Method for rapidly detecting South African II type foot and mouth disease virus

Abstract

The invention provides a method for rapidly detecting nucleic acid of a South Africa type II foot-and-mouth disease virus, namely a detection method based on RT-RAA-CRISPR / Cas13a, which is established on the basis that a group of RT-RAA primer probes for efficiently and specifically detecting the South Africa type II foot-and-mouth disease virus is obtained through screening. The sequence of an upstream primer of the RT-RAA primer is SEQ ID NO: 2, and the sequence of a downstream primer of the RT-RAA primer is SEQ ID NO: 3. Based on the combination of an RT-RAA technology and a CRISPR / Cas13a technology, the RT-RAA amplification primer pair for detecting the South Africa type II foot-and-mouth disease virus and the specific crRNA targeting the target sequence are finally provided, and the crRNA can realize high-sensitivity, high-specificity and low-complexity visual detection of the South Africa type II foot-and-mouth disease virus by activating Cas13a; an effective detection means is provided for preventing the South African II type foot-and-mouth disease virus from being introduced into China in the future.

Description

Technical Field

[0001] This invention belongs to the field of molecular biology gene detection technology, specifically relating to a method for rapid detection of South African foot-and-mouth disease virus type II. Background Technology

[0002] Foot-and-mouth disease (FMD) is an acute, febrile, and highly contagious infectious disease caused by the foot-and-mouth disease virus (FMDV). It is listed as a Class I animal disease in the "List of Class I and II Infectious and Parasitic Diseases of Animals Entering the People's Republic of China" and the "List of Class I, II, and III Animal Diseases." The virus belongs to the family MicroRNAviridae, genus FMDV, and has a single-stranded positive-sense RNA genome. It is highly infectious and can be transmitted through direct contact, aerosols, and other routes, causing large-scale outbreaks in a short period, leading to severe consequences such as decreased animal productivity and mortality, resulting in significant economic losses to the livestock industry.

[0003] Foot-and-mouth disease virus (FMDV) is classified into several serotypes, including A, O, C, Asia I, Asia II, and South African I and II. There is no cross-protection between serotypes. South African FMDV type II (FMDV-SAT2) was once widespread in Africa, severely impacting the local livestock industry. In 2022, FMDV-SAT2 broke through its traditional epidemic regions and began circulating in the Middle East, attracting significant attention. Risk assessment analysis indicates a very high risk of this strain entering my country. Since my country currently lacks a vaccine against this serotype, there is an immunization gap in livestock. If it were to enter my country, it could easily cause widespread transmission, severely impacting my country's livestock industry.

[0004] Currently, there are no commercially available test kits for FMDV-SAT2 in China, and there are few internationally available diagnostic techniques for identifying FMDV-SAT2 strains. If FMDV-SAT2 were to enter my country, existing diagnostic techniques would be unable to identify the serotype, failing to provide effective detection information in a timely manner and leading to missed outbreaks. Commonly used detection methods are laboratory tests, primarily quantitative RT-PCR. These methods require excellent laboratory conditions, expensive specialized equipment, and experienced technicians, are time-consuming and labor-intensive, and are inconvenient for field testing, failing to detect outbreaks promptly. Therefore, establishing a convenient, accurate, and field-ready FMDV-SAT2 detection technology would be more effective in preventing the epidemic from entering the country.

[0005] RT-RAA is an isothermal nucleic acid amplification technique that can rapidly and efficiently amplify specific nucleic acid sequences at a constant temperature. It offers advantages such as ease of operation, rapid reaction, and relatively low requirements for equipment. The CRISPR / Cas13 system is a powerful RNA editing tool; the Cas13 protein, guided by crRNA, specifically recognizes and cleaves target RNA sequences. Combining RT-RAA with CRISPR / Cas13 offers numerous advantages. In terms of detection, the rapid amplification capability of RT-RAA provides sufficient target RNA for CRISPR / Cas13, improving detection sensitivity and enabling the detection of trace amounts of nucleic acid, potentially for early disease diagnosis. Simultaneously, the specific cleavage capability of CRISPR / Cas13 further enhances detection accuracy and reduces false positive rates. However, this combined technique also faces some challenges, such as primer design optimization during RT-RAA amplification and potential off-target effects of CRISPR / Cas13. Summary of the Invention

[0006] The purpose of this invention is to provide a method for rapid detection of FMDV-SAT2 nucleic acid that can be used in frontline epidemic prevention. Specifically, after analyzing the complete genome sequences of 80 FMDV-SAT2, 56 FMDV-SAT1, 33 FMDV-SAT3, 42 FMDV-Asia1, 36 FMDV-O, and 45 FMDV-A serotypes, a sequence conserved among FMDV-SAT2 serotypes but significantly different among other serotypes was identified, and multiple pairs of amplification primers were designed. A set of highly efficient and specific FMDV-SAT2 RT-RAA primers was obtained through screening, and a highly sensitive and specific FMDV-SAT2 RT-RAA-CRISPR / Cas13a diagnostic method was established. The established method has discriminative ability and can accurately detect FMDV-SAT2 nucleic acid signals.

