Cell environment-specific gene regulation using inhibiting RNA

Abstract

The present invention relates to methods of environment-specific or cellular environment-specific gene regulation, as well as related nucleic acid constructs, cells and therapeutic uses and methods. In particular, the present invention relates to the inhibition of environmentally specific expression of RNA in a cell in order to regulate the expression of one or more target genes in said cell in an environmentally specific manner.

Description

Technical Field

[0001] This invention relates to methods for environment-specific and cell environment-specific gene regulation, as well as related nucleic acid constructs, cells, and therapeutic uses and methods. Specifically, this invention relates to inhibiting environment-specific RNA expression in cells in order to regulate the expression of one or more target genes in the cells in an environment-specific manner. Background Technology

[0002] The following discussion is provided to help readers understand this disclosure and does not constitute any admission of the content or relevance of prior art.

[0003] (or GEiGS) is a gene silencing technology that works by redirecting endogenous non-coding RNAs (ncRNAs) with RNAi-mediated silencing specificity to desired target sequences (such as gene transcripts). In humans, almost all redirected ncRNAs are microRNAs (miRNAs). These ncRNAs precisely target their targets through sequence complementarity, so by altering their sequence, their silencing activity can be transferred to the selected desired target. Precise gene editing of endogenous miRNA sequences enables them to bind to new desired targets through perfect sequence complementarity, silencing those targets via the RNAi pathway.

[0004] therefore, It works by hijacking miRNAs already expressed in cells and redirecting them to silence / regulate the expression of desired targets. GEiGS targets are silenced via the RNAi pathway. However, unlike siRNAs or shRNAs that are silenced by administration of double-stranded oligonucleotides or transgenes, GEiGS utilizes endogenous ncRNAs as a vector for silencing desired targets.

[0005] Modifying the sequence of endogenous ncRNAs to redirect their activity is achieved through genome editing technology, and GEiGS is not dependent on any specific technology, thus it can be used with CRISPR, TALEN, zinc finger nucleases, and any of their derivatives. While the "engine" of GEiGS (how to achieve target silencing) is based on RNAi mechanisms / pathways, the implementation of this technology (how to hijack endogenous ncRNAs to target desired genes) is based on genome editing technology. For these reasons, GEiGS draws on the advantages of both RNAi and genome editing to achieve stable, tunable, and programmable gene silencing.

[0006] Therefore, GEiGS (edit-induced gene silencing) uses endogenous miRNA loci to drive the expression of interfering RNAs (RNAi) specifically designed for novel mRNA targets. This invention is based, at least in part, on the understanding that GEiGS silencing can be selectively active in a specific environment (e.g., cell or tissue type, or cells under certain conditions) but not expressed in another environment (e.g., cell / tissue type, or under different conditions) by redirecting miRNAs or other repressive RNAs with environment-specific activity (e.g., developmentally regulatory, cell state-specific, or induced in response to stimuli in cells), but not expressed in another environment (e.g., cell / tissue type, or under different conditions). Cells can be programmed via gene editing to silence pathway genes, for example, when differentiating from stem cells or after stem cells are stimulated by extracellular signals. GEiGS is particularly powerful in this respect because other RNAi methods cannot silence genes in this environment-specific manner.

[0007] While the GEiGS method is preferred in some embodiments of the invention, other methods for partially or completely silencing gene expression using repressive RNA are also known in the art, such as driving repressive RNA expression by inserting a suitable expression construct into the cell's genome, driving free expression of repressive RNA by providing a suitable expression construct (e.g., on a suitable plasmid or other vector), or by delivering the repressive RNA directly to the cell. Such methods can also be applied to the present invention, provided that the repressive RNA exhibits appropriate environment-specific activity. For example, a suitable repressive RNA construct can be inserted into the genome, for example, at a locus encoding one or more endogenous miRNAs. Senis et al. describe such a method applicable to the present invention. ('TALEN / CRISPR-mediated engineering of a promoterless anti-viral RNAi hairpin into an endogenous miRNA locus'. Nucleic Acids Research, 2017, Vol. 45, No. 1e3 doi:10.1093 / nar / gkw805). Therefore, in some embodiments of the present invention, a sequence encoding repressor RNA (preferably a promoterless sequence encoding repressor RNA) may be inserted into an endogenous miRNA locus, preferably without disrupting or inactivating any endogenous miRNA.

[0008] There remains a need for improved methods to partially or completely silence gene expression in a more selective or specific manner (e.g., in an environment-specific way). This invention relates to a novel method for environment-specific silencing of target gene expression using repressive RNA.

[0009] Non-limiting examples of potential uses of the present invention include: environment-specific silencing of MHC-I on therapeutic cells that is associated with the functional specialization phase of the cells and prevents them from being rejected by the host immune system in an appropriate environment; targeting mechanisms in macrophages that prevent them from being polarized into immunosuppressive cells in response to the tumor microenvironment; and silencing immune checkpoints in T cells, thereby minimizing T cell exhaustion and cell death.

[0010] These and other advantages and uses of the present invention will become apparent from the following disclosure. Summary of the Invention

[0011] In a first aspect, the present invention provides a method for regulating the expression of target genes in cells in a context-specific manner, the method comprising:

[0012] - Provide cells with nucleic acid constructs suitable for expressing inhibitory RNA, which is adapted to suppress the expression of the target gene;

[0013] -The repressor RNA is active in the cell in an environment-specific manner, such that the inhibition of the expression of the target gene occurs specifically in the first environment in which the repressor RNA is active in the cell.

[0014] Appropriately, in at least a second environment where the inhibitory RNA is inactive or has low activity, inhibition does not occur or occurs in a reduced amount.

[0015] Therefore, the present invention relates to inhibiting the environment-specific activity of RNA to provide environment-specific inhibition of target genes. Thus, in a first environment, inhibition of target gene expression occurs only or to a greater extent, while in at least a second environment, such inhibition is absent or reduced. Therefore, the present invention allows for providing cells (preferably cells for therapeutic use) modified to inhibit the expression of target genes in a specific environment by means of conditionally inhibiting RNA activity.

[0016] In some preferred embodiments, the nucleic acid construct is a modified form of an endogenous sequence encoding a repressive RNA (preferably miRNA) that has been modified to target transcripts from a target gene.

[0017] In some preferred embodiments, the cell is adapted to express at least one additional repressive RNA (e.g., second, third, fourth, etc.) that is active in the cell in an environment-specific manner, such that inhibition of the expression of a second or additional target gene occurs specifically in a first environment in which the at least one additional repressive RNA is active in the cell. Alternatively, the at least one additional repressive RNA (e.g., second, third, fourth, etc.) may be active in a second or additional environment different from the first environment. Thus, the method suitably includes providing a cell having a nucleic acid construct adapted to express two or more repressive RNAs adapted to inhibit the expression of a target gene, or adapted to inhibit the expression of two or more target genes.

[0018] In some embodiments, the cell is adapted to express two, three, four, five, or more repressive RNAs, which are active in the cell in an environment-specific manner. Suitable, the repressive RNA targets more than one target gene. For example, two, three, four, five, or more repressive RNAs may target two, three, four, five, or more target genes. In some embodiments, two or more repressive RNAs may target a single target gene.

[0019] In some embodiments, the cell is provided with two or more nucleic acid constructs adapted to express repressive RNAs suitable for inhibiting the expression of one or more target genes in an environment-specific manner. In some embodiments, a single nucleic acid construct is adapted to express two or more repressive RNAs suitable for inhibiting the expression of one or more target genes in an environment-specific manner.

[0020] In some embodiments, the cell is provided with a first nucleic acid construct and at least a second nucleic acid construct, the first nucleic acid construct being adapted to express a first repressive RNA adapted to inhibit the expression of a first target gene in an environment-specific manner, and the second nucleic acid construct being adapted to express a second repressive RNA adapted to inhibit the expression of a second target gene in an environment-specific manner. In some embodiments, the cell is provided with a first nucleic acid construct and at least a second nucleic acid construct, the first nucleic acid construct being adapted to express a first repressive RNA adapted to inhibit the expression of a first target gene in an environment-specific manner, and the second nucleic acid construct being adapted to express a second repressive RNA adapted to inhibit the expression of a second target gene.

[0021] In some embodiments, the cell is provided with a single nucleic acid construct adapted to express two or more repressive RNAs, wherein one of the two or more repressive RNAs is adapted to inhibit the expression of a first target gene in an environment-specific manner, and another of the two or more repressive RNAs is adapted to inhibit the expression of a second target gene in an environment-specific manner. In some embodiments, the cell is provided with a single nucleic acid construct adapted to express two or more repressive RNAs, wherein one of the two or more repressive RNAs is adapted to inhibit the expression of a first target gene in an environment-specific manner, and another of the two or more repressive RNAs is adapted to inhibit the expression of a second target gene.

[0022] In some preferred embodiments, the method includes the step of genetically modifying (editing) an endogenous (typically genomic) sequence encoding an endogenous repressive RNA to alter its targeting specificity.

[0023] In another aspect of the invention, cells or cell populations obtained by the method of the first aspect of the invention are provided.

[0024] In another aspect of the invention, a genetically modified cell is provided, the genetically modified cell comprising a nucleic acid construct adapted to express repressive RNA adapted to suppress the expression of a target gene;

[0025] The repressor RNA is active in an environment-specific manner in the cell, such that the inhibition of the expression of the target gene occurs specifically in the first environment in which the repressor RNA is active in the cell.

[0026] The optional and preferred features of the first aspect as described above are of course related to this second aspect and the other aspects described herein.

[0027] Appropriately, in at least a second environment where the inhibitory RNA is inactive or has low activity, inhibition does not occur or is reduced.

[0028] In some preferred embodiments, the nucleic acid construct is a modified endogenous sequence encoding a repressive RNA (preferably miRNA) that has been modified to target transcripts from a target gene.

[0029] In some preferred embodiments, the cell is adapted to express at least one additional repressive RNA (e.g., second, third, fourth, etc.) that is active in the cell in an environment-specific manner, such that repression of the expression of the gene or a second or additional target gene occurs specifically in a first environment in which the at least one additional repressive RNA is active in the cell. Alternatively, the at least one additional repressive RNA (e.g., second, third, fourth, etc.) may be active in a second or additional environment different from the first environment. Thus, the method suitably includes providing a cell having a nucleic acid construct adapted to express two or more repressive RNAs adapted to suppress the expression of a target gene, or adapted to suppress the expression of two or more target genes.

[0030] In some embodiments, the cell is adapted to express two, three, four, five, or more repressive RNAs, which are active in the cell in an environment-specific manner. Suitablely, the repressive RNA targets more than one target gene. For example, two, three, four, five, or more repressive RNAs may target two, three, four, five, or more target genes. In some embodiments, two or more repressive RNAs may target a single target gene. Suitablely, the repressive RNA may be active in different environments (e.g., at least a first repressive RNA is active in a first environment, and at least a second repressive RNA is active in a second environment).

[0031] In some embodiments, cells are provided with two or more nucleic acid constructs adapted to express repressive RNAs suitable for suppressing the expression of target genes in an environment-specific manner. In some embodiments, a single nucleic acid construct is adapted to express two or more repressive RNAs suitable for suppressing the expression of target genes in an environment-specific manner.

[0032] In some embodiments, the cell is provided with a first nucleic acid construct and at least a second nucleic acid construct, the first nucleic acid construct being adapted to express a first repressive RNA adapted to inhibit the expression of a first target gene in an environment-specific manner, and the second nucleic acid construct being adapted to express a second repressive RNA adapted to inhibit the expression of a second target gene in an environment-specific manner. In some embodiments, the cell is provided with a first nucleic acid construct and at least a second nucleic acid construct, the first nucleic acid construct being adapted to express a first repressive RNA adapted to inhibit the expression of a first target gene in an environment-specific manner, and the second nucleic acid construct being adapted to express a second repressive RNA adapted to inhibit the expression of a second target gene.

[0033] In some embodiments, the cell is provided with a single nucleic acid construct adapted to express two or more repressive RNAs, wherein one of the two or more repressive RNAs is adapted to inhibit the expression of a first target gene in an environment-specific manner, and another of the two or more repressive RNAs is adapted to inhibit the expression of a second target gene in an environment-specific manner. In some embodiments, the cell is provided with a single nucleic acid construct adapted to express two or more repressive RNAs, wherein one of the two or more repressive RNAs is adapted to inhibit the expression of a first target gene in an environment-specific manner, and another of the two or more repressive RNAs is adapted to inhibit the expression of a second target gene.

[0034] In another aspect of the invention, a nucleic acid construct for inhibiting the environment-specific expression of RNA is provided, wherein the inhibitory RNA is adapted to inhibit the expression of a target gene.

[0035] In another aspect of the invention, a nucleic acid construct for environment-specific inhibition of target gene expression in a cell is provided, the nucleic acid construct encoding a repressive RNA adapted to inhibit the expression of the target gene, wherein the repressive RNA is active in the cell in an environment-specific manner, such that inhibition of the expression of the target gene occurs in a first environment in which the repressive RNA is active in the cell.

[0036] Appropriately, in at least a second environment where the inhibitory RNA is inactive or has low activity, inhibition does not occur or is reduced.

[0037] In another aspect of the invention, the use of an environmentally active repressive RNA or a nucleic acid construct encoding an environmentally active repressive RNA in a method for environmentally specific inhibition of the expression of a target gene in a cell is provided, wherein the repressive RNA is active in the cell in an environmentally specific manner, such that inhibition of the expression of the target gene occurs in a first environment in which the repressive RNA is active in the cell.

[0038] Appropriately, in at least a second environment where the inhibitory RNA is inactive or has low activity, inhibition does not occur or is reduced.

[0039] According to another aspect of the invention, a composition comprising the cells of the invention is provided.

[0040] According to another aspect of the invention, the cells or compositions of the invention are provided for treatment.

[0041] According to another aspect of the present invention, a method for treating a disease or ailment of a subject is provided, wherein the method comprises administering the cells of the present invention or the composition of the present invention to the subject in a therapeutic amount.

[0042] According to another aspect of the invention, the use of the cells or compositions of the invention in the preparation of a medicament for treating a disease in a subject is provided.

[0043] On the other hand, a reporter nucleic acid is provided that contains or is composed of a constitutive promoter operatively linked to a gene encoding a fluorescent protein and a target gene (or a portion thereof), wherein the fluorescent protein and the target gene are transcribed into polycistronic mRNA.

[0044] In some preferred embodiments, the target gene is inserted into the 3' untranslated region downstream of the fluorescent protein. In some embodiments, the target gene sequence is inserted as a continuous sequence into the 3' untranslated region of the fluorescent protein. In some preferred embodiments, the fluorescent protein and the target gene are transcribed into a single RNA construct.

[0045] In some implementations, the target gene is part of one or more exons.

[0046] In some preferred embodiments, the target gene is a target gene of one or more repressive RNAs. In some preferred embodiments, the target gene is a target gene of one or more repressive RNAs according to the present invention. The target gene can be any target gene disclosed herein. In some preferred embodiments, the target gene is PDCD-1, B2M, PPARG, IRF4, KDM6B, FOXP3, or STAT6.

[0047] Constitutive promoters can be selected from: simian virus early promoter (SV40), human ubiquitin C promoter (UBC), human elongation factor 1α promoter (EF1A), mouse phosphoglycerate kinase 1 promoter (PGK), and human phosphoglycerate kinase 1 (PGK1).

[0048] In some preferred embodiments, the constitutive promoter is EF1a.

[0049] The fluorescent protein may be selected from: green fluorescent protein (GFP), blue fluorescent protein (BFP), and red fluorescent protein (e.g., dsRed, mCherry, RFP). In some preferred embodiments, the fluorescent protein is GFP, optionally CopGFP (a fast-maturating bright variant).

