Use of a small molecule compound in the prevention and treatment of plant RNA virus infection

By spraying 2'-amino-2'-deoxyguanosine (ADG) on plants, the problems of long cycle and serious pollution in the control of plant RNA viruses in the existing technology have been solved. It has achieved efficient, safe and broad-spectrum inhibition of a variety of viruses, which meets the requirements of sustainable agriculture.

CN120918189BActive Publication Date: 2026-04-28NINGBO UNIV
View PDF 2 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
NINGBO UNIV
Filing Date
2025-10-14
Publication Date
2026-04-28

AI Technical Summary

Technical Problem

Existing technologies for controlling plant RNA virus infections suffer from problems such as long cycles, serious chemical pesticide pollution, and instability of biological agents, making it difficult to achieve long-term, safe, and broad-spectrum control effects.

Method used

Using 2'-amino-2'-deoxyguanosine (ADG) as a small molecule compound, it can broadly inhibit a variety of plant RNA viruses through exogenous spraying, induce plant antiviral immune responses, and inhibit virus replication.

Benefits of technology

It achieves highly efficient inhibition of a variety of plant RNA viruses, reduces the risk of phytotoxicity, reduces the use of chemical pesticides, conforms to sustainable agricultural development, and improves the safety and broad-spectrum effectiveness of prevention and control.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120918189B_ABST
    Figure CN120918189B_ABST
Patent Text Reader

Abstract

The application discloses an application of a small-molecule compound in preventing and treating plant RNA virus infection and belongs to the technical field of biotechnology. 2'-amino-2'-deoxyguanosine (ADG) is applied as the only antiviral active ingredient in plant RNA virus prevention for the first time, only a low concentration of 250 muM is needed, and a simple exogenous spraying method can achieve the broad-spectrum inhibition of various plant RNA viruses such as turnip mosaic virus (TuMV), tomato mosaic virus (ToMV) and tobacco mosaic virus (TMV), and after spraying, the normal growth of plants is not affected, the risk of drug damage is completely avoided, the safety, high efficiency and broad spectrum of plant RNA virus prevention are significantly improved, and the application has important practical application significance for guaranteeing the yield and quality of crops in agricultural production and promoting the green transformation of agriculture.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of biotechnology, and in particular to the application of a small molecule compound in the prevention and control of plant RNA virus infection. Background Technology

[0002] In agricultural production, plant viral diseases are a core bottleneck restricting crop yield improvement and quality optimization, among which infections caused by plant RNA viruses are particularly prominent. These viruses have highly diverse transmission routes, including vector insect transmission, soil transmission, seed transmission, and pollen transmission, causing the disease to spread exponentially once an outbreak occurs, making it difficult to eradicate effectively with conventional control methods.

[0003] Current mainstream plant RNA virus control strategies all have significant limitations: First, the breeding cycle for disease-resistant varieties is as long as 8-10 years, and they are prone to losing resistance due to viral mutations; Second, chemical pesticides have problems such as high residues and single targets, and are accompanied by ecotoxicity risks, which can easily cause harm to the environment; Third, biological agents are limited by poor environmental stability and large fluctuations in field control effects, making it difficult to guarantee stable control effects.

[0004] In recent years, small molecule compounds have shown great potential in antiviral drug development due to their advantages of high efficiency, safety, and fewer side effects. These compounds can resist viral infection by directly inhibiting viral replication and motility, activating the host's immune response, or enhancing the host's resistance. Therefore, discovering safe, efficient small molecule compounds with broad-spectrum inhibitory effects against various plant RNA viruses is of great practical significance.

[0005] Nucleoside analogs, as a class of small molecule compounds with structures similar to natural nucleosides but modified, can exert their effects by mimicking natural nucleotides involved in DNA or RNA synthesis, thereby disrupting viral replication and infection processes. They possess unique advantages in the control of plant viral diseases, reducing the use of chemical pesticides and lowering environmental pollution, aligning with the direction of sustainable agricultural development. However, existing nucleoside antiviral agents (such as ribavirin and 2'-fluoroguanosine) have significant drawbacks: treatment with these agents after viral infection of plants is completely ineffective in inhibiting viral activity; furthermore, these agents have certain phytotoxic effects on plants and a short duration of action, failing to meet the needs of agricultural production for long-term, safe control of plant RNA viruses. Therefore, there is an urgent need to develop novel nucleoside analogs to overcome these technological bottlenecks. Summary of the Invention