[0007] This invention first provides an RT-RAA primer pair for detecting FMDV-SAT2, wherein the sequence of the nucleic acid fragment detected by the primer pair is as follows: CAGTTCATCAACCCACGCACCAACACCACGGCACACGTCCAGGTTCCCTATCTGGGCGTGAACAGACACGATCAGGGTAAGCGCCACCAGGCGTGGTCTTTAGTCGTGATGGTGCTCACGCCTCTCACAACAGAGGCGCGATGAACAGTGGGACTGTCGAGGTTTACGCCAACATAGCACCC (SEQ ID NO: 1).

[0008] As a specific example, the sequence information of the upstream and downstream primer pairs of the RT-RAA primer pair is as follows: Upstream primer FMDV-SAT2 F1′: 5′-GAAATTAATACGACTCACTATAGGGGACAAAAGGGTTTTGTYCTYGGTCAG-3′ (SEQ ID NO: 2) Downstream primer FMDV-SAT2 R1′: 5′-AGYCCTGCCACRGAGATCAACTTCTC-3′ (SEQ ID NO: 3).

[0009] The RT-RAA primer pairs obtained in this invention are used to prepare an RT-RAA-CRISPR / Cas13a detection reagent for detecting FMDV-SAT2; Furthermore, the detection reagent also contains CRISPR-Cas13a protein, crRNA, and a reporter molecule; The sequence of the crRNA is as follows: AAACCTGTGATGGCNTCGAAGA (SEQ ID NO: 4).

[0010] When using the fluorescence method, the reporter molecule is a fluorescent reporter molecule with the sequence 5′-UUUUUUUUUUU-3′, and the probe ends are labeled with FAM and BHQ1, respectively; when using the test strip method, the reporter molecule is a biotin reporter molecule with the sequence 5′-UUUUUUUUUUU-3′, and the probe ends are labeled with FAM and biotin, respectively.

[0011] This invention also provides a method for detecting FMDV-SAT2 using RT-RAA-CRISPR / Cas13a; When the reporter molecule is a fluorescent reporter molecule, the nucleic acid of the sample to be tested is used as a template, and the above-mentioned RT-RAA primer pair is used to perform an RT-RAA reaction to obtain the amplification product. The fluorescent reporter molecule and the above-mentioned crRNA are used to perform a CRISPR / Cas13a reaction on the amplification product to obtain the reaction product. The presence of SAT2 nucleic acid in the sample to be tested is determined according to the fluorescence and fluorescence value of the reaction product. That is, the reaction product is observed under a blue light / ultraviolet light (wavelength of 440-460nm / 400nm). If the reaction product produces green fluorescence, the sample to be tested contains FMDV-SAT2 nucleic acid. If the reaction product does not produce green fluorescence, the sample to be tested does not contain FMDV-SAT2 nucleic acid.

[0012] When the reporter molecule is a biotin reporter molecule, using the nucleic acid of the sample to be tested as a template, an RT-RAA reaction is performed using the above-mentioned RT-RAA primer pair to obtain the amplification product. The amplification product is then subjected to a CRISPR / Cas13a reaction using the biotin reporter molecule and the above-mentioned crRNA to obtain the reaction product. The product after the CRISPR / Cas13a reaction is diluted with dd H2O at a ratio of 1:1. The test strip is inserted into the diluted mixture and the test result is read after 10 minutes. If the control line is not colored and the test line is visible to the naked eye, it indicates that the nucleic acid probe has been almost completely cleaved by the Cas enzyme, and the result is positive, indicating that the sample to be tested contains FMDV-SAT2 nucleic acid. If the control line is colored and the test line is visible to the naked eye, it indicates that some of the nucleic acid probe has been cleaved by the Cas enzyme, and the result is positive, indicating that the sample to be tested contains FMDV-SAT2 nucleic acid. If the control line is colored but the test line is not colored, it indicates that the nucleic acid probe has not been cleaved by the Cas enzyme, and the result is negative, indicating that the sample to be tested does not contain FMDV-SAT2 nucleic acid. If neither the test line nor the control line is colored, the result is invalid.