[0050] In some implementations, the reporter nucleic acid also includes WPRE (posttranscriptional regulatory element of marmot hepatitis virus (WHV)). In some preferred implementations, the reporter nucleic acid is flanked by a long terminal repeat (LTR) sequence.

[0051] In some embodiments, the reporter nucleic acid also includes a gene for a cell surface protein operatively linked to a constitutive promoter. In some preferred embodiments, the cell surface protein is tNGFR (low-affinity NGF receptor) protein. The constitutive promoter operatively linked to the gene for the cell surface protein may be selected from: simian virus early promoter (SV40), human ubiquitin C promoter (UBC), human elongation factor 1α promoter (EF1A), mouse phosphoglycerate kinase 1 promoter (PGK), and human phosphoglycerate kinase 1 (PGK1). In some embodiments, the constitutive promoter operatively linked to the gene for the cell surface protein is PGK. Appropriately, cell surface expression of tNGFR is used to identify cells successfully transfected with a labeled antibody.

[0052] In some implementations, reporter nucleic acids are used to detect the inhibition or silencing of a target gene via one or more repressive RNAs. Reporter nucleic acids are particularly useful in detecting the inhibition or silencing of target genes that do not encode cell surface proteins in living cells.

[0053] On the other hand, the use of the report nucleic acid according to the invention in detecting the inhibition or silencing of a target gene by one or more repressive RNAs is provided.

[0054] On the other hand, an expression system is provided, which includes:

[0055] -The reportable nucleic acid according to the present invention; and

[0056] - An expressed nucleic acid containing a constitutive promoter operatively linked to a nucleic acid sequence encoding a repressive RNA.

[0057] In some embodiments, the expressed nucleic acid includes a constitutive promoter operatively linked to a nucleic acid sequence encoding two or more repressor RNAs. In some embodiments, the expression system includes two or more expressed nucleic acids, each containing a constitutive promoter operatively linked to a nucleic acid sequence encoding a repressor RNA. Expression systems having nucleic acid sequences encoding two or more repressor RNAs or having two or more expressed nucleic acids are particularly advantageous for screening multiple repressor RNAs.

[0058] In some embodiments, the repressor RNA can be any repressor RNA according to any embodiment disclosed herein (e.g., in the "Repressor RNA" section). In some embodiments, the repressor RNA is an endogenous non-coding RNA coding sequence, such as an endogenous repressor RNA coding sequence, which has been modified to retarget the endogenous repressor RNA, thereby silencing or partially silencing the target gene. In some embodiments, the repressor RNA is an endogenous non-coding RNA coding sequence, such as an endogenous repressor RNA coding sequence, which has been modified to retarget the endogenous repressor RNA, thereby silencing or partially silencing the target gene via the GEiGS method. In some embodiments, the repressor RNA is a GEiGS mature sRNA sequence (guide), a GEiGS silencing element (solution) sequence (pre-miRNA hairpin), or a GEiGS extended silencing element. In some preferred embodiments, the repressor RNA is a GEiGS extended silencing element.

[0059] In some preferred embodiments, a nucleic acid-side long terminal repeat (LTR) sequence is expressed.

[0060] In some implementations, the reporter nucleic acid and the expression nucleic acid are provided in a single plasmid. In some implementations, the reporter nucleic acid and the expression nucleic acid are provided in two separate plasmids.

[0061] In some implementations, the reporter nucleic acid and the expression nucleic acid are provided in a single viral vector. In some implementations, the reporter nucleic acid and the expression nucleic acid are provided in a single lentiviral vector.

[0062] In some implementations, the reporter nucleic acid and the expression nucleic acid are provided in two separate viral vectors. In some implementations, the reporter nucleic acid and the expression nucleic acid are provided in two separate lentiviral vectors.

[0063] In some embodiments where the expression system comprises two or more expressed nucleic acids, the two or more expressed nucleic acids may be provided in two or more separate plasmids or two or more separate viral vectors. In some embodiments where the expression system comprises two or more expressed nucleic acids, the two or more expressed nucleic acids may be provided in two or more separate lentiviral vectors.

[0064] In some embodiments, the repressor RNA is integrated into a miRNA scaffold, or the repressor RNA contains a miRNA scaffold. The miRNA scaffold can be any miRNA scaffold disclosed herein. In some preferred embodiments, the repressor RNA is integrated into a miRNA scaffold, providing a reporter nucleic acid in a lentiviral vector and an expression construct in a lentiviral vector. Embodiments where the repressor RNA is integrated into a miRNA scaffold or contains a miRNA scaffold are advantageous because the repressor RNA integrated into the miRNA scaffold or containing a miRNA scaffold is shorter than the typical length of shRNA used in lentiviral constructs. This promises to process the repressor RNA integrated into the miRNA scaffold more efficiently compared to a typical shRNA construct.

[0065] In some embodiments, the expressed nucleic acid further includes a gene encoding an additional fluorescent protein operatively linked to a constitutive promoter. This additional fluorescent protein may be selected from: green fluorescent protein (GFP), blue fluorescent protein (BFP), and red fluorescent protein (e.g., dsRed, mCherry, RFP). In some embodiments, the additional fluorescent protein is dsRed. In some embodiments, the nucleic acid sequence encoding repressor RNA and the gene encoding the additional fluorescent protein are transcribed into a single RNA construct. In some embodiments, the nucleic acid sequence encoding repressor RNA and the gene encoding the fluorescent protein are transcribed into a single RNA construct separated by a T2A sequence.

[0066] In some embodiments, the constitutive promoter in the expressed nucleic acid is selected from: simian virus early promoter (SV40), human ubiquitin C promoter (UBC), human elongation factor 1α promoter (EF1A), mouse phosphoglycerate kinase 1 promoter (PGK), and human phosphoglycerate kinase 1 (PGK1). In some embodiments, the constitutive promoter in the expressed nucleic acid is EF1a.

[0067] In some preferred embodiments, the expression system has nucleic acid sequences encoding two or more repressive RNAs or two or more expressed nucleic acids, and provides reporter nucleic acids and expressed nucleic acids in one or more viral vectors, preferably in lentiviral vectors.

[0068] In some preferred embodiments, the expression system comprises two or more expressed nucleic acids, a reporter nucleic acid is provided in a lentiviral vector, and the two or more expressed nucleic acids are provided in separate lentiviral vectors. As detailed in Examples 21-22 and Example 10, this embodiment is particularly useful for screening repressive RNAs in an efficient and cost-effective manner (in a pool).

[0069] On the other hand, a method is provided for detecting the repressive or silencing activity of one or more repressive RNAs on a target gene, the method comprising:

[0070] (i) Transfect one or more cells using the expression system according to the invention;

[0071] (ii) The repressive RNA binds to the target gene within the polycistronic mRNA;

[0072] (iii) Degradation of the polycistronic mRNA; and

[0073] (iv) Reduction of fluorescence signal from fluorescent proteins in one or more of these cells.

[0074] In some embodiments, inhibiting the binding of RNA to a target gene within the polycistronic mRNA leads to the degradation of the polycistronic mRNA. In some embodiments, the degradation of the polycistronic mRNA results in a reduction in the fluorescence signal of fluorescent proteins from one or more cells.

[0075] In some embodiments, the method for detecting inhibitory or silencing activity further includes incubating one or more cells under conditions suitable for expressing reporter nucleic acids and expressing nucleic acids. In some embodiments, the method for detecting inhibitory or silencing activity further includes detecting a reduction in fluorescence signal.

[0076] In some embodiments, a reduction in the fluorescence signal of a fluorescent protein from one or more cells is detected via flow cytometry, fluorescence microscopy, or any fluorescence imaging system. In some embodiments, a reduction in the fluorescence signal of a fluorescent protein from one or more cells is detected via flow cytometry.

[0077] The one or more cells can be any cells disclosed herein. In some preferred embodiments, the cell is a macrophage. In some preferred embodiments, the cell is an iPSC. In some preferred embodiments, the cell is a T cell. In some preferred embodiments, the cell is a primary T cell. In some preferred embodiments, the cell is a T cell line, preferably Jurkat.

[0078] In embodiments where the cells are T cells, the reporter nucleic acid and the expression nucleic acid are preferably provided in a single lentiviral vector or in two or more separate lentiviral vectors. Plasmid-based methods are limited in their ability to transduce T cells, while the use of lentiviral delivery is advantageous for detecting the repressive or silencing activity of a variety of repressive RNAs.

[0079] In some preferred embodiments, the expression system has nucleic acid sequences encoding two or more repressor RNAs or two or more expressed nucleic acids, and the reporter nucleic acid and the expressed nucleic acid are provided in one or more viral vectors, preferably in lentiviral vectors. As detailed in Examples 21-22 and Example 10, this embodiment is particularly useful for screening repressor RNAs in an efficient and cost-effective manner.

[0080] In some implementations where cells are iPSCs, the reporter nucleic acid and expression nucleic acid are preferably provided in a single lentiviral vector or in two or more separate lentiviral vectors. Plasmid-based screening in iPSCs is limited in terms of the number of transducible plasmids and requires screening for multiple repressive RNAs in an array. Lentiviral delivery, on the other hand, allows for screening a greater number of repressive RNAs at any given time.

[0081] On the other hand, a method is provided for selecting one or more repressive RNAs from a pool of test repressive RNAs that exhibit silencing or suppression of a target gene, the method comprising:

[0082] (i) Transfect one or more cells using the expression system according to the invention;

[0083] (iii) Select one or more repressive RNAs that are transfected into one or more cells that show a reduction in fluorescent signals from fluorescent proteins.

[0084] In some implementations, the expression system has a nucleic acid sequence encoding each test repressor RNA pool, or two or more expressed nucleic acids, each expressing nucleic acid encoding a test repressor RNA pool.

[0085] In some embodiments, the selection method further includes the step of detecting and selecting repressor RNAs that exhibit the highest level of target gene silencing or suppression within the selected repressor RNAs. In some embodiments, the detection and selection steps are performed by detecting discrete cell populations corresponding to each repressor RNA via flow cytometry and selecting cell populations that exhibit the highest level of target gene silencing or suppression to which the repressor RNA is transfected.

[0086] In some embodiments, inhibiting the binding of RNA to a target gene within the polycistronic mRNA leads to the degradation of the polycistronic mRNA. In some embodiments, the degradation of the polycistronic mRNA results in a reduction in the fluorescence signal of fluorescent proteins from one or more cells.

[0087] In some embodiments, the method of selecting RNA inhibition further includes incubating one or more cells under conditions suitable for expressing reporter nucleic acids and expressing nucleic acids. In some embodiments, the method of selecting RNA inhibition further includes detecting a reduction in fluorescence signal.

[0088] In some embodiments, a reduction in the fluorescence signal of a fluorescent protein from one or more cells is detected via flow cytometry, fluorescence microscopy, or any fluorescence imaging system. In some embodiments, a reduction in the fluorescence signal of a fluorescent protein from one or more cells is detected via flow cytometry.

[0089] The one or more cells can be any cells disclosed herein. In some preferred embodiments, the cell is a macrophage. In some preferred embodiments, the cell is an iPSC. In some preferred embodiments, the cell is a T cell. In some preferred embodiments, the cell is a primary T cell. In some preferred embodiments, the cell is a T cell line, preferably Jurkat.

[0090] In embodiments where the cells are T cells, the reporter nucleic acid and the expression nucleic acid are preferably provided in a single lentiviral vector or in two or more separate lentiviral vectors. Plasmid-based methods are limited in their ability to transduce T cells, while the use of lentiviral delivery is advantageous for detecting the repressive or silencing activity of a variety of repressive RNAs.

[0091] In some implementations of iPSCs where cells are present, the reporter nucleic acid and the expression nucleic acid are preferably provided in a single lentiviral vector or in two or more separate lentiviral vectors. Plasmid-based screening in iPSCs is limited in quantity and requires screening for multiple repressive RNAs in an array. Lentiviral delivery allows for screening a greater number of repressive RNAs at any given time.

[0092] The various aspects, implementation schemes, and embodiments of the present invention are described in further detail below.

[0093] Throughout the description and claims of this specification, unless the context otherwise requires, the singular includes the plural. Specifically, when the indefinite article is used, unless the context otherwise requires, the specification should be understood to consider both the plural and the singular.

[0094] The features, wholes, properties, compounds, chemical parts or groups described in connection with a particular aspect, embodiment or example of the invention should be understood to be applicable to any other aspect, embodiment or example described herein, unless incompatible therewith. Attached Figure Description

[0095] Figure 1 A schematic diagram of cell surface MHC-I and the immune surveillance system is shown.

[0096] Figure 2 A schematic diagram illustrates the interaction between cells containing non-self MHC-I and cells completely lacking MHC-I with cells of the adaptive and innate immune systems.

[0097] Figure 3 This demonstrates a strategy to generate low immune cells based on downregulating MHC-I expression to an optimal level that can evade both T-cell and NK-cell-mediated responses.

[0098] Figure 4 A schematic diagram illustrating the use of the GEiGS workflow to develop, test, and implement modified cells according to the present invention is shown.

[0099] Figure 5 A plasmid map of plasmid VB210602-1567ytv for ectopic (free) expression is shown to assess the ability of miRNA sequences identified by GEiGS (“GEiGS silencing elements”) to silence B2M expression.

[0100] Figure 6 The figure shows a real-time PCR (RT-PCR) of small RNAs in iPSCs transfected with either a plasmid expressing a negative control or a plasmid targeting the silencing element 43 (B2M). The GEiGS silencing element was detected only in the corresponding samples, indicating the specificity of the assay. The silencing element 43 was expressed at a level comparable to a group of endogenous miRNAs.

[0101] Figure 7 The flow cytometry method and gating are shown for evaluating the ability of a given GEiGS silencing RNA to reduce B2M expression.

[0102] Figure 8 The diagram illustrates the ability or extent to which repressive / silencing RNA sequences developed via the GEiGS method (“GEiGS silencing elements”) reduce B2M expression in cells, as determined by flow cytometry. Each GEiGS silencing element is a combination of a miRNA scaffold and a specific sequence change complementary to B2M mRNA that triggers mRNA degradation. Silencing elements are developed via a computational workflow to reduce B2M expression. Series 1 shows results for all cells expressing DsRed (all successfully transfected cells), while Series 2 shows the top 20% of results, i.e., cells expressing high levels of DsRed and therefore high levels of GEiGS silencing elements (silencing RNA, sRNA).

[0103] Figure 9 and Figure 10 The mean silencing activity of GEiGS in clonal cell lines is shown, where a GEiGS silencing element was knocked into one or two alleles corresponding to the genomic location of the original encoding miRNA using gene editing technology. Data are presented as residual B2M expression measured by flow cytometry, averaged across multiple clones of the same genotype.

[0104] Figure 11 The expression of endogenous miRNAs of silencing elements 12 and 30 in iPSCs and pancreatic progenitor cells is shown. It can be seen that the expression of silencing element 30 miRNA (hsa-mir-21) is specific to pancreatic progenitor cells, while the expression of silencing element 12 miRNA (hsa-mir-302c) is specific to iPSCs.

[0105] Figure 12 shows a) results indicating reduced surface B2M expression. In a mixed population of CD3-positive T cells, approximately 24% of cells showed B2M silencing, with a mean fluorescence intensity reduction of 80% compared to unedited control cells; b) quantification of B2M silencing in helper (CD4+) and cytotoxic (CD8+) T cells, showing effective silencing of B2M in both compartments (approximately 90%).

[0106] Figure 13 A schematic diagram illustrating the use of the GEiGS method to promote T cell activity in the tumor microenvironment is shown.