[0006] The purpose of this invention is to provide an application of a small molecule compound in the prevention and control of plant RNA virus infection, thereby addressing the problems existing in the prior art. This invention is the first to use 2'-amino-2'-deoxyguanosine as the sole antiviral active ingredient. Exogenous application at 250 μM can broadly inhibit multiple plant RNA viruses without phytotoxicity or impacting plant growth. This overcomes the shortcomings of traditional control methods, reduces the use of chemical pesticides, aligns with sustainable agriculture, and fills the gap in green, efficient, and broad-spectrum inhibitors.

[0007] To achieve the above objectives, the present invention provides the following solution:

[0008] This invention provides the application of a small molecule compound in the preparation of a drug for combating plant RNA virus infection, wherein the small molecule compound is 2'-amino-2'-deoxyguanosine.

[0009] Optionally, the RNA virus includes turnip mosaic virus, tomato mosaic virus, and tobacco mosaic virus.

[0010] The present invention also provides a method for preventing and controlling plant RNA virus infection, comprising the step of spraying the plant with a drug whose active ingredient is 2'-amino-2'-deoxyguanosine.

[0011] Optionally, during spraying, the concentration of the 2'-amino-2'-deoxyguanosine is 250 μM.

[0012] Optionally, the spraying site is the leaf.

[0013] Optionally, the plant includes tobacco.

[0014] The present invention also provides a method for improving the resistance of plants to RNA viruses, comprising the step of exogenously spraying the plant with a drug whose active ingredient is 2'-amino-2'-deoxyguanosine.

[0015] Optionally, during spraying, the concentration of the 2'-amino-2'-deoxyguanosine is 250 μM.

[0016] Optionally, the spraying site is the leaf.

[0017] Optionally, the plant includes tobacco.

[0018] The present invention discloses the following technical effects:

[0019] This invention is the first to apply 2'-amino-2'-deoxyguanosine (ADG) as the sole antiviral active ingredient for the control of plant RNA viruses. Only a low concentration of 250 μM is required. Through a simple exogenous spraying method, it can achieve broad-spectrum inhibition of multiple plant RNA viruses such as turnip mosaic virus (TuMV), tomato mosaic virus (ToMV), and tobacco mosaic virus (TMV). Moreover, it does not affect the normal growth of plants after spraying, completely avoids the risk of phytotoxicity, and significantly improves the safety, efficiency and broad-spectrum control of plant RNA viruses.

[0020] This invention possesses significant advantages in its mechanism of action and application value: ADG can efficiently penetrate plant leaf tissues, inducing the plant's own antiviral immune response and inhibiting viral replication and protein accumulation at the molecular level. This not only effectively reduces the infected area and viral accumulation but also offers ease of operation—requiring no complex equipment; exogenous spraying on plant leaves is sufficient, facilitating large-scale field application. Simultaneously, this technology can significantly reduce the use of chemical pesticides, lowering environmental pollution and perfectly aligning with the direction of sustainable agricultural development. It fills the market gap for green, efficient, and broad-spectrum inhibitors of plant RNA viruses, and has significant practical application value for ensuring crop yield and quality in agricultural production and promoting the green transformation of agriculture. Attached Figure Description

[0021] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.

[0022] Figure 1 Figures showing the viral infection status in the control and treatment groups under ultraviolet light;

[0023] Figure 2 A statistical graph showing the infection ratio of fluorescent lesion area between the treatment group and the control group for three viruses: TuMV (A), ToMV (B), and TMV (C).

[0024] Figure 3 The image shows the Western blot (WB) results of viral protein accumulation in the treatment and control groups for the three viruses. Detailed Implementation

[0025] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as a limitation of the present invention, but rather as a more detailed description of certain aspects, features, and embodiments of the present invention.

[0026] It should be understood that the terminology used in this invention is merely for describing particular embodiments and is not intended to limit the invention. Furthermore, with respect to numerical ranges in this invention, it should be understood that each intermediate value between the upper and lower limits of the range is also specifically disclosed. Any stated value or intermediate value within a stated range, as well as each smaller range between any other stated value or intermediate value within said range, is also included in this invention. The upper and lower limits of these smaller ranges may be independently included or excluded from the range.