[0013] This invention combines RT-RAA technology and CRISPR / Cas13a technology to achieve convenient, rapid, and high-precision detection of FMDV-SAT2. It plays an important role in preventing the introduction of FMDV-SAT2 into my country and promptly eliminating infected livestock populations, and has good application prospects. Attached Figure Description

[0014] Figure 1 The image shows the results of RT-RAA primer screening in Example 1, where: 1: F1R1; 2: F1R1'; 3: F1'R1; 4: F1'R1'; 5: F2R2.

[0015] Figure 2 , Figure 3 The image shows the crRNA screening results in Example 1, where 1: crRNA1+; 2: crRNA1-; 3: crRNA2+; 4: crRNA2-; 5: crRNA3+; 6: crRNA3-; 7: crRNA4+; 8: crRNA4-; 9: crRNA5+; 10: crRNA5-.

[0016] Figure 4 , Figure 5 The image shows the sensitivity verification results of the FMDV-SAT2 fluorescence method provided in Example 2, where 1:10 -1 ;2:10 -2 3:10 -3 ;4:10 -4 5:10 -5 6:10 -6 7:10 -7 8:10-8 9:10 -9 10:10 -10 11:10 -11 12:10 -12 13:10 -13 14:10 -14 15:10 -15 ;16:NC.

[0017] Figure 6 The graph shows the sensitivity verification results of the FMDV-SAT2 test strip method provided in Example 2, where 1:10 -1 ;2:10 -2 3:10 -3 ;4:10 -4 5:10 -5 6:10 -6 7:10 -7 8:10 -8 9:10 -9 10:10 -10 11:10 -11 12:10 -12 13:10 -13 14:10 -14 15:10 -15 ;16:NC.

[0018] Figure 7 , Figure 8 This is a graph showing the validation results of the fluorescence method for detecting different FMDV subtypes provided in Example 3. Figure 7 , Figure 8 1: Type O / Type A; 2: Type Asia 1; 3: Type SAT 1; 4: Type SAT 3; 5: NC; 6: Type SAT 2.

[0019] Figure 9 This is a graph showing the verification results of the specificity method for detecting different FMDV subtypes using test strips provided in Example 3. Figure 9 1: Type O / Type A; 2: Type Asia 1; 3: Type SAT 1; 4: Type SAT 3; 5: NC; 6: Type SAT 2.

[0020] Figure 10 , Figure 11 This is a graph showing the validation results of the specificity method for detecting FMDV-SAT2 using fluorescence as described in Example 4. Figure 10 , Figure 111: Porcine pseudorabies virus (PRV); 2: Seneca virus (SVA); 3: Classical swine fever virus (CSFV); 4: Porcine respiratory and reproductive syndrome virus (PRRSV); 5: Porcine circovirus (PCV2); 6: Porcine epidemic diarrhea virus (PEDV); 7: NC; 8: FMDV-SAT2.

[0021] Figure 12 This is a graph showing the verification results of the specificity method for detecting FMDV-SAT2 using test strips provided in Example 4. Figure 12 1: Porcine pseudorabies virus (PRV); 2: Seneca virus (SVA); 3: Classical swine fever virus (CSFV); 4: Porcine respiratory and reproductive syndrome virus (PRRSV); 5: Porcine circovirus (PCV2); 6: Porcine epidemic diarrhea virus (PEDV); 7: NC; 8: FMDV-SAT2.

[0022] Figure 13 , Figure 14 This is a graph showing the verification results of the FMDV-SAT2 fluorescence method for detecting stability provided in Example 5. Figure 13 , Figure 14 A, B, C, and D are four gradient SAT2 nucleic acids.

[0023] Figure 15 The graph shows the verification results of the stability test of the FMDV-SAT2 test strip method provided in Example 5. Figure 15 A, B, C, and D are four gradient SAT2 nucleic acids.

[0024] Figure 16 , Figure 17 This is a graph showing the verification results of the fluorescence method for blind testing of bovine tissue samples using simulated clinical samples, as provided in Example 6. Figure 16 , Figure 17 Samples 1-20 are bovine tissue samples.

[0025] Figure 18 This is a graph showing the verification results of the blind testing of bovine tissue sample strips using simulated clinical samples provided in Example 6. Figure 18 Samples 1-20 are bovine tissue samples.

[0026] Figure 19 , Figure 20 This is a graph showing the verification results of the fluorescence method for blind testing of simulated clinical samples from bovine swabs provided in Example 6. Figure 19 , Figure 20 Samples 1-20 are bovine swabs.

[0027] Figure 21 This is a graph showing the verification results of the blind testing of bovine swab sample strips using simulated clinical samples provided in Example 6. Figure 21 Samples 1-20 are bovine swabs.

[0028] Figure 22 , Figure 23 This is a graph showing the validation results of the fluorescence method on pig tissue samples in a blind test simulating clinical samples, as provided in Example 6. Figure 22 , Figure 23 Samples 1-20 are pig tissue samples.