[0107] Figure 14 This diagram illustrates a strategy for using GEiGS in macrophage therapy for glioblastoma. GEiGS is used to prevent macrophages from entering a pro-tumorigenic (i.e., tumor-associated macrophage, TAM) state, thereby promoting an active inflammatory phenotype in the tumor microenvironment (TME). Environment-specific GEiGS is used to target the IL-4-induced genes STAT6 and IRF4, promoting the expression of inflammatory genes.

[0108] Figure 15 This diagram illustrates how GEiGS modification can be used to specifically silence additional pathways (e.g., only when T cells reach the tumor). By conditionally silencing DRP1 through redirected miRNAs, environment-specific GEiGS-mediated inhibition of mitochondrial division in the TME promotes the differentiation and persistence of memory T cells, while allowing mitochondrial dynamics to continue and contributing to mitochondrial homeostasis (such as mitophagy).

[0109] Figure 16 A scatter plot of the primary T cell transcriptome is shown, illustrating the fold change in count per millionfold (from initial to stimulation). This indicates that stimulation-induced miRNAs can be detected in primary T cells. Candidate upregulated miRNAs are highlighted with larger circles (Data from Amaral et al, 2017, EMBO J, EMBO J. 2017 Feb 1; 36(3):346-360).

[0110] Figure 17The figure illustrates the editing efficiency of CRISPR KI (GFP KI at the RAB11A locus) on primary T cells, showing that T cells can be efficiently edited via CRISPR knock-in (KI) (data from Roth et al, 2018, Nature. 2018 Jul; 559(7714):405-409.).

[0111] Figure 18a Differential expression analysis of miRNA and mRNA in primary macrophages. These figures show expression levels (x-axis, log2 of normalized count) versus fold change (y-axis, log2 of transformation). Comparisons were made between pro-inflammatory (M1) and anti-inflammatory (M2a). Dots represent individual genes, and values ​​highlighted indicate statistically significant differences between different disease patterns—above 0 indicates high anti-inflammatory and low pro-inflammatory, and below 0 indicates low anti-inflammatory and high pro-inflammatory.

[0112] Figure 18b THP-1 cells effectively differentiated and polarized into pro-inflammatory and anti-inflammatory macrophage-like cells. These figures illustrate flow cytometry detection of known macrophage polarization markers (CD80 for pro-inflammatory; CD209 for anti-inflammatory).

[0113] Figure 18c Correlation analysis of miRNA expression in polarized primary macrophages and THP-1 cells showed a high correlation between the two experimental models.

[0114] Figure 19a Monocytes were efficiently generated from iPSCs. Using a published protocol, iPSC lines (GEiGS silencing element 30 (S30 / S30 genotype) and syngeneic controls) were used to generate enriched monocytes, in which more than 90% of the cells were double-positive for the known monocyte markers CD14 and CD45.

[0115] Figure 19b Environment-specific silencing of B2M in iPSC-derived monocytes. Monocytes were generated using iPSC lines (GEiGS silencing element 30 and syngeneic control), and then flow cytometry (e.g., ...) was performed. Figure 9 , Figure 10 (As shown in Figure 12) These monocytes were stained for residual B2M expression on the cell surface. When expanded as undifferentiated iPSCs, more than 93% of cells in both the syngeneic control and the GEiGS silencing element 30 clone expressed B2M. However, after differentiation into monocytes, the GEiGS silencing element 30 clone showed a significantly reduced number of cells with the same amount of B2M expression on the cell surface compared to the syngeneic control (16% of cells had residual B2M compared to 77%).

[0116] Figure 20a A schematic diagram illustrates the process of identifying miRNAs for environment-specific GEiGS, followed by ectopic screening to assess target RNA silencing in target cells using a dual reporter plasmid system.

[0117] Figure 20b and Figure 20c A plasmid map of plasmids used for ectopic expression screening is shown to identify GEiGS silencing elements targeting the genes PPARγ, IRF4, KDM6B, and STAT6 in macrophages derived from monocytes (see Example 9).

[0118] Figure 20d A dual reporter gene construct containing the 3' untranslated sequence of the target gene in macrophages is shown. The specificity of the GEiGS silencing element is analyzed by using the dual reporter gene construct via GFP degeneration.

[0119] Figure 21a and Figure 21b The results of environment-specific silencing of B2M in iPSC-derived monocytes are shown in relation to the results illustrated in Figure 19. Figure 21a The expression of hsa-mir-21 in iPSCs was shown compared to that in macrophages; miR-21 was highly expressed in macrophages but not in iPSCs (quantified using NGS). Figure 21b The relative B2M expression in GEiGS-modified iPSCs, monocytes, and macrophages is shown compared to control cells in which endogenous miR-21 was knocked out (KO / KO). (miR-21 was redirected to target B2M, i.e., silencing element 30). GEiGS and control lines were first differentiated into monocytes in vitro, and then into macrophages. B2M was measured by flow cytometry and showed effective silencing in myeloid cells (84%–88% silencing), but not in the iPSC stage.

[0120] Figure 21c , Figure 21d , Figure 21e and Figure 21f The study showed that B2M silencing in myeloid cells leads to a reduction in HLA-A / B / C (and therefore MHC-I) on the cell surface of monocytes and macrophages.

[0121] Figure 22a , Figure 22b and Figure 22cThe results of the study are shown, demonstrating that GEiGS is highly specific and shows no off-target effects. Specifically, the GEiGS method for silencing B2M, as described herein, is highly specific and shows no significant off-target effects for expression other than B2M. The MA plots for differential gene expression analysis show log2 per million average counts on the x-axis and log2 of fold change on the y-axis. Points represent the individual genes tested. Significantly downregulated genes are highlighted in blue, and significantly upregulated genes are highlighted in red. Genes with no significant change in expression levels are shown in black. Figure 22a Transcriptomic data of CRISPR B2M knockout modified cells are shown compared to the control WT / WT parental cell line. The significantly reduced B2M expression level compared to the control is highlighted. No other significant changes were observed in the expression levels of other genes. Figure 22b Transcriptomic data are shown in cells where the miRNA hsa-mir-20a has been knocked out, compared to the control WT / WT parental cell line. Note that hsa-mir-20a is a miRNA edited when 'silencing element 29' is introduced via GEiGS. No significant change in expression levels was observed due to the knockout of hsa-mir-20a. Figure 22c Transcriptomic data are shown in cells in which the miRNA for silencing element 29 has been introduced by GEiGS compared to the control WT / WT parental cell line. It can be seen that, similar to CRISPR KO, only B2M shows a significant change in expression. The expression levels of other genes did not show any other significant changes.

[0122] Figure 23 The effect of homology arm length on homology-dependent repair (HDR) efficiency was demonstrated. Flanking genome sequences of 40 base pairs (homology arms) showed superior HDR efficiency (%HDR) in a dose-dependent manner compared to flanking genome sequences of 350 bp or 150-350 bp in length, while these longer flanking genome sequences were only slightly better than those without a donor template alone.

[0123] Figure 24 Partial knockdown of B2M was shown to result in reduced specific lysis of activated NK cells in tissue cultures (corresponding to enhanced cell survival after exposure to the innate (NK-mediated) immune system). NK cells and target cells were cultured under different experimental conditions, including exposure to the NK cell-activating cytokines IL-2 and / or IL-12. Compared to the positive control K562 cell line, the control iPSCs showed reduced levels of specific lysis, which is known to be a potent stimulant for activated NK cell-mediated killing. Undifferentiated B2M - / -iPSCs exhibited high levels of specific lysis because the complete absence of B2M led to the complete absence of MHC-I (“self-deficient” phenotype) and failure to be detected and lysed by activated NK cells. Under all the mixed culture conditions tested, with B2M… - / - Compared to other cell lines, undifferentiated, GEiGS-modified iPSC lines (iPSCs) S29 / 29 The results showed a sustained reduction through specific lysis of NK cells.

[0124] Figure 25 The ability of silencing element 29 to buffer the induction of B2M expression in edited cells after exposure to inflammatory stimuli (IFN-γ) was demonstrated (as measured by MHC-I assay).

[0125] Figure 26 This demonstrates the ability of the silencing element 30 heterozygous IPSC line to differentiate into well-defined endoderm cells expressing CXCR4. The heterozygous knock-in line (iPSC miR-21) S30 / +1 ) compared with control (unmodified, 50%) and B2M - / - iPSCs (95%) showed a high proportion of CXCR4-positive cells compared to the other two (approximately 97%).

[0126] Figure 27a The study showed a reduced proportion of CXCR4-expressing cells generated from in vitro differentiation of the silencing element 30 heterozygous iPSC line, with decreased B2M expression. Compared to the control (unmodified) iPSC cell line, iPSC miR-21... S30 / +1 The results showed that B2M expression was reduced by approximately 80%. As predicted, B2M... - / - iPSCs do not express the B2M protein.

[0127] Figure 27b The expression of pancreatic and duodenal homeobox-1 (PDX-1) and B2M in pancreatic progenitor cells was shown. The results indicated that a significant proportion of specialized progenitor cells were positive for PDX-1, a marker gene essential for pancreatic development and β-cell maturation. Most PDX-1-positive cells also stained for B2M. (iPSC miR-21) S30 / +1 The clonal line showed a high proportion of cells expressing PDX-1, with significantly reduced B2M expression compared to the control (unmodified) iPSCs.

[0128] Figure 28 A flow cytometry gating strategy is shown for determining the “hit” of GEiGS silencing elements against macrophage target genes using dual reporter genes.

[0129] Figure 29This study demonstrates the identification of macrophage target gene (STAT6, IRF4, and KDM6B) GEiGS silencing elements from ectopic screening using a dual reporter gene system construct.

[0130] Figure 30 An ectopic screening strategy using a dual reporter gene system to identify “hit” against T cell targets of interest from designed GEiGS silencing elements is demonstrated.

[0131] Figure 31a The build used to verify the use of lentivirus transduction and hybrid screening strategies is shown. Figure 31b This demonstrates the use of lentiviral transduction and a mixed screening strategy to identify “hit” from designed GEiGS silencing elements using primary human T cells.

[0132] Figure 32a This demonstrates the validation of a lentivirus-based hybrid screening strategy in primary human T cells using silencing elements validated against both eGFP and B2M. Figure 32b The following are shown: corresponding to the various silencing elements (selected from Example 2) and DsRed and B2M knockdown as combined silencing elements delivered via lentivirus in the Jurkat cell line.

[0133] Figure 33a and Figure 33b This demonstrates how various silencing elements, when ectopically expressed from a single construct with a constitutive promoter in an iPSC, can silence their target genes. Plasmid maps for expressing one or more silencing elements are shown. Figure 33a The plasmid construct was characterized using a miR-30-based silencing element that targets eGFP downstream of the dsRed reporter gene at the multiple cloning site (MCS), driven by a constitutive EF1a promoter. One or more silencing elements designed for B2M and eGFP, or B2M alone, were used instead of the eGFP-targeting silencing element (see Example 23). Figure 33b The results showed that silencing element 101, composed of miRNA-30 repurposed to target GFP only, demonstrated effective GFP silencing without affecting B2M expression levels in undifferentiated iPSCs, and silencing element 179, composed of two different modified miRNA scaffolds (miRNA-20a and miRNA-30), effectively silenced both B2M and eGFP with significantly equal efficiency.

[0134] Figure 34The results showed that silencing element 177, composed of modified miRNA-518b (silencing element 43) and miRNA-20a (silencing element 29), a different silencing element with different sequences targeting B2M transcripts (triggers), appeared to be more effective in silencing B2M compared to silencing element 43 alone, indicating a smaller additive effect, and that the two different silencing elements did not interfere with each other's ability to silence B2M. Silencing element 178, with two copies of silencing element 29 and the same trigger sequence, did not exhibit an additive effect in silencing B2M compared to silencing element 29 alone. Detailed Implementation

[0135] Although the preparation and use of various embodiments of the invention are discussed in detail below, it should be understood that the invention provides many applicable inventive concepts that can be implemented in various specific environments. The specific embodiments discussed herein are merely illustrative of specific ways of preparing and using the invention and do not limit the scope of the invention.

[0136] To facilitate understanding of this invention, several terms are defined below. The terms defined herein have meanings commonly understood by one of ordinary skill in the art related to this invention. Terms such as “a,” “an,” and “the” are not intended to refer only to a singular entity, but rather to include general categories that may be illustrated with specific examples. The terms herein are used to describe specific embodiments of the invention, but their use does not limit the invention unless set forth in the claims.

[0137] definition

[0138] "Environment-specific activity," "environment-specific inhibition," "environment-specific mode," and similar expressions refer to the preferential, predominant, or exclusive inhibition of a target gene or target RNA by an inhibitory RNA in a given cellular environment. In some embodiments, "environment specificity" can be "cell-environment-specific" inhibition of a target gene or target RNA by an inhibitory RNA that occurs preferentially, predominantly, or exclusively in a single cell within a given cellular environment. In some embodiments, "environment specificity" excludes tissue specificity.

[0139] In the context of this invention, "environment" refers to any suitable cell type, cell condition, or cell state (as the case may be). A "first environment" is the environment in which the expression of a target gene is to be selectively regulated (e.g., silenced). Specifically, a first environment is typically a cellular environment in which the activity of a given endogenous repressive RNA (e.g., miRNA) is increased compared to other environments. Thus, the activity of the endogenous RNA can be used to provide environment-specific gene silencing. A "second environment" can be any environment in which the target gene is not to be silenced or is silenced to a lesser degree. For example, the first or second environment of the cells of this invention can be selected from a non-exhaustive list of the following: cell type; cell differentiation stage; disease condition; hypoxic condition; stimulating condition; inflammatory condition; tumor-related condition, etc. In some embodiments, the second environment is any environment other than the first environment. In some embodiments, the second environment is a different differentiation stage of the cell. In some embodiments, the second environment is when the cell is not in the intended location (e.g., in the TME). Other environments are discussed in more detail herein. Target mRNAs (i.e., mRNAs that are the targets of repressive RNAs in this invention) are typically at least partially silenced in the first environment, and not silenced or silenced to a lesser degree in environments other than the first environment. The target mRNA can be an mRNA that is expressed at a high level in the first environment, for example, because it is upregulated in the first environment.

[0140] The terms “RNA interference” and “RNAi” are synonymous and refer to the process by which a polynucleotide (e.g., miRNA or siRNA) containing at least one polynucleotide unit influences biological processes. This process includes, but is not limited to, gene silencing through mRNA degradation, attenuation of translation, interactions with tRNA, rRNA, hnRNA, cDNA, and genomic DNA, and DNA methylation through helper proteins. “Repressive RNA” is an RNA molecule capable of RNA interference, whether as is or after cellular processing. Therefore, the term specifically includes RNA precursors processed to form miRNA, siRNA, or other RNAs capable of degrading target mRNA. The term “sRNA” is also used herein to refer to repressive RNA (i.e., silent RNA, abbreviated as sRNA).

[0141] The term "silencing" or "gene silencing" refers to the process of reducing or attenuating the expression of a specific gene product, typically achieved in this case by RNA interference. Target genes are usually silenced by inhibiting RNA targeting (e.g., via complementary binding) of the target RNA encoded by that gene. Therefore, in the context of this invention, gene silencing is typically achieved by utilizing inhibiting RNA targeting of the target RNA transcribed from that gene, as described herein. Silencing genes typically encode protein gene products, but they can also encode RNA gene products. The level of gene silencing (sometimes referred to as "knockdown" or the degree of reduced expression) can be measured in a variety of ways, including but not limited to measuring transcript levels by RNA blot analysis, B-DNA technology, transcription-sensitive reporter gene constructs, expression profiling (e.g., DNA microarrays), qRT-PCR, and related techniques. Alternatively, the level of silencing can be measured by assessing the level of the protein encoded by a specific gene. This can be achieved through a variety of studies, including antibody-based detections (such as protein analysis and flow cytometry), measuring the expression levels of reporter proteins having, for example, fluorescent properties (e.g., GFP) or enzymatic activity (e.g., alkaline phosphatase), or several other procedures. Typically, the level of silencing or reduction is compared to the expression level of a given protein or mRNA in control cells, as appropriate. Depending on the circumstances, silencing at least 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 96%, 97%, 98%, or 99% may be preferred. Generally, higher levels of silencing are preferred.

