pCMV-dCas9-P300-mCherry plasmid is shown as Figure 6 .

[0092] 3. Transfection

[0093] Two bovine mammary epithelial cell lines, BMEC and MAC-T (Shanghai Meiwai Biotechnology Co., Ltd.), were selected as experimental materials. For example, six replicates of 6-well plates were used for each experimental group. Each of the six replicates was co-transfected with single sgRNA plasmid or sgRNA plasmid mixture (STAT5A is a plasmid mixture of STAT5A-gRNA1-STAT5A-gRNA8 mixed at an equal ratio (sgRNA plasmid mixture 1)) and pCMV-dCas9-VPR-GFP plasmid, single sgRNA plasmid or sgRNA plasmid mixture (STAT5B is a plasmid mixture of STAT5B-gRNA1-STAT5B-gRNA3 mixed at an equal ratio (sgRNA plasmid mixture 3)) and pCMV-dCas9-P300-mCherry plasmid, and the control group of STAT5A and PER2 was co-transfected with sgRNA plasmid backbone (non-targeting sgRNA) and pCMV-dCas9-VPR-GFP plasmid in six replicates, and the control group of STAT5B was co-transfected with sgRNA plasmid backbone (non-targeting sgRNA) and pCMV-dCas9-P300-mCherry plasmid in six replicates. According to the instructions of the Thermo lipo3000 transfection reagent, the cells were transfected when they reached 80% confluence. First, single sgRNA plasmid or sgRNA plasmid mixture 1-2 was mixed with pCMV-dCas9-VPR-GFP plasmid at a mass ratio of 1:2 to obtain plasmid mixture A, and single sgRNA plasmid or sgRNA plasmid mixture 3 was mixed with pCMV-dCas9-P300-mCherry plasmid at a mass ratio of 1:2 to obtain plasmid mixture B. Then, 5 μL P3000 and 125 μL MEM medium were mixed to obtain diluted nucleic acid, and 5 μL lipo3000 and 125 μL MEM medium were mixed to obtain diluted reagent. Then, the diluted nucleic acid and the diluted reagent were mixed and incubated at room temperature for 15 min to obtain the transfection complex (transfection flow chart as shown in Figure 7 250 μL of the transfection complex was added to each well of cells.

[0094] After 48 hours of transfection, the indicators of the cells were detected.

[0095] (1) Total RNA was isolated using the guanidine isothiocyanate method (TRizol). Taking a 12-well plate as an example, 1 mL of TRizol was added to each well for lysis, followed by 200 μL of chloroform. The mixture was vigorously shaken to mix. After incubation on ice for 5 min, the layers separated and then centrifuged at 12,000 rpm for 15 min in a pre-cooled centrifuge at 4°C. The supernatant was collected, and 1 μL of glycogen was added. An equal volume of isopropanol was added to the supernatant, and the mixture was incubated overnight at -20°C for precipitation. After centrifugation at 13,000 rpm for 30 min, the supernatant was discarded, and the RNA precipitate was collected at the bottom of the tube. 500 μL of 75% ethanol (prepared with RNase-free water) was added to the RNA precipitate, and the tube was washed twice. The tube was then centrifuged at 7500 rpm for 5 min at 4°C, and the supernatant was discarded. The precipitate at the bottom was the RNA. After drying the precipitate at room temperature for 30 minutes, add 25 μl of RNase-free water to the precipitate and gently tap the tube wall to fully dissolve the RNA. Then, measure the RNA concentration using nanodrop. Take 1 μg of RNA and synthesize cDNA using the Tiangen FastKing reverse transcription kit. After diluting it five times, perform a quantitative experiment (q-PCR) using Tiangen Quantitative Mix to determine gene expression.

[0096] (2) The contents of the corresponding metabolites were detected using the Casein (bovine total casein) assay kit and Solarbiotase triglyceride (TG) assay kit from Shanghai Enzyme-Link Biotechnology Co., Ltd.

[0097] ①For BMEC cell lines

[0098] Experimental results: such as Figures 8-10 As shown, compared with the untransfected target sgRNA group, transfection with four single sgRNAs, STAT5A-sgRNA8 and PER2, in single sgRNA plasmids significantly increased mRNA levels. The mRNA expression levels of STAT5A and PER2 genes were also significantly increased in the sgRNA plasmid mixture transfected group.

[0099] like Figure 11 As shown. Crtl was not treated in any way, Blank was the control group. Compared with the group without transfection of the targeting sgRNA, the total casein content of STAT5A and PER2 was significantly increased in the sgRNA plasmid mixture treatment, and the triglyceride content of PER2 showed an upward trend.

[0100] ②For MAC-T cell lines

[0101] Experimental results: such as Figures 12-15 As shown in the figure, compared with the group without target sgRNA, the mRNA expression levels of STAT5A and PER2 genes were significantly increased in the group transfected with a single sgRNA plasmid, and the mRNA expression levels of STAT5A, STAT5B and PER2 genes were all significantly increased in the group transfected with a mixture of sgRNA plasmids.