[0027] Unless otherwise stated, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art. While only preferred methods and materials have been described herein, any methods and materials similar or equivalent to those described herein may be used in the implementation or testing of this invention. All references to this specification are incorporated by way of citation to disclose and describe methods and / or materials associated with those references. In the event of any conflict with any incorporated reference, the content of this specification shall prevail.

[0028] Various modifications and variations can be made to the specific embodiments described in this specification without departing from the scope or spirit of the invention, as will be apparent to those skilled in the art. Other embodiments derived from this specification will also be apparent to those skilled in the art. This specification and embodiments are merely exemplary.

[0029] The terms “include,” “including,” “have,” “contain,” etc., used in this article are all open-ended terms, meaning that they include but are not limited to.

[0030] The small molecule compound described in this invention is 2'-Amino-2'-deoxyguanosine (ADG), with the chemical formula C10H14N6O4 and CAS number 60966-26-9. It is a structurally modified guanosine analog, and its chemical structural formula is as follows:

[0031] .

[0032] Example

[0033] I. Experimental Methods and Procedures

[0034] 1. Preparation of ADG working solution

[0035] Take ADG powder (purity ≥98%), use sterile water as solvent, and mix thoroughly with a vortex mixer to prepare an ADG working solution with a concentration of 250μM. After preparation, filter it through a 0.22μm sterile filter membrane for sterilization, store it in a 4℃ refrigerator for later use, and bring it to room temperature before use.

[0036] 2. Construction of viral infectious clonal recombinant plasmids and Agrobacterium-mediated transformation

[0037] 2.1 PCR cloning of full-length viral cDNA

[0038] Based on the full-length cDNA sequences of TuMV (GenBank: MH735112.1), ToMV (GenBank: AJ417701.1), and TMV (GenBank: OL471714.1), specific primers were designed (the upstream primer contains an XbaⅠ restriction site, and the downstream primer contains a BamHI restriction site; the primers were synthesized by Sangon Biotech (Shanghai) Co., Ltd.):

[0039] TuMV-specific primers (SEQ ID NO.1-2):

[0040] F:TCTAGAAAAAATATAAAAACTCAACACAACATACAC, SEQ ID NO.1;

[0041] R-: GGATCCGTCCCTTGCATCCTATCAAATGTTAAGGCA, SEQ ID NO.2;

[0042] ToMV-specific primers (SEQ ID NO.3-4):

[0043] F: TCTAGAGTATTTTTACAACAATTACCAACAA, SEQ ID NO.3;

[0044] R-:GGATCCTGGGCCCCAACCGGGGGTTCCGGGG, SEQ ID NO.4;

[0045] TMV-specific primers (SEQ ID NO.5-6):

[0046] F-: TCTAGACAACAATTACCAACAACAACAAACA, SEQ ID NO.5;

[0047] R: GGATCCTGGGCCCCTACCGGGGGTAACGGGG, SEQ ID NO. 6.

[0048] Using the cDNA of each virus as a template, PCR amplification was performed (reaction system: 2×Taq Master Mix 25μL, upstream primer (10μM) 2μL, downstream primer (10μM) 2μL, cDNA template 1μL, sterile water 20μL; reaction program: 95℃ pre-denaturation for 5 min; 95℃ denaturation for 30 s, 58℃ annealing for 30 s, 72℃ extension (TuMV: 3.5 min, ToMV: 3 min, TMV: 2.5 min), for a total of 35 cycles; 72℃ final extension for 10 min).

[0049] 2.2 Construction of Recombinant Plasmids

[0050] The full-length viral fragments obtained by PCR amplification and the vector pCB301-GFP (containing the 35S promoter) were double-digested with XbaⅠ and BamHI, respectively.

[0051] Enzyme digestion system: 10 μL vector / fragment, 2 μL 10× digestion buffer, 1 μL XbaⅠ, 1 μL BamHI, 6 μL sterile water, incubated at 37℃ for 2 h.

[0052] After the enzyme digestion products were separated by agarose gel electrophoresis (1% agarose, 120V electrophoresis for 30 min), the target fragment and the vector fragment were recovered using a gel recovery kit; and ligation was performed using T4 DNA ligase.