[0142] The terms “microRNA,” “miRNA,” or “miR” are synonymous and all refer to non-coding RNAs capable of entering the RNAi pathway and regulating gene expression, such as non-coding RNAs of approximately 19–24 nucleotides in length (and, as the context will indicate, also the DNA sequence encoding such RNA). “Primary miRNA” or “pri-miRNA” refers to the non-coding transcript prior to Drosha processing and includes stem-loop structures and flanking 5' and 3' sequences. “Pre-miRNA” or “pre-miRNA” refers to the non-coding transcript following Drosha processing of pri-miRNA. The term “mature miRNA” can refer to the double-stranded product of Dicer processing of pre-miRNA or the single-stranded product introduced into RISC after Dicer processing. In some cases, only the single strand of the miRNA enters the RNAi pathway. In other cases, both strands of the miRNA can enter the RNAi pathway. miRNAs are present in a variety of organisms (e.g., insects, mammals, plants, nematodes) and have been shown to play roles in development, homeostasis, and disease etiology.

[0143] The terms “silent RNA form” or “silent RNA” or “silent RNA molecule”, “sRNA” or “trigger sequence / RNA” refer to mature small RNAs that can hybridize with target RNA (or fragments thereof) and participate in the RNAi pathway.

[0144] The term "target RNA" refers to a specific RNA targeted by the RNAi pathway, resulting in a reduction in the functional activity of that RNA. In some cases, the RNA target is mRNA (typically B2M), whose functional activity is its ability to be translated. In such cases, the RNAi pathway will reduce the functional activity of the mRNA through translational attenuation or cleavage. In this disclosure, the target RNA is targeted by a non-naturally occurring miRNA. The term "target" may also refer to DNA.

[0145] The term "endogenous miRNA" refers to miRNAs produced in an organism by transcription of sequences naturally present in the organism's genome. Endogenous miRNAs can be located, for example, introns, open reading frames (ORFs), 5' or 3' untranslated regions (UTRs), or intergenic regions. Organisms that produce endogenous miRNAs can be, but are not limited to, humans (and other primates), mice, rats, flies, worms, fish, or other organisms with a complete RNAi pathway. In some embodiments of the invention, the endogenous miRNA locus is altered to retarget the endogenous miRNA to a new target (for suitable methods using a method called GEiGS, see, for example, WO2019 / 058253, WO2020 / 183414, and WO2020 / 183419). Endogenous miRNAs can be modified in situ, meaning that endogenous miRNAs in the genome can be directly modified, or copies of endogenous miRNAs can be removed from their normal genomic background and modified (e.g., for ectopic expression in cells, such as at different genomic loci or in free expression in a suitable vector). Modified copies of endogenous miRNAs can also be inserted into the locus of the original endogenous miRNA, allowing the modified copy to be co-transcribed with the original endogenous miRNA; this can be achieved without destroying or inactivating the original endogenous miRNA (e.g., placing the modified copy of the endogenous miRNA upstream or downstream of the original endogenous miRNA).

[0146] As used herein, the term "nucleic acid construct suitable for expressing repressor RNA" means any polynucleotide sequence suitable for expressing repressor RNA as described herein. The nucleic acid construct can be genomically integrated or free. In some embodiments, the nucleic acid construct can be a modified endogenous genomic sequence, for example, one that has been genetically modified, such as through gene editing, to make the endogenous genomic sequence suitable for expressing repressor DNA. In some embodiments, the nucleic acid construct can be a synthetic construct, such as an expression cassette in a suitable vector. In other embodiments, the nucleic acid construct can be a synthetic construct already inserted into the genome. In some preferred embodiments, the construct is a modified endogenous genomic locus in which an endogenous sequence encoding non-coding RNA has been modified (in situ) to provide a sequence encoding repressor RNA, which has been retargeted to silence a target gene.

[0147] The terms “identity” and “sameness” refer to the sequence similarity between two polymer molecules, such as two nucleic acid molecules, or two DNA molecules. Sequence alignment and determination of sequence identity can be performed, for example, using the basic local alignment search tool (BLAST) originally described by Altschul et al. 1990 (J Mol Biol 215:403-10), such as the “Blast 2 sequence” algorithm described by Tatusova and Madden 1999 (FEMS Microbiol Lett 174:247-250).

[0148] The methods used to align sequences for comparison are well known in the art. Various procedures and alignment algorithms are described in, for example: Smith and Waterman (1981) Adv. Appl. Math. 2:482; Needleman and Wunsch (1970) J. Mol. Biol. 48:443; Pearson and Lipman (1988) Proc. Natl. Acad. Sci. USA 85:2444; Higgins and Sharp (1988) Gene 73:237-44; Higgins and Sharp (1989) CABIOS 5:151-3; Corpet et al. (1988) Nucleic Acids Res. 16:10881-90; Huang et al. (1992) Comp. Appl. Biosci. 8:155-65; Pearson et al. (1994) Methods Mol. Biol. 24:307-31; Tatiana et al. (1999) FEMS Microbiol. Lett. 174:247-50. For detailed considerations on sequence alignment methods and homology calculations, see, for example, Altschul et al. (1990) J.Mol.Biol. 215:403-10.

[0149] The National Center for Biotechnology Information (NCBI) Basic Local Comparison Search Tool (BLAST) TM Altschul et al. (1990) are available from multiple sources, including the National Center for Biotechnology Information (Bethesda, MD, MW) and the Internet, for use in conjunction with various sequence analysis programs. Instructions on how to use the program to determine sequence identity are available on the Internet via BLAST. TM The "Help" section can be found there. For comparing nucleic acid sequences, BLAST can be used. TM The "Blast 2 Sequence" function of the (Blastn; Aligned Sequence Nucleotide BLAST) program, using default parameters, will display an increased percentage of identity when evaluated using this method for nucleic acid sequences that have even greater similarity to a reference sequence. Typically, the percentage of sequence identity is calculated over the entire length of the sequence.

[0150] For example, the globally optimal alignment can be found appropriately using the Needleman-Wunsch algorithm with the following scoring parameters: match score: +2, mismatch score: -3; gap penalty: gap open 5, gap extend 2. The identity percentage of the resulting optimal global alignment is appropriately calculated by multiplying the ratio of the number of aligned bases to the total alignment length by 100, where the alignment length includes both matches and mismatches.

[0151] The term "complementary" refers to the ability of a polynucleotide to form base pairs with each other. Base pairs are typically formed by hydrogen bonds between nucleotide units in antiparallel polynucleotide chains. Complementary polynucleotide chains can pair bases in a Watson-Crick manner (e.g., A to T, A to U, C to G) or in any other manner that allows for the formation of a duplex (including a wobbly base pair formed between U and G). As those skilled in the art will know, when using RNA instead of DNA, uracil, rather than thymine, is considered a complementary base to adenosine. However, when U is referred to in the context of this invention, it means, unless otherwise stated, that it can substitute for T.

[0152] Complete complementarity, or 100% complementarity, means that each nucleotide unit of one polynucleotide chain can form a hydrogen bond with a nucleotide unit of another polynucleotide chain. Partial complementarity means that some, but not all, nucleotide units of the two chains can form a hydrogen bond with each other. For example, when at least 6-7 base pairs can be formed on a segment of about 19-25 nucleotides, the two chains are at least partially complementary. Sequences are said to be “complementary” to each other when each sequence is a (partial or complete) anticomplement (RC) sequence of another sequence. For example, the sequence 5'GATC 3' is completely complementary to its anticomplement 3'CTAG 5'. Sequences can also have rocking base pairings.

[0153] As used herein, the term “expression cassette” includes a polynucleotide sequence encoding a polypeptide or RNA to be expressed and sequences that control its expression, such as promoter and optional enhancer sequences, including any combination of cis-acting transcriptional control elements.

[0154] As used herein, the term "eukaryotic cell" refers to any cell of a eukaryote. Eukaryotes include both single-celled and multicellular organisms. Single-celled eukaryotes include, but are not limited to, yeast, protozoa, slime molds, and algae. Multicellular eukaryotes include, but are not limited to, animals (e.g., mammals, insects, invertebrates, nematodes, birds, fish, reptiles, and crustaceans), plants, fungi, and algae (e.g., brown algae, red algae, and green algae).

[0155] As used herein, the phrase "stem cell" refers to a cell that, while remaining undifferentiated in culture for an extended period, is capable of self-renewal but retains the ability to differentiate into one or more different cell types (e.g., fully differentiated cells) with specific, specialized functions. Stem cells can be totipotent, pluripotent, multipotent, or unipotent until induced to differentiate into other cell types. Totipotent cells, such as embryonic cells in the first few cell divisions after fertilization, are the only cells capable of differentiating into embryonic cells and extraembryonic cells and developing into a living human. Preferably, the phrase "pluripotent stem cell" refers to a cell that can differentiate into all three defined embryonic germ layers (i.e., ectoderm, endoderm, and mesoderm) or remain undifferentiated. Pluripotent stem cells include embryonic stem cells (ESCs) and induced pluripotent stem cells (iPSCs). Pluripotent stem cells include adult stem cells and hematopoietic stem cells.

[0156] Induced pluripotent stem cells (iPSCs; embryonic-like stem cells) are cells obtained by dedifferentiating adult somatic cells, giving them pluripotency, meaning they can differentiate into the three embryonic germ cell layers: endoderm, ectoderm, and mesoderm. These cells can be obtained from differentiated tissues (e.g., somatic tissues such as skin) and dedifferentiated through genetic manipulation, thereby reprogramming the cells to acquire embryonic stem cell characteristics. Induced pluripotent stem cells can be generated from somatic cells by inducing the expression of Oct-4, Sox2, Kfl4, and c-Myc in somatic cells. Induced pluripotent stem cells (iPSCs) (embryo-like stem cells) can be generated from somatic cells through genetic manipulation, for example, by retroviral transduction of somatic cells such as fibroblasts, hepatocytes, and gastric epithelial cells with transcription factors such as Oct-3 / 4, Sox2, c-Myc, and KLF4, as described in Park et al. Reprogramming of human somatic cells to pluripotency with defined factors. Nature (2008) 451:141-146. iPSCs can be human-derived or non-human-derived.

[0157] The phrase "embryonic stem cells" refers to cells capable of differentiating into all three embryonic germ layers (i.e., endoderm, ectoderm, and mesoderm) or embryonic cells that remain undifferentiated. The phrase "embryonic stem cells" may include cells obtained from embryonic tissue formed after early pregnancy (e.g., blastocyst) but before implantation (i.e., preimplantation blastocyst), extended blastocyst cells (EBCs) obtained from postimplantation / pregastrulation blastocysts (see WO2006 / 040763), embryonic germ (EG) cells obtained from fetal reproductive tissue at any time during pregnancy, preferably before 10 weeks of gestation, and cells derived from unfertilized eggs stimulated by parthenogenesis (parthenogenetic organisms).

[0158] Embryonic stem cells in some embodiments of the present invention can be obtained using well-known cell culture methods. For example, human embryonic stem cells can be isolated from human preimplantation blastocysts. Human blastocysts are typically obtained from preimplantation embryos in humans or from in vitro fertilization (IVF) embryos. Alternatively, single-cell human embryos can be expanded to the blastocyst stage.

[0159] It should be understood that, according to some embodiments of the present invention, commercially available stem cells may also be used. Human ES cells are available from the NTH Human Embryonic Stem Cell Registry [www.grants.nih.gov / stem_cells / registry / current.htm].

[0160] Furthermore, embryonic stem cells can be obtained from various species, including mice (Mills and Bradley, 2001), golden hamsters [Doetschman et al., 1988, Dev Biol. 127:224-7], rats [Iannaccone et al., 1994, DevBiol. 163:288-92], rabbits [Giles et al. 1993, Mol Reprod Dev. 36:130-8; Graves & Moreadith, 1993, Mol Reprod Dev. 1993, 36:424-33], and several domesticated animal species [Notarianni et al., 1991, J Reprod Fertil Suppl. 43:255-60; Wheeler 1994, Reprod Fertil Dev. 6:563-8; Mitalipova et al. ] [Thomson et al., 2001, Cloning. 3: 59-67] and non-human primate species (rhesus monkeys and marmosets) [Thomson et al., 1995, Proc Natl Acad Sci US A. 92: 7844-8; Thomson et al., 1996, Biol Reprod. 55: 254-9].

[0161] The phrase "adult stem cells" (also known as "tissue stem cells" or stem cells derived from somatic tissues) refers to any stem cell derived from somatic tissues [in animals (especially humans) after birth or before birth]. Adult stem cells are generally considered pluripotent stem cells, capable of differentiating into multiple cell types. Adult stem cells can be derived from any adult, neonatal, or fetal tissue, such as adipose tissue, skin, kidney, liver, prostate, pancreas, intestine, bone marrow, and placenta.

[0162] According to one embodiment, some embodiments of the present invention utilize bone marrow (BM)-derived stem cells, including hematopoietic stem cells, stromal stem cells, or mesenchymal stem cells [Dominici, M et al., (2001) J. Biol. Regul. Homeost. Agents. 15:28-37]. BM-derived stem cells can be obtained from the iliac crest, femur, tibia, spine, ribs, or other medullary spaces.

[0163] Hematopoietic stem cells (HSCs), also known as adult tissue stem cells, include stem cells obtained from the blood or bone marrow tissue of individuals of any age or from the umbilical cord blood of newborn individuals. Preferred stem cells for this aspect according to some embodiments of the invention are embryonic stem cells, preferably embryonic stem cells derived from humans or primates (e.g., monkeys).

[0164] Mesenchymal stem cells (MSCs) (formative pluripotent blasts) give rise to one or more mesenchymal tissues (e.g., adipose tissue, bone, cartilage, elastic and fibrous connective tissue, myoblasts) and tissues other than those originating from the embryonic mesoderm (e.g., nerve cells), depending on the various effects of bioactive factors such as cytokines. Although such cells can be isolated from the embryonic yolk sac, placenta, umbilical cord, fetal and adolescent skin, blood, and other tissues, their abundance in BMs is far greater than in other tissues, and therefore isolation from BMs is currently preferred. Adult tissue stem cells can be isolated using various methods known in the art, such as those disclosed in the following literature: Alison, MR [J Pathol. (2003) 200(5): 547-50]. Fetal stem cells can be isolated using various methods known in the art, such as those disclosed in the following literature: Eventov-Friedman S, et al. [PLoS Med. (2006) 3: e215].

[0165] Hematopoietic stem cells can be isolated using a variety of methods known in the art, such as those disclosed in the following literature: Robert Lanze, ed., "Handbook of Stem Cells", Elsevier Academic Press, 2004, Chapter 54, pp. 609-614, "isolation and characterization of hematopoietic stem cells", by Gerald J Spangrude and William B Stayton.

[0166] Methods for isolating, purifying, and expanding mesenchymal stem cells (MSCs) are known in the art and include those disclosed, for example, in the following literature: Caplan and Haynesworth, U.S. Patent No. 5,486,359; and Jones E.A. et al., 2002, Isolation and characterization of bone marrow multipotential mesenchymal progenitor cells, Arthritis Rheum. 46(12):3349-60.