[0102] As shown in Figure 16 Crtl without any treatment, Blank is the control group, compared with the group of untransfected targeting sgRNA, the content of total tyrosine protein of STAT5A, STAT5B and PER2 treated by sgRNA plasmid mixture is significantly improved, the content of triglyceride of STAT5B is significantly improved, and the content of triglyceride of STAT5A and PER2 has an upward trend.

[0103] From the above examples, the present application establishes an epigenetic editing system in bovine cells by co-transfecting epigenetic regulation tool plasmid and targeting sgRNA plasmid, specifically targets the cis-acting region of the gene related to the lactation trait of bovine mammary epithelial cells, realizes the precise activation of the expression of the key gene of bovine lactation, the mRNA expression of the target gene is significantly increased, and the content of nutritional ingredients in bovine milk is significantly improved.

[0104] The above is only the preferred embodiment of the present application, it should be pointed out that, for those skilled in the art, without departing from the principles of the present application, can make a number of improvements and refinements, these improvements and refinements should also be considered as the protection scope of the present application.

Claims

1. An sgRNA targeting a cis-acting region of a bovine lactation trait gene, characterized in that, The bovine lactation trait genes comprise STAT5A, STAT5B and PER2; The nucleotide sequence of the sgRNA targeting STAT5A is shown as SEQ ID NO: 1-8; The nucleotide sequence of the sgRNA targeting STAT5B is shown as SEQ ID NO: 9-11; The nucleotide sequence of the sgRNA targeting PER2 is shown as SEQ ID NO: 12-15.

2. A sgRNA plasmid, characterized in that, The sgRNA plasmid comprises the sgRNA of claim 1 and an sgRNA backbone plasmid, and the nucleotide sequence of the sgRNA backbone plasmid is shown as SEQ ID NO:

16.

3. The method of claim 2, wherein the sgRNA plasmid is prepared by, The method comprises the following steps: The sgRNA backbone plasmid is cut by BbsI endonuclease, and the cut sgRNA backbone plasmid and the sgRNA of claim 1 are connected by T4 DNA ligase to obtain the sgRNA plasmid.

4. The sgRNA of claim 1 or the sgRNA plasmid of any one of claims 2-3 for use in increasing the content of milk nutritional components in cattle.

5. Use according to claim 4, characterized in that, The method comprises the following steps: 1) Taking the dCas9-VPR plasmid as the original carrier, replacing the Ac5 promoter on the dCas9-VPR plasmid with the CMV promoter, and connecting P2A and GFP in sequence behind the VPR on the dCas9-VPR plasmid to construct the pCMV-dCas9-VPR-GFP plasmid; 2) Taking the dCas9-P300 plasmid as the original carrier, connecting P2A and mCherry in sequence behind the P300 on the dCas9-P300 plasmid to construct the pCMV-dCas9-P300-mCherry plasmid; 3) Mixing the sgRNA plasmid of claim 2 with the pCMV-dCas9-VPR-GFP plasmid and the pCMV-dCas9-P300-mCherry plasmid respectively to obtain two kinds of plasmid mixtures, mixing the two kinds of plasmid mixtures with P3000 and MEM medium to obtain two kinds of diluted nucleic acids, mixing lipo3000 with MEM medium to obtain a diluted reagent, mixing the two kinds of diluted nucleic acids and the diluted reagent, and incubating to obtain a transfection complex, and transfecting the transfection complex into cells.

6. Use according to claim 5, characterized in that, The nucleotide sequence of the pCMV-dCas9-VPR-GFP plasmid of step 1) is shown as SEQ ID NO: 17, and the nucleotide sequence of the pCMV-dCas9-P300-mCherry plasmid of step 2) is shown as SEQ ID NO:

18.

7. Use according to claim 5, characterized in that, The mass ratio of the sgRNA plasmid of claim 2 to the pCMV-dCas9-VPR-GFP plasmid is 1:1-3, and the mass ratio of the sgRNA plasmid of claim 2 to the pCMV-dCas9-P300-mCherry plasmid is 1:1-3; The volume ratio of the lipo3000 to the MEM medium is 3.75-7.5 μL:125 μL; and the incubation time is 15 min.

8. Use according to claim 5, characterized in that, The cells include bovine mammary epithelial cells BMEC and bovine mammary epithelial cells MAC-T; the cells are transfected when they grow to 70-90%.

9. Use according to claim 4, characterized in that, The nutritional components include casein and triglyceride.

Citation Information

Patent Citations

  • Eukaryote CRISPR-Cas9 double gRNA vector and construction method

    CN111534541A

  • Method for site-directed mutagenesis by using dCas9-p450 system

    CN115704016A

  • Vectors For Integration Of DNA Into Genomes And Methods For Altering Gene Expression And Interrogating Gene Function

    US20180305719A1