[0029] Figure 24 This is a graph showing the verification results of the paper strip method for blind testing of simulated clinical samples in pig tissue samples provided in Example 6. Figure 24 Samples 1-20 are pig tissue samples.

[0030] Figure 25 , Figure 26 This is a graph showing the verification results of the fluorescence method for blind testing of pig swab samples in simulated clinical trials, as provided in Example 6. Figure 25 , Figure 26 Samples 1-20 are swab samples from pigs.

[0031] Figure 27 This is a graph showing the verification results of the blind test of pig swab sample strips using simulated clinical samples provided in Example 6. Figure 27 Samples 1-20 are swab samples from pigs. Detailed Implementation

[0032] In practice, the applicant discovered that establishing a genotyping detection technology for FMDV-SAT2 requires a systematic analysis of viral sequences from all FMDV serotypes to identify differentially expressed sequences as target sequences for developing the FMDV-SAT2 diagnostic technology. When RT-RAA amplification efficiency is low, it leads to low template amplification and false negatives. Conversely, poor crRNA sequence specificity results in non-specific binding of crRNA to non-target templates, initiating non-specific Cas enzyme cleavage activity and generating false positive signals. To avoid these drawbacks, this invention first conducts a systematic analysis of the pathogen sequence and designs five pairs of RT-RAA amplification primers. The primer pair with the strongest amplification efficiency and specificity is then selected as the RT-RAA reaction primer, ensuring both amplification efficiency and specificity. Simultaneously, five crRNAs are designed for the amplification sequence, and their specificity in binding to the target is tested individually to avoid false positives and ensure the reliability of the detection results.

[0033] The present invention will now be described in further detail with reference to specific embodiments. The given embodiments are merely illustrative of the invention and not intended to limit its scope. The embodiments provided below can serve as a guide for further improvements by those skilled in the art and do not constitute a limitation on the invention in any way.

[0034] Example 1: Establishment of FMDV-SAT2 detection method I. Preparation of FMDV-SAT2 RNA Standard 1. Since FMDV-SAT2 has not yet been introduced into my country, it is necessary to prepare RNA standards. The highly conserved sequence (SEQ ID NO:1) obtained by screening is used as a template for the positive plasmid synthesized from the target gene fragment for in vitro transcription. The transcribed product is purified to prepare FMDV-SAT2 RNA standards.

[0035] 2. Perform a 10-fold serial dilution of the FMDV-SAT2 RNA standard, and take 1×10⁻⁶ doses. -1 —1×10 -15 A total of 15 serially diluted RNA standards were used. The diluted 1×10⁻⁶ RNA standards were analyzed using a digital PCR instrument. -1 —1×10 -15 Nucleic acid copy number determination was performed using 15 consecutively diluted standards. The reaction program was set as follows: reverse transcription 55℃ for 15 min, pre-denaturation 95℃ for 30 s, amplification 95℃ for 10 s, 60℃ for 30 s, for 45 cycles. The reaction system consisted of: 6 µL of 5 × One Step U+ Mix, 1.5 µL of One Step U+ Enzyme Mix, and 0.6 µL of 50 × ROX Reference Dye (HiScript). ® III U+One StepqRT-PCR Probe Kit (Vazyle), 0.6 µL each of upstream and downstream primers, 0.3 µL of fluorescent probe (10 µM) (primer and probe sequences are shown in Table 1), 1 µL of diluted FMDV-SAT2 RNA standard, and ddH2O to bring the total volume to 30 µL.

[0036] 3. Place the calibrated 10 -1 —10 -15 FMDV-SAT2 RNA standards at dilutions were aliquoted and stored at -80°C for later use. The copy numbers were 116526.2 copies / µL (10⁻¹¹). -5 ), 12888.6 copies / µL (10 -6 ), 1194 copies / µL (10 -7 ), 92.6 copies / µL (10 -8 ), 40 copies / µL (10 -9 ), 35 copies / µL (10 -10 ), 7.8 copies / µL (10 -11 ), 6.4 copies / µL (10 -12 ).