[0053] Ligation system: 3 μL vector fragment, 6 μL target fragment, 1 μL 10×T4 ligation buffer, 1 μL T4 DNA ligase, ligated overnight at 16℃ to construct recombinant plasmids pCB301-TuMV-GFP, pCB301-ToMV-GFP and pCB301-TMV-GFP, respectively.

[0054] 2.3 Agrobacterium-mediated electroporation transformation

[0055] Take 100 μL of Agrobacterium GV3101 competent cells, add 1 μg of the above-mentioned pCB301-TuMV-GFP, pCB301-ToMV-GFP and pCB301-TMV-GFP recombinant plasmids respectively, mix gently and transfer to a 0.2 cm electroporation cuvette (pre-cooled); place the electroporation cuvette in an electroporation transducer, set the parameters (voltage 2.5 kV, capacitance 25 μF, resistance 200 Ω) for electroporation; immediately after electroporation, add 1 m of LYEP liquid medium (antibiotic-free), and culture at 28℃ with shaking (150 rpm) for 1 h.

[0056] Spread 200 μL of culture onto YEP solid medium containing 50 μg / mL rifampicin (Rif) and 50 μg / mL kanamycin (Kan), and incubate upside down at 28°C for 24-36 h. Pick single colonies and verify them by colony PCR. After confirming positive clones, inoculate them into YEP liquid medium containing 50 μg / mL Rif and 50 μg / mL Kan, and incubate at 28°C with shaking (200 rpm) for 16 h. Add 50% glycerol (final concentration 20%) and store at -80°C for later use.

[0057] 3. Preparation and concentration adjustment of Agrobacterium-mediated bacterial suspension

[0058] Take Agrobacterium positive clones containing pCB301-TuMV-GFP, pCB301-ToMV-GFP, and pCB301-TMV-GFP stored at -80℃, and inoculate them into 2 mL of YEP liquid medium containing 50 μg / mL Rif and 50 μg / mL Kan, respectively. Incubate at 28℃ with shaking (200 rpm) for 12-16 h until the bacterial culture reaches OD. 600 The value was 0.8-1.0; the cultured bacterial solution was transferred to a 1.5 mL centrifuge tube and centrifuged at 5000 rpm for 2 min at room temperature, discarding the supernatant; 1 mL of Agrobacterium infection solution (10 mM MES (pH 5.6), 10 mM MgCl2, 200 μM acetylsylgenone) was added to the centrifuge tube, the bacterial cells were gently resuspended by pipetting, and centrifuged at 5000 rpm for 2 min at room temperature, discarding the supernatant; the above washing steps were repeated once; finally, the bacterial cells were resuspended in Agrobacterium infection solution, the OD600 value was measured by UV spectrophotometer, and the bacterial concentration was adjusted to OD600 using the infection solution. 600 =0.001, let stand at room temperature for 30 minutes before use.

[0059] 4. Selection of *Fumica benthamiana* and Agrobacterium infiltration inoculation

[0060] Healthy plants (Nicotiana benthamiana) that have grown for 4-6 weeks, are free from pests and diseases, have a uniform height (15-20cm), and have the same number of leaves (6-8) were selected. Before the experiment, they were placed in an artificial culture room at 22℃, 16h light / 8h dark, and 60%-70% relative humidity for 3 days to adapt.

[0061] Selected Nicotiana benthamiana plants after adaptation and culture, and healthy leaves (3rd-4th leaves) from the middle of each plant were selected. Circular injection areas with a diameter of 1.5 cm were marked symmetrically on both sides of the leaf using a marker (ensuring the left and right areas were of the same size, ≥1 cm from the leaf edge, and without a midrib). Prepared Agrobacterium suspensions (corresponding to TuMV, ToMV, and TMV) were loaded into 1 mL sterile syringes (needle removed). The syringe needle was placed close to the lower epidermis of the marked circular area on the leaf, and the suspension was slowly injected until the circular area was completely infiltrated (approximately 0.2 mL of suspension per area). Each Nicotiana plant was inoculated with Agrobacterium suspension of only one virus, and three biological replicates were set up for each virus, along with a blank control.

[0062] 5. ADG spraying treatment and control of cultivation conditions

[0063] After Agrobacterium infiltration inoculation, the *Fumiganthus benthamiana* was transferred to an artificial culture room at 22°C, 16 hours light / 8 hours dark, and 60%-70% relative humidity; 6 hours after virus inoculation, ADG spraying treatment was performed.