[0167] When used in reference to polynucleotide sequences, “artificial” or “synthetic” means a sequence not found in nature, such as a synthetic modification of a natural sequence or containing a non-natural sequence.

[0168] The terms “polynucleotide,” “nucleotide,” or “nucleic acid” are used interchangeably herein and refer to a polymeric macromolecule composed of nucleotide chains of monomers, particularly deoxyribonucleotides or ribonucleotides, regardless of length. Nucleotides include purines, such as adenine, hypoxanthine, guanine, and their derivatives and analogs, and pyrimidines, such as cytosine, uracil, thymine, and their derivatives and analogs. The term also covers nucleic acids containing known nucleotide analogs or modified backbone residues or bonds, which are naturally occurring and non-naturally occurring, have properties similar to a reference nucleic acid, and are intended to be metabolized in a manner similar to a reference nucleotide or to have an extended half-life in a system. Examples of such analogs include, but are not limited to, thiophosphates, aminophosphates, methyl phosphonates, chiral methyl phosphonates, 2-O-methylribonucleotides, and peptide-nucleic acids (PNAs). Appropriately, the term “polynucleotide” refers to a naturally occurring polymer of monomers of deoxyribonucleotides or ribonucleotides. Non-limiting examples of polynucleotides include genes, gene fragments, messenger RNA (mRNA), complementary DNA (cDNA), non-coding RNA (ncRNA), microRNA (miRNA), small RNA (sRNA), short interfering RNA (siRNA), short hairpin RNA (shRNA), recombinant polynucleotides, plasmids, vectors, isolated DNA of any sequence, isolated RNA of any sequence, nucleic acid probes, and primers. The polynucleotides of the present invention can be provided in a separable or substantially separable form. "Substantially separable" means that the polypeptide can be substantially separable from any surrounding medium, but not completely separable. The polynucleotides can be mixed with a vector or diluent that does not interfere with their intended use and are still considered substantially separable. Suitably, the polynucleotides of the present invention are recombinant. "Recombinant" means that the polynucleotide is the product of at least one step in cloning, restriction, or ligation, or the product of other procedures that produce nucleic acid molecules different from naturally found nucleic acid molecules (e.g., in the case of cDNA).

[0169] As used herein, the term "operably linked" refers to the arrangement of various nucleic acid elements relative to each other such that these elements are functionally linked and able to interact with each other in a intended manner. When nucleic acid sequence elements are operably linked, they work together to regulate each other's activity. Regulation means increasing, decreasing, or maintaining the activity level of a particular element.

[0170] As used in this article, "polycistronic mRNA" is an mRNA that encodes two or more proteins.

[0171] As used herein, a “constitutive promoter” is a promoter that allows for the continuous transcription of one or more genes to which it is operatively linked. In all cases, constitutive promoters are active in the cell.

[0172] The term "fluorescent protein" refers to a polypeptide that emits fluorescence and can typically be detected by flow cytometry, microscopy, or any fluorescence imaging system, thus serving as a basis for selecting cells that express such proteins. Examples of fluorescent proteins that can be used as reporter proteins are, but are not limited to, green fluorescent protein (GFP), blue fluorescent protein (BFP), and red fluorescent proteins (e.g., dsRed, mCherry, RFP).

[0173] The term "reporter nucleic acid" refers to a nucleic acid containing a constitutive promoter operatively linked to a gene encoding a fluorescent protein and a target gene (or a portion of the target gene), wherein the fluorescent protein and the target gene are transcribed into polycistronic mRNA. A schematic diagram of a reporter nucleic acid according to some embodiments is shown in Figure 31B.

[0174] The term "expressed nucleic acid" refers to a nucleic acid containing a constitutive promoter operatively linked to a nucleic acid sequence encoding a repressive RNA. A schematic diagram of an expressed nucleic acid according to some embodiments is shown in Figure 31A.

[0175] As used in this article, the term “test repressor RNA pool” refers to two or more repressor RNAs that will be tested experimentally for their activity (i.e., their ability to suppress or silence target genes).

[0176] As used in this article, the term "transfection" refers to the introduction of nucleic acids into one or more eukaryotic cells.

[0177] As used in this article, "methods for detecting the inhibitory or silencing activity of one or more inhibitory RNAs on target genes" refers to methods for measuring or experimentally assessing the extent to which inhibitory RNAs inhibit or silence their target genes.

[0178] As used in this article, "a method for selecting repressor RNAs that show target gene silencing or inhibition from a pool of tested repressor RNAs" refers to a method for screening repressor RNAs based on their ability to silence or inhibit target gene expression and selecting repressor RNAs that show target gene silencing or inhibition.

[0179] Repressive RNA that is active in cells in an environment-specific manner

[0180] In this disclosure, "active" means that the repressor RNA is transcribed and processed (if desired) to give it the activity of repressing target gene expression. Typically, repression of the repressor RNA occurs via targeting RNA (usually mRNA) transcribed from the target gene, but other repressive mechanisms are also possible.

[0181] "Inactive" or "reduced activity" means that the repressor RNA is inactive or has low activity in the cell, making it unable to inhibit or less able to inhibit the expression of the target gene. The inactivation or reduced activity of the repressor RNA may be due to the loss or reduction of transcription of the repressor RNA in the cell, reduced processing of the repressor RNA into its active form, or both.

[0182] In some embodiments, the repressive RNA is adapted to be transcribed and / or processed in an environment-specific manner such that it has a repressive level of activity in a first environment (where the target gene needs to be repressed), wherein the repressive RNA significantly reduces the expression of the target gene. In at least a second environment (where the desired target gene is not to be repressed or where it is desired to reduce repression), the repressive RNA is transcribed and / or processed to have activity at a lower (preferably sub-repressive) level or is substantially inactive.

[0183] Therefore, in some embodiments, the present invention utilizes the environment-specific or cell-environment-specific activity of repressive RNA (via, for example, repressive RNA environment-specific transcription and / or post-transcriptional processing) to allow for environment-specific regulation of target gene expression. Various repressive RNAs that can be used in the present invention are discussed herein.

[0184] In some preferred embodiments, the regulation of target gene expression is cell-environment specific, wherein the environment-specific regulation of target gene expression occurs between a first environment (e.g., differentiated state) and a second environment (e.g., undifferentiated state) within a single cell. This cell-environment-specific regulation of target gene expression distinguishes it from differential regulation of target gene expression between different cells (e.g., between a first cell in a first tissue and a second cell in a second tissue). Suitably, the repressive RNA suitable for inhibiting target gene expression is active in the cell in a cell-environment-specific manner, such that inhibition of target gene expression in the cell occurs specifically in the first environment in which the repressive RNA is active in the cell. Optionally, in at least a second environment where the repressive RNA is inactive or has low activity, inhibition does not occur or occurs in a reduced amount in the cell.

[0185] The activity of endogenous repressive RNAs in cells varies depending on cell type and cellular environment (e.g., cell type, tissue type, developmental stage, differentiation state, stress, microenvironment, activation, etc.). In some embodiments, the present invention utilizes modified forms of one or more endogenous repressive RNAs that are active in an environment-specific or cell-environment-specific manner to regulate gene expression, for example, silencing or partially silencing one or more target genes in an environment where one or more endogenous repressive RNAs are active. Specifically, in some embodiments, the present invention employs modified forms of endogenous miRNAs that exhibit environment-specific activity (typically via environment-specific transcription and / or processing) to regulate (typically partially or completely silence) target genes.

[0186] In some embodiments of the invention, compared with control cells (e.g., cells without a construct for expressing repressive RNA), the expression of the target gene in the first environment is reduced by at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 95%, at least 97%, at least 98%, at least 99%, or 100%.

[0187] In some embodiments of the invention, the expression of the target gene is reduced by at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, or 100% in the first environment compared to at least the second environment.

[0188] In some embodiments of the invention, the GEiGS method is used to modify endogenous non-coding RNA coding sequences, such as endogenous repressor RNA coding sequences, wherein the repressor RNA exhibits environment-specific activity, so as to retarget the endogenous repressor RNA in an environment where the endogenous repressor RNA is active to silence or partially silence target genes. In some embodiments, the GEiGS method is used to modify two or more endogenous non-coding RNA coding sequences, such as two or more endogenous repressor RNA coding sequences, wherein the repressor RNA exhibits environment-specific activity, so as to retarget the endogenous repressor RNA in an environment where the endogenous repressor RNA is active to silence or partially silence one or more target genes.

[0189] In some embodiments of the invention, a modified form of a nucleic acid sequence encoding an endogenous repressor RNA is introduced into a cell, preferably into the cell's genome (however, it can be, for example, free), wherein the repressor RNA exhibits environment-specific activity to silence or partially silence a target gene in an environment where the endogenous repressor RNA is active. Therefore, in some embodiments, instead of retargeting the endogenous repressor RNA with environment-specific activity, a modified form of a nucleic acid sequence encoding the endogenous repressor RNA with environment-specific activity can be inserted into the cell, for example, into the cell's genome. Thus, in such embodiments, the original (“in situ”) endogenous repressor RNA can be unmodified. The modified form of the endogenous repressor RNA can be inserted into the cell's genome at any suitable locus for expression. In some embodiments, the modified form of the endogenous repressor RNA is provided in a synthetic expression cassette.

[0190] In some embodiments, two or more nucleic acid sequences encoding modified forms of two or more endogenous repressive RNAs are introduced into a cell, preferably into the cell's genome (however, it can be, for example, free), wherein the repressive RNAs exhibit environment-specific activity to silence or partially silence one or more target genes in an environment where at least one of the two or more endogenous repressive RNAs is active. In some embodiments, instead of retargeting endogenous repressive RNAs with environment-specific activity, two or more nucleic acid sequences encoding modified forms of endogenous repressive RNAs with environment-specific activity are inserted into the cell, for example, into the cell's genome. Therefore, in such embodiments, the original (“in situ”) endogenous repressive RNA may be unmodified. The modified form of the endogenous repressive RNA can be inserted into the cell's genome at any suitable locus for expression. In some embodiments, the modified forms of the two or more endogenous repressive RNAs are provided in two or more synthetic expression cassettes.

[0191] In some embodiments, a modified form of nucleic acid sequence encoding an endogenous repressor RNA with environment-specific activity may be inserted into an endogenous miRNA locus. Methods applicable to this invention are described, for example, by Senis et al. ('TALEN / CRISPR-mediated engineering of a promoterless anti-viral RNAi hairpin into an endogenous miRNA locus'. Nucleic Acids Research, 2017, Vol.45, No.1e3 doi:10.1093 / nar / gkw805). Therefore, in some embodiments of this invention, a promoterless sequence encoding repressor RNA may be inserted into an endogenous miRNA locus, preferably without disrupting or inactivating any endogenous miRNA.

[0192] Inhibit RNA

[0193] Non-coding RNA molecules can be modified to provide repressive RNAs as described herein. According to one embodiment, non-limiting examples of non-coding RNA molecules include, but are not limited to, microRNAs (miRNAs), piwi-interacting RNAs (piRNAs), short interfering RNAs (siRNAs), short hairpin RNAs (shRNAs), trans-acting siRNAs (tasiRNAs), small nuclear RNAs (snRNAs or URNAs), small nucleolar RNAs (snoRNAs), small Cahalosome RNAs (scaRNAs), transfer RNAs (tRNAs), ribosomal RNAs (rRNAs), extracellular RNAs (exRNAs), repetitive derived RNAs, transposable RNAs, and long non-coding RNAs (incRNAs). Non-coding RNAs can be modified to become repressive RNAs used in this invention.

[0194] The term "repressor RNA" refers to an RNA molecule that degrades or silences (e.g., partially or completely silences) its corresponding mRNA with a complementary sequence. In some embodiments of the invention, repressor RNA includes siRNA, shRNA, and microRNA, preferably microRNA. The term silent RNA (sRNA) is also used herein to refer to repressor RNA.

[0195] According to one implementation, non-limiting examples of RNA molecules that inhibit RNA include, but are not limited to, small interfering RNA (siRNA), short hairpin RNA (shRNA), microRNA (miRNA), Piwi-interacting RNA (piRNA), and trans-acting siRNA (tasiRNA).

[0196] According to some implementation schemes, inhibiting RNA molecules can induce RNA interference (RNAi), which can optionally be performed after cellular processing.

[0197] According to some implementation schemes, RNA molecules are inhibited from being processed from precursors.

[0198] According to some implementation schemes, non-coding RNA molecules or RNA silencing molecules are processed from single-stranded RNA (ssRNA) precursors.

[0199] According to some implementation schemes, non-coding RNA molecules or RNA silencing molecules are processed from single-stranded RNA precursors with a double-stranded structure.

[0200] According to some implementation schemes, non-coding RNA molecules or RNA silencing molecules are processed from dsRNA precursors (e.g., containing perfect and imperfect base pairings).

[0201] According to some implementation schemes, non-coding RNA molecules or RNA silencing molecules are processed from unstructured RNA precursors.

[0202] According to some implementation schemes, non-coding RNA molecules or RNA silencing molecules are processed from protein-coding RNA precursors.

[0203] According to some implementation schemes, non-coding RNA molecules or RNA silencing molecules are processed from non-coding RNA precursors.

[0204] According to some implementation schemes, dsRNA may originate from two different complementary RNAs, or from a single RNA that folds itself to form dsRNA.

[0205] In some embodiments, the repressor RNA or the nucleic acid sequence encoding the repressor RNA includes flanking sequences (5' and 3' sequences). In some preferred embodiments, the flanking sequences are approximately 40 bp in length. In some preferred embodiments, the flanking sequences are less than 100 bp, less than 90 bp, less than 80 bp, less than 70 bp, preferably less than 60 bp, less than 50 bp, more preferably less than 49 bp, less than 48 bp, less than 47 bp, less than 46 bp, less than 45 bp, less than 44 bp, less than 43 bp, less than 42 bp, or less than 41 bp in length. Figure 23 As shown, flanking genome sequences (homologous arms) of 40 base pairs in length exhibit higher silencing efficacy compared to flanking genome sequences of 350 bp or 150 bp-350 bp in length.

[0206] Perfect and imperfect base-paired RNAs (i.e., double-stranded RNA, dsRNA), siRNA, and shRNA—the presence of long dsRNA in cells stimulates the activity of a ribonuclease III enzyme called dicer. Dicer, also known as the endonuclease Dicer or a helicase with an RNase motif, is an enzyme encoded by the DICER 1 gene in the human body. Dicer is involved in processing dsRNA into short fragments of dsRNA called short interfering RNA (siRNA). siRNA derived from dicer activity is typically about 21 to 23 nucleotides in length and contains a 19-base-pair double strand with two 3' nucleotide overhangs.

[0207] Therefore, some embodiments of the present invention consider modifying the genomic sequence encoding dsRNA to redirect silencing specificity (including silencing activity) to the target RNA, thereby silencing or partially silencing the target gene.

[0208] According to one implementation scheme, a dsRNA precursor longer than 21 bp is used. Various studies have shown that long dsRNAs can be used to silence gene expression without inducing stress responses or causing significant off-target effects—see, for example, [Strat et al., Nucleic Acids Research, 2006, Vol.34, No.13 3803-3810; Bhargava A et al. Brain Res. Protoc. 2004; 13:115-125; Diallo M., et al., Oligonucleotides. 2003; 13:381-392; Paddison PJ, et al., Proc. Natl Acad. Sci. USA. 2002; 99:1443-1448; Tran N., et al., FEBS Lett. 2004; 573:127-134].