[0037] Table 1: Information on primers and fluorescent probe sequences for FMDV-SAT2 RNA standard amplification Primer name Primer sequence (5′→3′) FMDV-SAT2 cRNA F CAAGCGCATTACTGTTGAAGG FMDV-SAT2 cRNA R TAGGGCGTAGAGCACATAGA FMDV-SAT2 cRNA probe CCACCAGCATCATCAACACCATTCTCA II. Design and Screening of RT-RAA Primers The whole genome sequences of 80 South African foot-and-mouth disease virus (FMD) types II, 56 South African FMD types I, 33 South African FMD types III, 42 Asian FMD types I, 36 FMD types O, and 45 FMD types A were extracted from the GenBank database (NCBI, http: / / www.ncbi.nlm.nih.gov / ) and sequence alignment was performed using BioEdit software (version 7.2.5). Genes highly conserved in SAT2 but showing significant differences among other serotypes were selected as detection targets. Six primers for conserved genes were designed according to the RT-RAA design principle, with the T7 promoter sequence added to the upstream primer to facilitate in vitro transcription (as shown in Table 2).

[0038] Table 2: SAT2 Virus RT-RAA Primer Sequence Listing Primer name Primer sequence 5′→3′ FMDV-SAT2-F1 GAAATTAATACGACTCACTATAGGGGACAAAAGGGTTTGTTCTTGGTCAG FMDV-SAT2-R1 CCTGCCRCGGAGATCAACTTCTCCT FMDV-SAT2-F1' GAAATTAATACGACTCACTATAGGGCAGTTCATCAACCCACYAACAC FMDV-SAT2-R1' ATGTTGGCGTAVACCTCRACRGT FMDV-SAT2-F2 GAAATTAATACGACTCACTATAGGGGGAACTGGGTTTTACAAACCTGTGATGGC FMDV-SAT2-R2 CGTCACCGCACACGGCGTTCACCCA III. Selection of Optimal Primer Pairs With 10 -2 Using diluted FMDV-SAT2 RNA standard as a template, RT-RAA reactions were performed using five primer pairs (F1R1, F1R1', F1'R1, F1'R1', and F2R2) as shown in Table 1. The kits were purchased from Jiangsu Qitian Gene Biotechnology Co., Ltd. (reaction system shown in Table 3). The reaction temperature was 37℃ for 40 min. After the reaction, 5 μL of the reaction product was electrophoresed on a 2% agarose gel, and the results were observed using a gel imaging system. Figure 1 The results showed that ( Figure 1 The amplification band of primer F1'R1' was brighter, so F1'R1' was selected as the best primer pair for detecting FMDV-SAT2.

[0039] Table 3: RT-RAA Reaction System Components of the reaction system Volume / μL Buffer V 25 Upstream primer (10µM) 2 Downstream primer (10µM) 2 template 1 Magnesium acetate I 5 <![CDATA[RNase-free ddH2O]]> 15 IV. Design, transcription, and purification of FMDV-SAT2 crRNA 1. Based on the target fragment sequence amplified by RT-RAA and the characteristics of LwaCas13a recognizing crRNA, five crRNAs were designed (sequences are shown in Table 4).

[0040] 2. The oligonucleotide T7 oligo synthesized from the crRNA transcription template was combined with crRNA-R (1-5) respectively. The resulting oligonucleotide chain combinations were dissolved in DEPC water to a concentration of 100 µmol / L. The mixture was then denatured at 95°C for 5 min and slowly cooled to 25°C for at least 45 min to anneal and form double-stranded DNA (the annealing system is shown in Table 5).

[0041] 3. Using the above double-stranded DNA as a template, in vitro transcription (T7 RNA Polymerase, Vazyme) was performed to obtain crRNA1-5 (transcription system is shown in Table 6). The crRNA concentration was measured, aliquoted, and stored at -80℃ for later use.