[0064] Control group: Sterile water was sprayed onto the circular marked area on the left half of the leaf using a small sprayer (nozzle diameter 0.5 mm, pressure 0.2 MPa). The amount of water sprayed should be such that a uniform water film is formed on the leaf surface but does not drip (0.5 mL / area).

[0065] Treatment group: The prepared 250μM ADG working solution was sprayed onto the circular marked area on the right half of the leaf, with the same spraying amount as the control group. During the spraying process, a sterile plastic baffle (0.1mm thick, 3cm×5cm in size) was used to separate the left and right areas of the leaf to prevent the ADG solution from drifting to the control group area. After the spraying was completed, the Nicotiana benthamiana was placed in the above-mentioned culture room for 24 hours. After 24 hours, the sterile water (control group) and 250μM ADG (treatment group) were sprayed once again according to the above method. After the repeated spraying, the culture was continued until the leaves showed symptoms of viral disease (about 3-4 days after inoculation).

[0066] 6. Ultraviolet observation and activity assessment of virus accumulation

[0067] After the leaves of *Tobacco Benzovia* showed symptoms of viral infection, on the 4th and 6th days after the onset of the disease, the circular marked areas on the left and right sides of the leaves were irradiated with a handheld ultraviolet lamp in a dark room, and the GFP fluorescence signal was observed and recorded (GFP fluorescence intensity directly reflects the amount of virus accumulation). The fluorescence images of the leaves were taken with a digital camera under the same exposure parameters, and the image numbers corresponded to the treatment group, the control group, and the number of days of culture.

[0068] Observation results are shown in Figure 1 ( Figure 1In the diagram, H2O represents the sterile water control group on the left half of the leaf, and ADG represents the 250μM ADG treatment group on the right half of the leaf. Compared with the control group, the fluorescence intensity of GFP in the circular marked area of ​​the leaves in the treatment group was significantly reduced, and the fluorescence reduction trend on the 6th day of disease was more obvious than that on the 4th day, indicating that ADG treatment can significantly reduce the accumulation of TuMV, ToMV and TMV in the leaves of Tobacco Benedict and has inhibitory activity against the three RNA viruses.

[0069] 7. Quantitative analysis of GFP fluorescent lesion area

[0070] Leaf fluorescence images were imported into ImageJ software to quantify the area of ​​GFP fluorescent lesions in leaves under different treatments and calculate the area ratio of leaves infected by each virus. The specific method is as follows:

[0071] After opening the image, use the "Threshold" function (set the grayscale threshold to 80-255) to select the GFP fluorescent region, and use the "Measure" function to calculate the area of ​​the fluorescent region (i.e., the area of ​​virus infection).

[0072] Calculate the total area of ​​the circular marked region on the leaf using the same method;

[0073] Calculate the virus infection area ratio: Infection area ratio = Virus infection area / Total area of ​​the circular marked area × 100%.

[0074] See results Figure 2 ( Figure 2 In the diagram, Mock represents the sterile water control group, and ADG represents the ADG treatment group. Statistical analysis showed that compared with the control group, the infection area ratios of TuMV-GFP, ToMV-GFP, and TMV-GFP in the ADG treatment group were significantly reduced, with the TMV infection area ratio showing the most significant reduction. This confirms that ADG can effectively reduce the infection range of the virus in the leaves.

[0075] 8. Preparation and Western blot detection of plant protein samples

[0076] 8.1 Protein Sample Preparation

[0077] On the 6th day of viral infection, leaf tissue from the circularly marked areas of the control and treatment groups was collected. Three biological replicates were taken from each sample, and 0.2g of fresh tissue was taken from each replicate. The tissue was placed in a mortar and ground rapidly into powder with liquid nitrogen. The powder was then transferred to a 2mL sterile centrifuge tube, and 0.2mL of pre-chilled cell lysis buffer (200mM NaCl, 1.0mM EDTA, 1.0mM MDT, 20mM...) was added. Tris-HCl (adjust pH to 7.4 with HCl) was used to mix the protein in the centrifuge tube. The mixture was vortexed for 1 min and then placed on ice for 20 min (vortexed every 5 min for 10 s each time). The centrifuge tube was then placed in a refrigerated centrifuge at 4°C and centrifuged at 14000g for 10 min. The supernatant (approximately 0.15 mL) was carefully aspirated into a new 2 mL sterile centrifuge tube. 0.2 mL of supernatant (if insufficient, add cell lysis buffer to bring the total to 0.2 mL) was accurately aspirated into a 1.5 mL sterile centrifuge tube. 50 μL of loading buffer was added, and the mixture was gently pipetted 10 times to obtain the protein mixture. The protein mixture was heated in a boiling water bath for 5 min, then immediately transferred to an ice bath and allowed to stand for 5 min. The mixture was then centrifuged at 4°C and 14000g for 10 min. A small amount of precipitate at the bottom was discarded to obtain a clear protein sample, which was then placed on ice for later use.