[0209] The term "siRNA" refers to a small repressive RNA duplex (typically between 18 and 30 base pairs) that induces RNA interference (RNAi) pathway. Typically, siRNA is chemically synthesized as a 21-mer with a central 19 bp duplex region and symmetrical 2-base 3' overhangs at the ends, although chemically synthesized 25-30 bp long RNA duplexes have recently been described to exhibit up to 100-fold increases in potency compared to the 21-mer at the same position. The increased potency observed with longer RNA in triggering RNAi is thought to be due to the provision of substrate (27-mer) to Dicer rather than the product (21-mer), and this increases the rate or efficiency of siRNA duplex entry into RISC.

[0210] It has been found that the position of the 3' overhang, rather than its composition, affects the efficacy of siRNA, and asymmetric duplexes with a 3' overhang on the antisense strand are generally more effective than asymmetric duplexes with a 3' overhang on the sense strand (Rose et al., 2005).

[0211] The strands of double-stranded interfering RNA (e.g., siRNA) can be linked to form hairpin or stem-loop structures (e.g., shRNA). Therefore, as mentioned, the repressive RNA in some embodiments of the present invention can also be short hairpin RNA (shRNA).

[0212] As used herein, the term short hairpin RNA “shRNA” refers to an RNA molecule having a stem-loop structure, comprising a first and second region of complementary sequences, the complementarity and orientation of which are sufficient to allow base pairing to occur between the regions, the first and second regions being connected by a loop region resulting from the lack of base pairing between nucleotides (or nucleotide analogs) within the loop region. The number of nucleotides in the loop is between 3 and 23, or 5 and 15, or 7 and 13, or 4 and 9, or 9 and 11, and includes numbers of these values. Some nucleotides in the loop may participate in base pair interactions with other nucleotides in the loop. Examples of oligonucleotide sequences that can be used to form the loop include 5'-CAAGAGA-3' and 5'-UUACAA-3' (International Patent Applications WO2013126963 and WO2014107763). Those skilled in the art will recognize that the resulting single-stranded oligonucleotides form a stem-loop or hairpin structure containing a double-stranded region capable of interacting with the RNAi mechanism.

[0213] The RNA-inhibiting molecules in some embodiments of the present invention are not limited to those containing only RNA, but also cover chemically modified nucleotides and non-nucleotides.

[0214] This invention considers various types of siRNA, including trans-acting siRNA (Ta-siRNA), repeat-associated siRNA (Ra-siRNA), and siRNA derived from natural antisense transcripts (Nat-siRNA).

[0215] According to one implementation, the repressive RNA includes “piRNA,” which is a class of Piwi-interacting RNAs with lengths of approximately 26 and 31 nucleotides. piRNAs typically form RNA-protein complexes by interacting with Piwi proteins; that is, antisense piRNAs are usually loaded into Piwi proteins (such as Piwi, Ago3, and Aubergine (Aub)).

[0216] miRNA—According to another commonly preferred embodiment, the repressor RNA molecule can be a miRNA. The terms “microRNA,” “miRNA,” and “miR” are synonymous and refer to a collection of non-coding single-stranded RNA molecules of approximately 19–28 nucleotides in length that regulate gene expression. miRNAs are present in a variety of organisms, including viruses, and have been shown to play roles in development, homeostasis, and disease etiology.

[0217] Initially, pre-miRNA exists as a long, imperfect double-stranded stem-loop RNA, which is further processed by Dicer into an siRNA-like double strand containing a mature guide strand (miRNA) and a similarly sized fragment called the transit strand (miRNA*). miRNA and miRNA* can be derived from the opposite arms of pri-miRNA and pre-miRNA. miRNA* sequences can be found in cloned miRNA libraries, but are generally less frequent than miRNA sequences.

[0218] Although initially existing as a double-stranded form of miRNA*, miRNAs eventually become single-stranded RNAs incorporated into a ribonucleoprotein complex called the RNA-induced silencing complex (RISC). Various proteins can form RISCs, leading to variability in the specificity of the miRNA / miRNA* duplex, the binding site of the target gene, the activity of the miRNA (repression or activation), and which strand of the miRNA / miRNA* duplex is loaded into the RISC. When the miRNA strand of the miRNA:miRNA* duplex is loaded into the RISC, the miRNA* is removed and degraded. The strand of the miRNA:miRNA* duplex loaded into the RISC is the strand with a less tight 5' pairing. When the miRNA:miRNA* has approximately equal 5' pairing at both ends, both the miRNA and miRNA* can possess gene silencing activity.

[0219] RISC is based on the high level of complementarity between miRNA and mRNA, specifically by identifying target nucleic acids through nucleotides 2-8 of the miRNA (called the "seed sequence").

[0220] Many studies have focused on the base pairing requirements between miRNAs and their mRNA targets to achieve efficient translational repression (reviewed in Bartel 2004, Cell 116-281). Computational studies analyzing miRNA binding across the entire genome have shown a specific role for bases 2-8 at the 5' of the miRNA (also known as the "seed sequence") in target binding, but the role of the first nucleotide (often identified as "A") has also been recognized (Lewis et al 2005, Cell 120-15). Similarly, nucleotides 1-7 or 2-8 are used to identify and validate targets, as in Krek et al. (2005, Nat Genet 37-495). Target sites in mRNA can be located in the 5' UTR, 3' UTR, or coding region. Interestingly, multiple miRNAs can regulate the same mRNA target by recognizing the same or multiple sites. The presence of multiple miRNA binding sites in most genetically identified targets may indicate that the synergistic action of multiple RISCs provides the most efficient translational repression.

[0221] miRNAs can direct RISC downregulation of gene expression through either of two mechanisms: mRNA cleavage or translational repression. If the mRNA and miRNA have a certain degree of complementarity, the miRNA can direct the cleavage of the mRNA. When miRNA directs cleavage, the cleavage typically occurs between nucleotides paired with residues 10 and 11 of the miRNA. Alternatively, if the miRNA and miRNA do not have the required degree of complementarity, the miRNA can repress translation. Translational repression may be more common in animals because the complementarity between the miRNA and its binding site may be lower in animals.

[0222] It should be noted that variability may exist at the 5' and 3' ends of any pair of miRNAs and miRNAs*. This variability may be due to variations in the cleavage sites during enzymatic processing of Drosha and Dicer. Variation at the 5' and 3' ends of miRNAs and miRNAs* may also be due to mismatches in the stem structures of pri-miRNAs and pre-miRNAs. Stem mismatches can lead to a large number of different hairpin structures. Variation in stem structures can also lead to variability in the cleavage products of Drosha and Dicer. It should be understood that pre-miRNA sequences may contain 45-90, 60-80, or 60-70 nucleotides, while pri-miRNA sequences may contain 45-30,000, 50-25,000, 100-20,000, 1,000-1,500, or 80-100 nucleotides.

[0223] As described above, some embodiments of the present invention provide methods for redirecting the silencing activity and / or specificity of an RNA molecule that inhibits silencing activity (or, if a non-coding RNA molecule does not have the intrinsic ability to silence RNA molecules, then silencing activity and / or specificity) to a target RNA of interest.

[0224] According to one embodiment, the target RNA is different from the original target RNA of the endogenous repressor RNA. According to various embodiments, the method of the present invention includes introducing a DNA editing agent into a eukaryotic cell that silences and / or specifically redirects the repressor RNA to the desired target RNA.

[0225] As used herein, the term "redirected silencing specificity" refers to the reprogramming of the original specificity of a non-coding RNA (typically a repressor RNA) toward a non-natural target of the non-coding RNA. Thus, the original specificity of the repressor RNA is disrupted (i.e., loss of function), and the new specificity targets an RNA target different from the natural target (i.e., the RNA of interest) (i.e., gain of function). It should be understood that gain of function only occurs if the original non-coding RNA does not possess silencing activity or if a construct for expressing the repressor RNA is introduced into the cell.

[0226] As used herein, the term "target RNA" refers to an RNA sequence to which repressor RNA molecules bind. Therefore, those skilled in the art will consider target RNA to be a substrate of repressor RNA.

[0227] The results of silencing can be confirmed by examining the external characteristics of eukaryotic cells or organisms or by biochemical techniques. It should be understood that the repressive RNA molecules in some embodiments of the present invention may have some off-target specific effects, provided that they do not inappropriately affect the intended growth, differentiation, or function of the cell or organism.

[0228] Previous silencing methods using shRNA or siRNA are known to have significant off-target effects (Rao DD, Senzer N, Cleary MA, Nemenaitis J. Cancer Gene Ther. 2009 Nov; 16(11):807-9. Doi:10.1038 / cgt.2009.53. Epub 2009 Aug 28. PMID:19713999). Advantageously, in some preferred embodiments, the repressive RNA or the nucleic acid sequence encoding the repressive RNA according to the invention does not have off-target effects. In some preferred embodiments, the repressive RNA or the nucleic acid sequence encoding the repressive RNA does not silence unintended targets (any targets other than those it is designed to target, such as B2M).

[0229] In some preferred embodiments, the repressor RNA may be a miRNA that does not have off-target effects. In some preferred embodiments, the repressor RNA may be a miRNA that does not silence unintended targets (any targets other than those it is designed to target, such as B2M).

[0230] In some preferred embodiments, the repressor RNA or the nucleic acid sequence encoding the repressor RNA does not exhibit a loss-of-function effect after redirection of the miRNA gene used as a scaffold.

[0231] According to one implementation scheme, the target RNA is endogenous to the cell, for example, derived from an endogenous gene. This article discusses various genes that express suitable target RNAs.

[0232] According to one embodiment, the target RNA, or target RNA of interest, is exogenous to the cell (also referred to herein as heterologous). In this case, the target RNA is the product of a gene that is not a natural part of the eukaryotic cell genome (i.e., it expresses non-coding RNA). Exemplary exogenous target RNAs include, but are not limited to, the products of genes associated with infectious diseases, such as those of pathogens (e.g., insects, viruses, bacteria, fungi, nematodes). The exogenous target RNA (coding or non-coding) may contain a nucleic acid sequence that shares sequence identity with the cell's or organism's endogenous RNA sequence (e.g., may be partially homologous to an endogenous nucleic acid sequence).

[0233] The specific binding of endogenous noncoding RNA molecules to target RNA can be determined by computational algorithms (such as BLAST) and verified by methods including, for example, RNA blotting, in situ hybridization, QuantiGene Plex assays.

[0234] The use of the terms "complementarity" or "complementary" refers to the regulation or inhibition of a target gene by hybridizing an inhibitory RNA molecule (or at least a portion thereof in its processed form, or at least one strand or a portion thereof of a double-stranded polynucleotide, or a portion thereof of a single-stranded polynucleotide) with a target RNA or a fragment thereof under physiological conditions. For example, in some embodiments, when the target RNA (or a family member of a given target gene) hybridizes with the target RNA (or a family member of a given target gene) at positions 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, the target RNA is used to regulate or inhibit the function of the target gene. When compared with sequences of 70, 80, 90, 100, 150, 200, 300, 400, 500 or more consecutive nucleotides, the repressor RNA molecule has 100% sequence identity or at least about 30%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% sequence identity.

[0235] As used herein, repressor RNA molecules, or their processed small RNA forms, are considered to exhibit “perfect complementarity” when each nucleotide of one of the sequences in reads 5' to 3' is complementary to each nucleotide of another sequence in reads 3' to 5'. A nucleotide sequence that is perfectly complementary to a reference nucleotide sequence will exhibit the same sequence as the inverse complementary sequence of the reference nucleotide sequence.

[0236] Methods for determining sequence complementarity are well known in the art, including but not limited to bioinformatics tools well known in the art (e.g., BLAST, multiple sequence alignment).

[0237] According to one implementation, if the repressive RNA molecule is siRNA or has been processed into siRNA, its complementarity with its target sequence is in the range of 90%-100% (e.g., 100%).

[0238] According to one implementation, if the repressor RNA molecule is a miRNA or piRNA or is processed into a miRNA or piRNA, its complementarity with its target sequence is in the range of 33%-100%.

[0239] According to one implementation, if the repressor RNA molecule is a miRNA, the complementarity of the seed sequence to its target sequence (i.e., nucleotides 2-8 from 5') is in the range of 85%-100% (e.g., 100%).

[0240] According to one implementation, the repressive RNA can be further processed into a small RNA form (e.g., processing pre-miRNA into mature miRNA). In this case, homology is measured based on the processed small RNA form (e.g., the mature miRNA sequence).

[0241] As used herein, the term "small RNA form" refers to a mature small RNA capable of hybridizing with a target RNA (or a fragment thereof). According to one implementation, the small RNA form has silencing activity.

[0242] According to one embodiment, the complementarity with the target sequence is at least about 33% (e.g., 33% of 21-24 nucleotides) in the form of the processed small RNA. Thus, for example, if the repressive RNA molecule is a miRNA, then 33% of the mature miRNA sequence (e.g., in 21 nucleotides) contains seed complementarity (e.g., 7 nucleotides in 21 nucleotides).

[0243] According to one embodiment, the complementarity with the target sequence is at least about 45% (e.g., 45% of 21-28 nucleotides) in the form of the processed small RNA. Thus, for example, if the repressive RNA molecule is a miRNA, then 45% of the mature miRNA sequence (e.g., in 21 nucleotides) contains seed complementarity (e.g., 9-10 nucleotides in 21 nucleotides).

[0244] According to one implementation, endogenous repressive RNA (i.e., prior to modification) is typically selected as a repressive RNA molecule having about 10%, 20%, 30%, 33%, 40%, 50%, 60%, 70%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or up to 99% complementarity to the sequence of the desired target RNA of interest.

[0245] According to specific embodiments, the repressor RNA molecule (i.e., before modification) is typically selected as a repressor RNA molecule having no more than 99% complementarity to the sequence of the target RNA of interest. According to specific embodiments, the target RNA molecule (i.e., before modification) is typically selected as a repressor RNA molecule having no more than 98% complementarity to the sequence of the target RNA of interest. According to specific embodiments, the repressor RNA molecule (i.e., before modification) is typically selected as a repressor RNA molecule having no more than 97% complementarity to the sequence of the target RNA of interest. According to specific embodiments, the repressor RNA molecule (i.e., before modification) is typically selected as a repressor RNA molecule having no more than 96% complementarity to the sequence of the target RNA of interest. According to specific embodiments, the repressor RNA molecule (i.e., before modification) is typically selected as a repressor RNA molecule having no more than 95% complementarity to the sequence of the target RNA of interest. According to specific embodiments, the repressor RNA molecule (i.e., before modification) is typically selected as a repressor RNA molecule having no more than 90% complementarity to the sequence of the target RNA of interest. According to specific implementation schemes, the repressor RNA molecule (i.e., before modification) is typically selected as a repressor RNA molecule having no more than 85% complementarity to the sequence of the target RNA of interest. According to specific implementation schemes, the repressor RNA molecule (i.e., before modification) is typically selected as a repressor RNA molecule having no more than 50% complementarity to the sequence of the target RNA of interest. According to specific implementation schemes, the RNA molecule (i.e., before modification) is typically selected as a repressor RNA molecule having no more than 33% complementarity to the sequence of the target RNA of interest.

[0246] According to one implementation, repressive RNA molecules are designed to contain at least about 33%, 40%, 45%, 50%, 60%, 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or even 100% complementarity with the target RNA sequence of interest.

[0247] Depending on the specific implementation plan, the repressive RNA molecule is designed to contain at least 33% complementarity with the target RNA of interest (e.g., 85%–100% seed match).

[0248] Depending on the specific implementation, the repressive RNA molecule (e.g., the RNA silencing molecule) is designed to contain at least 40%, 45%, 50%, 60%, 70%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% complementarity with the target RNA of interest. Higher levels of complementarity are generally preferred when a higher level of repression / silencing is preferred.

[0249] In order to generate silencing activity and / or specificity of repressive RNA molecules or to redirect the silencing activity and / or specificity of repressive RNA molecules to target RNA, it is preferable to use a DNA editing agent to modify the sequence of endogenous non-coding RNA molecules (e.g., repressive RNA).