[0042] Table 4: Information on crRNA and reporter molecule sequences Oligonucleotides Sequence 5′→3′ T7 oligo GAAATTAATACGACTCACTATAGGG crRNA-R1 ATCCTCTCCTTTGCACGCCGTGGGACCAGTTTTAGTCCCTCGTTTTTGGGGTAGTCTAAATCCCCTATAGTGAGTCGTATTAATTTC crRNA-R2 TCCTCTCCTTTGCACGCCGTGGGACCATGTTTTAGTCCCCTTCGTTTTTGGGGTAGTCTAAATCCCCTATAGTGAGTCGTATTAATTTC crRNA-R3 TCCTCTCCTTTGCACGCCGTGGGACCATGTTTTAGTCCCCTTCGTTTTTGGGGTAGTCTAAATCCCCTATAGTGAGTCGTATTAATTTC crRNA-R4 AAACCTGTGATGGCNTCGAAGACCCTCGGTTTTAGTCCCCTTCGTTTTTGGGGTAGTCTAAATCCCCTATAGTGAGTCGTATTAATTTC crRNA-R5 CGAYCAGGGYAARCGCCACCAGRCGTGGGTTTTAGTCCCCTTCGTTTTTGGGGTAGTCTAAATCCCCTATAGTGAGTCGTATTAATTTC Fluorescent reporter molecules 5′-FAM / UUUUUUUUUUU / BHQ-3′ Biotin reporter molecule 5′-FAM / UUUUUUUUUUU / biotin-3′ Table 5: Composition of the annealing system Components Volume / μL T7 oligo 1 crRNA-R 1 10×Transcription Buffer 1 <![CDATA[RNase-free ddH2O]]> Add to 10 Table 6: crRNA in vitro transcription system Components Volume / μL Previous product 10 10×Transcription Buffer 4 ATP / CTP / GTP / UTP (100mM) 0.3 each T7 RNA Polymerase (50 U / μL) 4 RNase Inhibitor 2 <![CDATA[RNase-free ddH2O]]> Add to 40 Dnase I 2 V. Screening of FMDV-SAT2 crRNA With 10 -2 Using diluted FMDV-SAT2 RNA standard as a template, an RT-RAA reaction was performed with FMDV-SAT2 F1'R1' primers to obtain amplification products. ddH2O was set as a negative control for the template (reaction system shown in Table 3). The CRISPR / Cas13a fluorescence method and test strip method reaction system 1 was incubated at 37℃ for 10 minutes in a PCR instrument (as shown in Table 7). The amplification products were added to the CRISPR / Cas13a fluorescence method and test strip method reaction system 2 (as shown in Table 8), and reacted in a constant temperature metal bath at 37℃ for 30 minutes. The reporter molecule used in this reaction was a fluorescent reporter molecule. After the reaction was complete, the fluorescence intensity was observed and the fluorescence value was detected to screen out the optimal crRNA. The fluorescence results were observed under blue light irradiation, and the fluorescence intensity value was detected and read using a multi-functional microplate reader. The results are shown in Table 3. Figure 2 , Figure 3 The Cas13a protein was purchased from Genscript Biotech Inc. The 5′ and 3′ ends of the fluorescent reporter molecule were modified with a fluorescent group (FAM) and a fluorescence quencher group (BHQ 1), respectively, which were synthesized by Sangon Biotech (Shanghai) Co., Ltd. (sequence shown in Table 4).

[0043] The experimental results showed that crRNA5 had the highest fluorescence intensity, therefore crRNA5 was selected for subsequent experiments. Figure 2 , Figure 3 ).

[0044] Table 7: Established Reaction System Components of the reaction system Volume / μL 10 × Cas13a Reaction Buffer 1 crRNA (7.5 ng / μL) 2 Cas13a (C2c2) Nuclease (100 ng / μL) 2 DEPC water 5 Table 8: CRISPR / Cas13a Fluorescence and Test Strip Method Reaction System Components of the reaction system Volume / μL CRISPR / Cas13a reaction system 1 mixture 10 10 × Cas13a Reaction Buffer 5 ATP / CTP / GTP / UTP (100mM) 1 each T7 RNA Polymerase (50 U / μL) 1 RNase Inhibitor 2 RT-RAA products 5 Fluorescent reporter molecule / Biotin reporter molecule (10 μmol) 5 DEPC water 28 Example 2: Sensitivity of the FMDV-SAT2 method Use the calibrated 10 -1 —10 -15 Using FMDV-SAT2 RNA standards at different dilutions as templates, the copy numbers were 116526.2 copies / µL (10⁻¹⁰). -5 ), 12888.6 copy / µL (10 -6 ), 1194 copy / µL (10 -7 ), 92.6 copy / µL (10 -8 ), 40 copy / µL (10 -9 ), 35 copy / µL (10 -10 ), 7.8 copy / µL (10 -11 ), 6.4 copy / µL (10 -12 ), and prepare RT-RAA-CRISPR / Cas13a fluorescence method and test strip method detection system.

[0045] When the reporter molecule is a fluorescent reporter molecule, the results are as follows: Figure 4 , Figure 5 The results showed that fluorescence was still present even at a template concentration as low as 6.4 copies / µL. The experiment was repeated three times, and the results consistently showed the same pattern. This indicates that the detection limit of the fluorescence method for FMDV-SAT2 is 6.4 copies / µL.

[0046] When the reporter molecule is a biotin reporter molecule, the result is as follows: Figure 6 The results showed that when the template dilution was 10... -1 —10 -12 At a certain time, the test line on the test strip is bright, indicating strong signal amplification; when the template dilution is 10... -13 In the initial test, only the control line showed a red line, and the negative control also showed a red line. The experiment was repeated three times, and the results consistently showed the same pattern. This indicates that the detection limit of the test strip method for FMDV-SAT2 is 6.4 copies / µL.

[0047] Example 3: Specificity of RT-RAA-CRISPR / Cas13a in detecting different FMDV subtypes 1. Common FMDV subtypes such as O / A, Asia1, SAT1, and SAT3, as well as FMDV-SAT2 RNA standards, were selected for comparison to verify the specificity of the fluorescence method and the test strip method. ddH2O was used as a negative control.