[0078] 8.2 Western blot detection

[0079] SDS-PAGE electrophoresis: Take 20 μL of protein sample and add it to the loading well of the SDS-PAGE gel. Electrophore at 120V for 30 min (stack gel), and then adjust the voltage to 150V for 60 min (separating gel).

[0080] Transfer: After electrophoresis, the proteins on the gel were transferred to a PVDF membrane (0.45 μm pore size) using a semi-dry transfer apparatus. The transfer conditions were: 200 mA constant current and 90 min transfer time.

[0081] Blocking and incubation: After the transfer was completed, the PVDF membrane was placed in 5% skim milk powder (prepared with TBST buffer) and incubated on a shaker at room temperature for 1 hour; the blocking solution was discarded, and the membrane was washed 3 times with TBST buffer for 10 minutes each time; diluted GFP was added for color development and detection: solution A and solution B in the ECL chemiluminescence kit were mixed in a 1:1 ratio and evenly added to the PVDF membrane, which was then exposed and detected in a gel imaging system, and the chemiluminescent signal of the GFP protein was recorded (signal intensity reflects the level of viral protein accumulation).

[0082] Test results are shown Figure 3 ( Figure 3In the diagram, H2O represents the control group, ADG represents the treatment group, and β-actin is the internal reference protein. Compared with the control group, the chemiluminescence signal intensity of GFP protein in the ADG treatment group was significantly reduced, and the reduction in GFP signal of the three viruses was similar, indicating that ADG treatment can significantly inhibit the protein accumulation of TuMV, ToMV, and TMV in tobacco leaves.

[0083] The embodiments described above are merely preferred embodiments of the present invention and are not intended to limit the scope of the present invention. Various modifications and improvements made by those skilled in the art to the technical solutions of the present invention without departing from the spirit of the present invention should fall within the protection scope defined by the claims of the present invention.

Claims

1. The application of a small molecule compound in the preparation of a drug for combating plant RNA virus infection, characterized in that, The small molecule compound is 2'-amino-2'-deoxyguanosine; The RNA viruses mentioned are turnip mosaic virus, tomato mosaic virus, and tobacco mosaic virus; The small molecule compound can exert an anti-infection effect after plants are infected with the RNA virus.

2. A method for preventing and controlling plant RNA virus infection, characterized in that, This includes the step of exogenously spraying plants with a drug whose active ingredient is 2'-amino-2'-deoxyguanosine; The RNA viruses mentioned are turnip mosaic virus, tomato mosaic virus, and tobacco mosaic virus.

3. The method according to claim 2, characterized in that, During the spraying process, the concentration of the 2'-amino-2'-deoxyguanosine was 250 μM.

4. The method according to claim 2, characterized in that, The part to be sprayed is the leaf.

5. The method according to claim 2, characterized in that, The plant mentioned includes tobacco.

6. A method for improving the resistance of plants to RNA viruses, characterized in that, This includes the step of exogenously spraying plants with a drug whose active ingredient is 2'-amino-2'-deoxyguanosine; The RNA viruses mentioned are turnip mosaic virus, tomato mosaic virus, and tobacco mosaic virus.

7. The method according to claim 6, characterized in that, During the spraying process, the concentration of the 2'-amino-2'-deoxyguanosine was 250 μM.

8. The method according to claim 6, characterized in that, The part to be sprayed is the leaf.

9. The method according to claim 6, characterized in that, The plant mentioned includes tobacco.

Citation Information

Patent Citations

  • Antiplant viral agent

    JP1990167205A

  • Preparation method and use of 2'-deoxyguanosine, guanosine and composition of 2'-deoxyguanosine and guanosine

    WO2023217094A1