[0250] According to one embodiment, the inhibitory RNA comprises a modified form of a miRNA selected from the group consisting of: hsa-mir-191, hsa-mir-302a, hsa-mir-302c, hsa-mir-93, hsa-mir-106a, hsa-mir-106b, hsa-mir-20a, hsa-mir-363, hsa-mir-518b, hsa-mir-744, hsa-mir-99b, hsa-mir-320a, hsa-mir-520f, hsa-mir-652, hsa-mir-1180, hsa-mir-15b, hsa-mir-23a, hsa-mir-26b, hsa-mir-335, hsa-mir-361, hsa-mir-1307, hsa-mir-205, hsa-mir-221, hsa-mir-222, hsa-mir-30e, hsa-mir-423, hsa-mir-519c, hsa-mir-92b, hsa-mir-30, hsa-mir-302b, hsa-let-7b, hsa-mir-98, hsa-let-7g, hsa-mir-126, hsa-mir-17, hsa-mir-378a, hsa-mir-671, hsa-mir-155, hsa-mir-20b, hsa-mir-34c, hsa-mir-146a, hsa-mir-29a, hsa-mir-342, hsa-miR-375, hsa-miR-143, hsa-miR-21, hsa-miR-30d, hsa-miR-192, hsa-miR-30a, hsa-miR-182, hsa-miR-148a, hsa-miR-127, hsa-miR-200c, hsa-miR-143, hsa-miR-10a, hsa-miR-122, hsa-miR-22, hsa-miR-192, hsa-miR-146b, hsa-miR-26a, hsa-miR-125a, hsa-miR-150, hsa-miR-10b, hsa-miR-181a, hsa-miR-26a, hsa-miR-92a, hsa-miR-143, hsa-miR-10a, hsa-miR-21, MIR146A (hsa-miR-146a-5p), MIR20A (hsa-miR-20a-5p), LET7C (hsa-miR-let-7c-5p), LET7i (hsa-let-7i-5p), miR-375, miR-340-5p, miR-29a-3p,miR-222-3p, miR-940, miR-203, miR-145, miR-103a, miR-21-3p, miR-181-5p, miR-125b-5p, miR-301a-3p, miR-132, miR-29b-1, miR-27a, miR-146a, miR-2 22, miR-let7a, miR-320a, miR-146a, miR-let7c, miR-1246, miR-let7d-5p, miR-451, miR-21, miR-23a, miR-27a, miR-24-2, miR-155, miR125b-2, and miR-16.

[0251] According to one embodiment, the inhibitory RNA comprises a modified form of a miRNA selected from the group consisting of: hsa-miR-375, hsa-miR-143, hsa-miR-21, hsa-miR-30d, hsa-miR-192, hsa-miR-30a, hsa-miR-182, hsa-miR-148a, hsa-miR-127, hsa-miR-200c, hsa-miR-143, hsa-miR-10a, hsa-miR-122, hsa-miR-22, hsa-miR-192, hsa-miR-146b, hsa-miR-26a, hsa-miR-125a, hsa-miR-150, hsa-miR-10b, hsa-miR-181a, hsa-miR-26a, hsa-miR-92a, hsa-miR-143, hsa-miR-10a, hsa-miR-21, MIR146A (hsa-miR-146a-5p), MIR20A (hsa-miR-20a-5p), LET7C (hsa-miR-let-7c-5p), LET7i (hsa-let-7i-5p), miR-375, miR-340-5p, miR-29a-3p, miR-222-3p, miR-940, miR-203, miR-145, miR-103a, miR-21-3p, miR-181-5p, miR-125b-5p, miR-301a-3p, miR-132, miR-29b-1, miR-27a, miR-146a, miR-222, miR-let7a, miR-320a, miR-146a, miR-let7c, miR-1246, miR-let7d-5p, miR-451, miR-21, miR-23a, miR-27a, miR-24-2, miR-155, miR125b-2 and miR-16.

[0252] According to one implementation scheme, the repressor RNA comprises a modified form of miRNA selected from the group consisting of: hsa-mir-191, hsa-mir-302a, hsa-mir-302c, hsa-mir-93, hsa-mir-106a, hsa-mir-106b, hsa-mir-200c, hsa-mir-20a, hsa-mir-21, hsa-mir-363, hsa-mir-518b, hs a-mir-744, hsa-mir-99b, hsa-mir-320a, hsa-mir-520f, hsa-mir-652, hsa-mir-1180, hsa-mir-15b, hsa-mir-182, hsa-mir-23a, hsa-mir-26b, hsa-mir-335, hsa-mir-361, hsa-mir-1307, hsa-mir-205, hsa-mir-22, hsa-mir-221, hsa-mir-222, hsa-mir-30e, hsa-mir-423, hsa-mir-519c, hsa-mir-92b, hsa-mir-30, hsa-mir-302b, hsa-mir-375, hsa-let-7b, and hsa-mir-98, according to one embodiment, repressive RNA comprising miRNAs selected from the group consisting of... Decoration forms: hsa-let-7g, hsa-mir-126, hsa-mir-150, hsa-mir-17, hsa-mir-191, hsa-mir-30d, hsa-mir-30e , hsa-mir-363, hsa-mir-93, hsa-mir-378a, hsa-mir-671, hsa-mir-155, hsa-mir-20b and hsa-mir-34c. According to one implementation, the repressor RNA comprises a modified form of miRNA selected from the group consisting of: hsa-mir-146a, hsa-mir-29a, hsa-mir-342, hsa-mir-363, hsa-mir-126, hsa-mir-146b, hsa-mir-30d, hsa-mir-20b, hsa-mir-378a, hsa-let-7g, hsa-mir-30e, hsa-mir-671, hsa-mir-17, hsa-mir-20a, hsa-mir-93, hsa-mir-34c, hsa-let-7b, and hsa-mir-155.

[0253] The following section discusses other miRNAs of interest and preferred environments for using these miRNAs. The sequences of these miRNAs can be found in miRbase (…). https: / / www.mirbase.org / ) was found.

[0254] According to one embodiment, the repressor RNA comprises a sequence selected from SEQ ID NO:1 to SEQ ID NO:17 or from SEQ ID NO:18 to SEQ ID NO:34. These sequences correspond to miRNAs (mature sRNAs and pre-miRNA hairpin forms) that target B2M. In some preferred embodiments, the repressor RNA comprises SEQ ID NO:1 or 18 (silencing element 8), SEQ ID NO:5 or 22 (silencing element 20), SEQ ID NO:9 or 26 (silencing element 29), or SEQ ID NO:10 or 27 (silencing element 30). In some embodiments, the repressor RNA does not comprise a sequence selected from SEQ ID NO:1 to SEQ ID NO:17 or from SEQ ID NO:18 to SEQ ID NO:34.

[0255] According to one embodiment, the repressor RNA comprises a sequence selected from SEQ ID NO:66 to SEQ ID NO:87 or SEQ ID NO:88 to SEQ ID NO:109. These sequences correspond to miRNAs (mature sRNA and pre-miRNA hairpin forms) that target PPARG.

[0256] According to one embodiment, the repressor RNA comprises a sequence selected from SEQ ID NO:110 to SEQ ID NO:133 or SEQ ID NO:134 to SEQ ID NO:157. These sequences correspond to miRNAs (mature sRNA and pre-miRNA hairpin forms) that target IRF4. Silencing element 219 (SEQ ID NO:127 and SEQ ID NO:151) is a particularly preferred repressor RNA that targets IRF4.

[0257] According to one embodiment, the repressor RNA comprises a sequence selected from SEQ ID NO:158 to SEQ ID NO:181 or SEQ ID NO:182 to SEQ ID NO:205. These sequences correspond to miRNAs (mature sRNA and pre-miRNA hairpin forms) that target KDM6B. Silencing element 245 (SEQ ID NO:177 and SEQ ID NO:201) is a particularly preferred repressor RNA targeting KDM6B.

[0258] According to one embodiment, the repressor RNA comprises a sequence selected from SEQ ID NO:206 to SEQ ID NO:229 or SEQ ID NO:230 to SEQ ID NO:253. These sequences correspond to miRNAs (mature sRNA and pre-miRNA hairpin forms) that target STAT6. Silencing elements 260 (SEQ ID NO:216 and SEQ ID NO:240) and silencing elements 266 (SEQ ID NO:222 and SEQ ID NO:246) are particularly preferred repressor RNAs that target STAT6.

[0259] According to one embodiment, the repressor RNA comprises a sequence selected from SEQ ID NO:348 to SEQ ID NO:411 or SEQ ID NO:412 to SEQ ID NO:475. These sequences correspond to miRNAs (mature sRNAs and pre-miRNA hairpin forms) that target B2M. In some embodiments, the repressor RNA does not comprise a sequence selected from SEQ ID NO:348 to SEQ ID NO:411 or SEQ ID NO:412 to SEQ ID NO:475.

[0260] According to one embodiment, the repressive RNA comprises a sequence selected from SEQ ID NO:476 to SEQ ID NO:525 or SEQ ID NO:526 to SEQ ID NO:575. These sequences correspond to miRNAs (mature sRNA and pre-miRNA hairpin forms) that target FOXP3.

[0261] According to one embodiment, the repressor RNA comprises a sequence selected from SEQ ID NO:576 to SEQ ID NO:624 or SEQ ID NO:625 to SEQ ID NO:673. These sequences correspond to miRNAs (mature sRNA and pre-miRNA hairpin forms) that target PDCD-1.

[0262] In some embodiments, the repressor RNA is encoded by a nucleic acid sequence encoding the repressor RNA. In some embodiments, the nucleic acid sequence encoding the repressor RNA comprises a sequence selected from SEQ ID NO:254-347.

[0263] In some embodiments, the nucleic acid sequence encoding the repressor RNA includes an HDR template sequence. In some embodiments, the HDR template sequence is selected from SEQ ID NO:674-679, 59, 61, 63, and 65.

[0264] Two or more repressive RNAs suitable for inhibiting the expression of one or more target genes

[0265] A method according to a first aspect of the invention may include providing a cell having a nucleic acid construct adapted to express two or more repressive RNAs adapted to inhibit the expression of a target gene, or adapted to inhibit the expression of two or more target genes. Cells according to a second or third embodiment of the invention may be provided having or containing a nucleic acid construct adapted to express two or more repressive RNAs adapted to inhibit the expression of a target gene, or adapted to inhibit the expression of two or more target genes.

[0266] In some embodiments of the first, second, or third aspect of the invention, the cell is provided with two or more nucleic acid constructs adapted to express repressive RNAs adapted to inhibit the expression of one or more target genes. In some embodiments of the first, second, or third aspect of the invention, a single nucleic acid construct is adapted to express two or more repressive RNAs adapted to inhibit the expression of one or more target genes. Suitably, the inhibition of expression is carried out in a cell environment-specific or environment-specific manner.

[0267] In some embodiments, the method suitably includes providing a cell with one or more nucleic acid constructs adapted to express two or more repressor RNAs adapted to inhibit the expression of a target gene (i.e., two or more repressor RNAs having the same target). In some embodiments, the cell is provided with, or the cell contains, one or more nucleic acid constructs adapted to express two or more repressor RNAs adapted to inhibit the expression of a target gene (i.e., two or more repressor RNAs having the same target).

[0268] In some embodiments, the method suitably includes providing a nucleic acid construct to a cell adapted to express two or more repressive RNAs adapted to inhibit the expression of a target gene (i.e., two or more repressive RNAs having the same target). In some embodiments, the cell is provided with or contains a nucleic acid construct adapted to express two or more repressive RNAs adapted to inhibit the expression of a target gene (i.e., two or more repressive RNAs having the same target). In some preferred embodiments, the cell is a pancreatic cell. In some preferred embodiments, the cell is a T cell. In some preferred embodiments, the cell is a macrophage. In some embodiments, the target gene is selected from: B2M, PPARG, IRF4, KDM6B, FOXP3, PDCD-1, and STAT6. In some preferred embodiments, the target gene is B2M.

[0269] In some embodiments, the two or more repressive RNAs are selected from SEQ ID NO:1 or 18 (silencing element 8), SEQ ID NO:5 or 22 (silencing element 20), SEQ ID NO:9 or 26 (silencing element 29), SEQ ID NO:10 or 27 (silencing element 30), SEQ ID NO:348 to SEQ ID NO:411 or SEQ ID NO:412 to SEQ ID NO:475 (targeting B2M). In some embodiments, the two or more repressive RNAs are selected from SEQ ID NO:66 to SEQ ID NO:87 or SEQ ID NO:88 to SEQ ID NO:109 (targeting PPARG). In some embodiments, the two or more repressive RNAs are selected from SEQ ID NO:110 to SEQ ID NO:133 or SEQ ID NO:134 to SEQ ID NO:157 (targeting IRF4). In some embodiments, the two or more repressive RNAs are selected from SEQ ID NO:158 to SEQ ID NO:181 or SEQ ID NO:182 to SEQ ID NO:205 (targeting KDM6B). In some embodiments, the two or more repressive RNAs are selected from SEQ ID NO:476 to SEQ ID NO:525 or SEQ ID NO:526 to SEQ ID NO:575 (targeting FOXP3). In some embodiments, the two or more repressive RNAs are selected from SEQ ID NO:576 to SEQ ID NO:624 or SEQ ID NO:625 to SEQ ID NO:673 (targeting PDCD-1). In some embodiments, the two or more repressive RNAs are selected from SEQ ID NO:206 to SEQ ID NO:229 or SEQ ID NO:230 to SEQ ID NO:253 (targeting STAT6).

[0270] In some embodiments, the method suitably includes providing cells with one or more nucleic acid constructs adapted to express two or more repressive RNAs adapted to suppress the expression of two or more target genes (i.e., two or more repressive RNAs with different targets).

[0271] In some implementations, the cell is provided with or contains one or more nucleic acid constructs adapted to express two or more repressive RNAs adapted to suppress the expression of two or more target genes (i.e., two or more repressive RNAs with different targets).

[0272] In some embodiments, the method suitably includes providing a cell with a nucleic acid construct adapted to express two or more repressive RNAs adapted to inhibit the expression of two or more target genes (i.e., two or more repressive RNAs with different targets). In some embodiments, the cell is provided with or the cell contains a nucleic acid construct adapted to express two or more repressive RNAs adapted to inhibit the expression of two or more target genes (i.e., two or more repressive RNAs with different targets). In some preferred embodiments, the cell is a pancreatic cell. In some preferred embodiments, the cell is a T cell. In some preferred embodiments, the cell is a macrophage. In some embodiments, at least one of the two or more repressive RNAs is selected from SEQ ID NO:1 or 18 (silencing element 8), SEQ ID NO:5 or 22 (silencing element 20), SEQ ID NO:9 or 26 (silencing element 29), SEQ ID NO:10 or 27 (silencing element 30), SEQ ID NO:348 to SEQ ID NO:411 or SEQ ID NO:412 to SEQ ID NO:475 (targeting B2M). In some embodiments, at least one of the two or more repressive RNAs is selected from SEQ ID NO:66 to SEQ ID NO:87 or SEQ ID NO:88 to SEQ ID NO:109 (targeting PPARG). In some embodiments, at least one of the two or more repressive RNAs is selected from SEQ ID NO:110 to SEQ ID NO:133 or SEQ ID NO:134 to SEQ ID NO:157 (targeting IRF4). In some embodiments, at least one of the two or more repressive RNAs is selected from SEQ ID NO:158 to SEQ ID NO:181 or SEQ ID NO:182 to SEQ ID NO:205 (targeting KDM6B). In some embodiments, at least one of the two or more repressive RNAs is selected from SEQ ID NO:476 to SEQ ID NO:525 or SEQ ID NO:526 to SEQ ID NO:575 (targeting FOXP3). In some embodiments, at least one of the two or more repressive RNAs is selected from SEQ ID NO:576 to SEQ ID NO:624 or SEQ ID NO:625 to SEQ ID NO:673 (targeting PDCD-1). In some embodiments, at least one of the two or more repressive RNAs is selected from SEQ ID NO:206 to SEQ ID NO:229 or SEQ ID NO:230 to SEQ ID NO:253 (targeting STAT6).