[0048] 2. RT-RAA amplification was performed using the optimal primer pair screening method described in Example 1. After amplification, 5 μL of RT-RAA product was taken to prepare RT-RAA-CRISPR / Cas13a fluorescence detection system and test strip detection system.

[0049] When the reporter molecule is a fluorescent reporter molecule, the positivity of the test sample is determined based on the fluorescence and fluorescence value of the product after the CRISPR / Cas13a reaction. The results are as follows: Figure 7 , Figure 8 The results showed that only the reaction product of the FMDV-SAT2 positive control showed obvious green fluorescence, while the other control virus samples and the negative control did not produce green fluorescence. This proves that the fluorescence detection method designed in this invention has high serotype specificity for FMDV-SAT2.

[0050] When the reporter molecule is a biotin reporter molecule, the test result is determined based on the detection result of the test strip inserted into the product after the CRISPR / Cas13a reaction, and the result is as follows: Figure 9 The results showed that only the reaction product detection line of the FMDV-SAT2 positive control showed a clear red line, while the other control virus samples and negative controls only showed a red line in the quality control line. This proves that the test strip detection method designed in this invention has high specificity for different subtypes of FMDV.

[0051] Example 4: Specificity of the RT-RAA-CRISPR / Cas13a method for detecting SAT2 nucleic acid 1. Nucleic acids of common swine disease viruses such as Seneca virus (SVA), classical swine fever virus (CSFV), porcine epidemic diarrhea virus (PEDV), pseudorabies virus (PRV), porcine reproductive and respiratory syndrome virus (PRRSV), and porcine circovirus (PCV2) were selected to compare with the FMDV-SAT2 RNA standard to verify the specificity of the fluorescence method and the test strip method. ddH2O was used as a negative control.

[0052] 2. RT-RAA amplification was performed using the optimal primer pair screening method described in Example 1. After amplification, 5 μL of RT-RAA product was taken to prepare RT-RAA-CRISPR / Cas13a fluorescence detection system and test strip detection system.

[0053] When the reporter molecule is a fluorescent reporter molecule, the presence of SAT2 nucleic acid in the test sample is determined based on the fluorescence and fluorescence value of the product after the CRISPR / Cas13a reaction. The results are as follows: Figure 10 , Figure 11 The results showed that only the reaction product of the SAT2 nucleic acid positive control showed obvious green fluorescence, while the other control virus samples and negative controls did not produce green fluorescence, thus proving that the fluorescence detection method designed in this invention has high specificity.

[0054] When the reporter molecule is a biotin reporter molecule, the presence of SAT2 nucleic acid in the sample is determined based on the detection result of the test strip inserted into the product of the CRISPR / Cas13a reaction. The result is as follows: Figure 12 The results showed that only the reaction product detection line of the SAT2 nucleic acid positive control showed a clear red line, while the other control virus samples and negative controls only showed a red line in the quality control line. This proves that the test strip detection method designed in this invention has high specificity.

[0055] Example 5: Stability of the RT-RAA-CRISPR / Cas13a method for detecting SAT2 nucleic acid From the calibrated 10 -1 —10 -12 Four dilutions of FMDV-SAT2 RNA standard were randomly selected as templates to prepare the RT-RAA-CRISPR / Cas13a fluorescence detection system, with ddH2O as a negative control. The assay was repeated three times.

[0056] When the reporter molecule is a fluorescent reporter molecule, the results are as follows: Figure 13 , Figure 14 The results showed that the reaction products of FMDV-SAT2 at all four dilutions exhibited obvious green fluorescence, while the negative control did not produce green fluorescence, thus proving that the fluorescence detection method designed in this invention has high stability.

[0057] When the reporter molecule is a biotin reporter molecule, the result is as follows: Figure 15 The results showed that the detection line for the reaction product FMDV-SAT2 showed a distinct red line, while the negative control only showed a red line in the quality control line, thus proving that the test strip detection method designed in this invention has high stability.

[0058] Example 6: RT-RAA-CRISPR / Cas13a simulated FMDV-SAT2 clinical sample detection Twenty bovine tissue samples, twenty bovine swab samples, twenty porcine tissue samples, and twenty porcine swab samples were tested using RT-RAA-CRISPR / Cas13a to simulate clinical samples. Each sample contained 10 positive simulated SAT2 clinical samples and 10 negative simulated clinical samples.

[0059] When the reporter molecule is a fluorescent reporter molecule, the results are as follows: Figure 16 , Figure 17 , Figure 19 , Figure 20 , Figure 22 , Figure 23 , Figure 25 , Figure 26 The results showed that 10 samples of the four clinical samples exhibited obvious green fluorescence, while the negative control did not produce green fluorescence.

[0060] When the reporter molecule is a biotin reporter molecule, the result is as follows: Figure 18 , Figure 21 , Figure 24 , Figure 27 The results showed that in all four clinical samples, 10 samples showed a clear red line on the test line, while only the control line showed a red line in the negative control.

[0061] The RT-RAA-CRISPR / Cas13a fluorescence assay and test strip assay showed a 100% concordance rate with the results of clinical samples simulating FMDV-SAT2, indicating that RT-RAA-CRISPR / Cas13a has the potential for clinical sample analysis.

[0062] In summary, this invention combines RT-RAA technology with CRISPR / Cas13a technology to achieve highly sensitive, highly specific, and low-complexity visual detection of FMDV-SAT2.

Claims

1. An RT-RAA primer pair for detecting South African foot-and-mouth disease virus type II, characterized in that, The sequence of the nucleic acid fragment amplified and detected by the primer pair is SEQ ID NO:

1.

2. The RT-RAA primer pair as described in claim 1, characterized in that, The primer pair has the sequence of the upstream primer as SEQ ID NO:2 and the sequence of the downstream primer as SEQ ID NO:

3.

3. The use of the primer pair according to claim 1 in the preparation of a detection reagent for detecting South African foot-and-mouth disease virus type II.

4. An RT-RAA-CRISPR / Cas13a detection reagent for detecting South African foot-and-mouth disease virus type II, characterized in that, The detection reagent contains the primer pair as described in claim 1.

5. The detection reagent as described in claim 4, characterized in that, The detection reagent also contains CRISPR-Cas13a protein, crRNA, and a reporter molecule.

6. The detection reagent as described in claim 5, characterized in that, The sequence of the crRNA is SEQ ID NO:

4.

7. The detection reagent as described in claim 5, characterized in that, The reporter molecule is a fluorescent reporter molecule with the sequence 5′-UUUUUUUUUUU-3′, and the 5′ and 3′ ends are labeled with FAM and BHQ1, respectively.

8. The detection reagent as described in claim 5, characterized in that, The reporter molecule is a biotin reporter molecule with the sequence 5′-UUUUUUUUUUU-3′, and its two ends are labeled with FAM and biotin, respectively.

9. A method for detecting South African foot-and-mouth disease virus type II, characterized in that, The method described herein is to perform detection using the detection reagent as described in claim 4.

10. The method as described in claim 9, characterized in that, The method, when the reporter molecule is a fluorescent reporter molecule, uses the nucleic acid of the sample to be tested as a template, and performs an RT-RAA reaction using the above-mentioned RT-RAA primer pair to obtain an amplification product. The amplification product is then subjected to a CRISPR / Cas13a reaction using the above-mentioned reporter molecule and the above-mentioned crRNA to obtain a reaction product. The presence of South African foot-and-mouth disease virus type II is determined based on the fluorescence and fluorescence value of the reaction product. Specifically, the reaction product is observed under a blue light / ultraviolet light. If the reaction product produces green fluorescence, the sample to be tested contains South African foot-and-mouth disease virus type II nucleic acid; if the reaction product does not produce green fluorescence, the sample to be tested does not contain South African foot-and-mouth disease virus type II nucleic acid. When the reporter molecule is a biotin reporter molecule, using the nucleic acid of the sample to be tested as a template, an RT-RAA reaction is performed using the above-mentioned RT-RAA primer pair to obtain the amplification product. The amplification product is then subjected to a CRISPR / Cas13a reaction using the biotin reporter molecule and the above-mentioned crRNA to obtain the reaction product. The product after the CRISPR / Cas13a reaction is diluted with dd H2O at a ratio of 1:

1. The test strip is inserted into the diluted mixture and the test result is read after 10 minutes. If the control line is not colored and the test line is visible to the naked eye, it indicates that the nucleic acid probe has been almost completely cleaved by the Cas enzyme, and the result is positive, indicating that the sample to be tested contains South African foot-and-mouth disease virus type II nucleic acid. If the control line is colored and the test line is visible to the naked eye, it indicates that some of the nucleic acid probe has been cleaved by the Cas enzyme, and the result is positive, indicating that the sample to be tested contains South African foot-and-mouth disease virus type II nucleic acid. If the control line is colored but the test line is not colored, it indicates that the nucleic acid probe has not been cleaved by the Cas enzyme, and the result is negative, indicating that the sample to be tested does not contain South African foot-and-mouth disease virus type II nucleic acid. If neither the test line nor the control line is colored, the result is invalid.

Images