[0273] In some embodiments, the method suitably includes providing a cell with a nucleic acid construct adapted to express two or more repressive RNAs adapted to inhibit the expression of two or more target genes (i.e., two or more repressive RNAs with different targets). In some embodiments, the cell is provided with or the cell contains a nucleic acid construct adapted to express two or more repressive RNAs adapted to inhibit the expression of two or more target genes (i.e., two or more repressive RNAs with different targets).

[0274] In some preferred embodiments, the cell is a pancreatic cell. In some preferred embodiments, the cell is a T cell. In some preferred embodiments, the cell is a macrophage. In some embodiments, the two or more target genes are selected from: B2M, PPARG, IRF4, KDM6B, FOXP3, PDCD-1, STAT6. In some embodiments, one of the target genes is B2M, and the other target gene is selected from: STAT6, IRF4, DRP1, PPARG, KDM6B, Clever-1 (also known as STAB1 or FEEL-1), LAIR1 / 2, P-selective glycoprotein ligand (PSGL-1), signal regulatory protein α (SIRPa), trigger receptor 2 (TREM2) expressed on myeloid cells, proton-sensing GPCR (GPR65), inhibitory leukocyte immunoglobulin-like receptor subfamily B4 (LILRB4), RASA-2, CTLA4, and PD-1 (PDCD-1).

[0275] In some embodiments, one of the target genes is B2M, and the other target gene is selected from: PPARG, IRF4, KDM6B, FOXP3, PDCD-1, and STAT6. In some embodiments, the two or more repressive RNAs are selected from:

[0276] -SEQ ID NO:1 or 18 (silent element 8), SEQ ID NO:5 or 22 (silent element 20), SEQ ID NO:

[0277] 9 or 26 (silencing element 29), SEQ ID NO: 10 or 27 (silencing element 30), SEQ ID NO: 348 to SEQ ID NO: 411 or SEQ ID NO: 412 to SEQ ID NO: 475 (targeting B2M);

[0278] -SEQ ID NO:66 to SEQ ID NO:87 or SEQ ID NO:88 to SEQ ID NO:109 (targeting PPARG);

[0279] -SEQ ID NO:110 to SEQ ID NO:133 or SEQ ID NO:134 to SEQ ID NO:157 (targeting IRF4);

[0280] -SEQ ID NO:158 to SEQ ID NO:181 or SEQ ID NO:182 to SEQ ID NO:205 (targeting KDM6B);

[0281] -SEQ ID NO:476 to SEQ ID NO:525 or SEQ ID NO:526 to SEQ ID NO:575 (targeting FOXP3);

[0282] -SEQ ID NO:576 to SEQ ID NO:624 or SEQ ID NO:625 to SEQ ID NO:673 (targeting PDCD-1); or

[0283] -SEQ ID NO:206 to SEQ ID NO:229 or SEQ ID NO:230 to SEQ ID NO:253 (targeting STAT6).

[0284] In some implementations, one of the two or more repressive RNAs is selected from:

[0285] SEQ ID NO:1 or 18 (silencing element 8), SEQ ID NO:5 or 22 (silencing element 20), SEQ ID NO:9 or 26 (silencing element 29), SEQ ID NO:10 or 27 (silencing element 30), SEQ ID NO:348 to SEQ ID NO:411 or SEQ ID NO:412 to SEQ ID NO:475 (targeting B2M).

[0286] In some embodiments, one of the two or more repressive RNAs is selected from SEQ ID NO:1 or 18 (silencing element 8), SEQ ID NO:5 or 22 (silencing element 20), SEQ ID NO:9 or 26 (silencing element 29), SEQ ID NO:10 or 27 (silencing element 30), SEQ ID NO:348 to SEQ ID NO:411 or SEQ ID NO:412 to SEQ ID NO:475 (targeting B2M), and another of the two or more repressive RNAs is adapted to inhibit the expression of target genes selected from PPARG, IRF4, KDM6B, FOXP3, PDCD-1 and STAT6.

[0287] In some embodiments, one of the two or more repressive RNAs is selected from SEQ ID NO:1 or 18 (silencing element 8), SEQ ID NO:5 or 22 (silencing element 20), SEQ ID NO:9 or 26 (silencing element 29), SEQ ID NO:10 or 27 (silencing element 30), SEQ ID NO:348 to SEQ ID NO:411 or SEQ ID NO:412 to SEQ ID NO:475 (targeting B2M), and the other of the two or more repressive RNAs is selected from:

[0288] -SEQ ID NO:66 to SEQ ID NO:87 or SEQ ID NO:88 to SEQ ID NO:109 (targeting PPARG);

[0289] -SEQ ID NO:110 to SEQ ID NO:133 or SEQ ID NO:134 to SEQ ID NO:157 (targeting IRF4);

[0290] -SEQ ID NO:158 to SEQ ID NO:181 or SEQ ID NO:182 to SEQ ID NO:205 (targeting KDM6B);

[0291] -SEQ ID NO:476 to SEQ ID NO:525 or SEQ ID NO:526 to SEQ ID NO:575 (targeting FOXP3);

[0292] -SEQ ID NO:576 to SEQ ID NO:624 or SEQ ID NO:625 to SEQ ID NO:673 (targeting PDCD-1); or

[0293] -SEQ ID NO:206 to SEQ ID NO:229 or SEQ ID NO:230 to SEQ ID NO:253 (targeting STAT6).

[0294] In some embodiments, one of the two or more repressive RNAs is adapted to inhibit the expression of the target gene B2M, and another of the two or more repressive RNAs is adapted to inhibit the expression of the target gene PPARG. In some embodiments, one of the two or more repressive RNAs inhibits the expression of the target gene B2M, and another of the two or more repressive RNAs inhibits the expression of the target gene PPARG. In some embodiments, one of the two or more repressive RNAs is selected from SEQ ID NO:1 or 18 (silencing element 8), SEQ ID NO:5 or 22 (silencing element 20), SEQ ID NO:9 or 26 (silencing element 29), SEQ ID NO:10 or 27 (silencing element 30), SEQ ID NO:348 to SEQ ID NO:411 or SEQ ID NO:412 to SEQ ID NO:475 (targeting B2M), and another of the two or more repressive RNAs is adapted to inhibit the expression of the target gene PPARG. In some embodiments, one of the two or more repressive RNAs is selected from SEQ ID NO:1 or 18 (silencing element 8), SEQ ID NO:5 or 22 (silencing element 20), SEQ ID NO:9 or 26 (silencing element 29), SEQ ID NO:10 or 27 (silencing element 30), SEQ ID NO:348 to SEQ ID NO:411 or SEQ ID NO:412 to SEQ ID NO:475 (targeting B2M), and the other of the two or more repressive RNAs represses the expression of the target gene PPARG. In some embodiments, one of the two or more repressive RNAs is selected from SEQ ID NO:1 or 18 (silencing element 8), SEQ ID NO:5 or 22 (silencing element 20), SEQ ID NO:9 or 26 (silencing element 29), SEQ ID NO:10 or 27 (silencing element 30), SEQ ID NO:348 to SEQ ID NO:411 or SEQ ID NO:412 to SEQ ID NO:475 (targeting B2M), and the other of the two or more repressive RNAs is selected from SEQ ID NO:66 to SEQ ID NO:87 or SEQ ID NO:88 to SEQ ID NO:109 (targeting PPARG).

[0295] In some embodiments, one of the two or more repressive RNAs is adapted to inhibit the expression of the target gene B2M, and another of the two or more repressive RNAs is adapted to inhibit the expression of the target gene IRF4. In some embodiments, one of the two or more repressive RNAs inhibits the expression of the target gene B2M, and another of the two or more repressive RNAs inhibits the expression of the target gene IRF4. In some embodiments, one of the two or more repressive RNAs is selected from SEQ ID NO:1 or 18 (silencing element 8), SEQ ID NO:5 or 22 (silencing element 20), SEQ ID NO:9 or 26 (silencing element 29), SEQ ID NO:10 or 27 (silencing element 30), SEQ ID NO:348 to SEQ ID NO:411 or SEQ ID NO:412 to SEQ ID NO:475 (targeting B2M), and another of the two or more repressive RNAs is adapted to inhibit the expression of the target gene IRF4. In some embodiments, one of the two or more repressive RNAs is selected from SEQ ID NO:1 or 18 (silencing element 8), SEQ ID NO:5 or 22 (silencing element 20), SEQ ID NO:9 or 26 (silencing element 29), SEQ ID NO:10 or 27 (silencing element 30), SEQ ID NO:348 to SEQ ID NO:411 or SEQ ID NO:412 to SEQ ID NO:475 (targeting B2M), and the other of the two or more repressive RNAs represses the expression of the target gene IRF4. In some embodiments, one of the two or more repressive RNAs is selected from SEQ ID NO:1 or 18 (silencing element 8), SEQ ID NO:5 or 22 (silencing element 20), SEQ ID NO:9 or 26 (silencing element 29), SEQ ID NO:10 or 27 (silencing element 30), SEQ ID NO:348 to SEQ ID NO:411 or SEQ ID NO:412 to SEQ ID NO:475 (targeting B2M), and the other of the two or more repressive RNAs is selected from SEQ ID NO:110 to SEQ ID NO:133 or SEQ ID NO:134 to SEQ ID NO:157 (targeting IRF4).

[0296] In some embodiments, one of the two or more repressive RNAs is adapted to inhibit the expression of the target gene B2M, and another of the two or more repressive RNAs is adapted to inhibit the expression of the target gene KDM6B. In some embodiments, one of the two or more repressive RNAs inhibits the expression of the target gene B2M, and another of the two or more repressive RNAs inhibits the expression of the target gene KDM6B. In some embodiments, one of the two or more repressive RNAs is selected from SEQ ID NO:1 or 18 (silencing element 8), SEQ ID NO:5 or 22 (silencing element 20), SEQ ID NO:9 or 26 (silencing element 29), SEQ ID NO:10 or 27 (silencing element 30), SEQ ID NO:348 to SEQ ID NO:411 or SEQ ID NO:412 to SEQ ID NO:475 (targeting B2M), and another of the two or more repressive RNAs is adapted to inhibit the expression of the target gene KDM6B. In some embodiments, one of the two or more repressive RNAs is selected from SEQ ID NO:1 or 18 (silencing element 8), SEQ ID NO:5 or 22 (silencing element 20), SEQ ID NO:9 or 26 (silencing element 29), SEQ ID NO:10 or 27 (silencing element 30), SEQ ID NO:348 to SEQ ID NO:411 or SEQ ID NO:412 to SEQ ID NO:475 (targeting B2M), and the other of the two or more repressive RNAs represses the expression of the target gene KDM6B. In some embodiments, one of the two or more repressive RNAs is selected from SEQ ID NO:1 or 18 (silencing element 8), SEQ ID NO:5 or 22 (silencing element 20), SEQ ID NO:9 or 26 (silencing element 29), SEQ ID NO:10 or 27 (silencing element 30), SEQ ID NO:348 to SEQ ID NO:411 or SEQ ID NO:412 to SEQ ID NO:475 (targeting B2M), and the other of the two or more repressive RNAs is selected from SEQ ID NO:158 to SEQ ID NO:181 or SEQ ID NO:182 to SEQ ID NO:205 (targeting KDM6B).

[0297] In some embodiments, one of the two or more repressive RNAs is adapted to inhibit the expression of the target gene B2M, and another of the two or more repressive RNAs is adapted to inhibit the expression of the target gene FOXP3. In some embodiments, one of the two or more repressive RNAs inhibits the expression of the target gene B2M, and another of the two or more repressive RNAs inhibits the expression of the target gene FOXP3. In some embodiments, one of the two or more repressive RNAs is selected from SEQ ID NO:1 or 18 (silencing element 8), SEQ ID NO:5 or 22 (silencing element 20), SEQ ID NO:9 or 26 (silencing element 29), SEQ ID NO:10 or 27 (silencing element 30), SEQ ID NO:348 to SEQ ID NO:411 or SEQ ID NO:412 to SEQ ID NO:475 (targeting B2M), and another of the two or more repressive RNAs is adapted to inhibit the expression of the target gene FOXP3. In some embodiments, one of the two or more repressive RNAs is selected from SEQ ID NO:1 or 18 (silencing element 8), SEQ ID NO:5 or 22 (silencing element 20), SEQ ID NO:9 or 26 (silencing element 29), SEQ ID NO:10 or 27 (silencing element 30), SEQ ID NO:348 to SEQ ID NO:411 or SEQ ID NO:412 to SEQ ID NO:475 (targeting B2M), and the other of the two or more repressive RNAs represses the expression of the target gene FOXP3. In some embodiments, one of the two or more repressive RNAs is selected from SEQ ID NO:1 or 18 (silencing element 8), SEQ ID NO:5 or 22 (silencing element 20), SEQ ID NO:9 or 26 (silencing element 29), SEQ ID NO:10 or 27 (silencing element 30), SEQ ID NO:348 to SEQ ID NO:411 or SEQ ID NO:412 to SEQ ID NO:475 (targeting B2M), and the other of the two or more repressive RNAs is selected from SEQ ID NO:476 to SEQ ID NO:525 or SEQ ID NO:526 to SEQ ID NO:575 (targeting FOXP3).

[0298] In some embodiments, one of the two or more repressive RNAs is adapted to inhibit the expression of the target gene B2M, and another of the two or more repressive RNAs is adapted to inhibit the expression of the target gene PDCD-1. In some embodiments, one of the two or more repressive RNAs inhibits the expression of the target gene B2M, and another of the two or more repressive RNAs inhibits the expression of the target gene PDCD-1. In some embodiments, one of the two or more repressive RNAs is selected from SEQ ID NO:1 or 18 (silencing element 8), SEQ ID NO:5 or 22 (silencing element 20), SEQ ID NO:9 or 26 (silencing element 29), SEQ ID NO:10 or 27 (silencing element 30), SEQ ID NO:348 to SEQ ID NO:411 or SEQ ID NO:412 to SEQ ID NO:475 (targeting B2M), and another of the two or more repressive RNAs is adapted to inhibit the expression of the target gene PDCD-1. In some embodiments, one of the two or more repressive RNAs is selected from SEQ ID NO:1 or 18 (silencing element 8), SEQ ID NO:5 or 22 (silencing element 20), SEQ ID NO:9 or 26 (silencing element 29), SEQ ID NO:10 or 27 (silencing element 30), SEQ ID NO:348 to SEQ ID NO:411 or SEQ ID NO:412 to SEQ ID NO:475 (targeting B2M), and the other of the two or more repressive RNAs represses the expression of the target gene PDCD-1. In some embodiments, one of the two or more repressive RNAs is selected from SEQ ID NO:1 or 18 (silencing element 8), SEQ ID NO:5 or 22 (silencing element 20), SEQ ID NO:9 or 26 (silencing element 29), SEQ ID NO:10 or 27 (silencing element 30), SEQ ID NO:348 to SEQ ID NO:411 or SEQ ID NO:412 to SEQ ID NO:475 (targeting B2M), and the other of the two or more repressive RNAs is selected from SEQ ID NO:576 to SEQ ID NO:624 or SEQ ID NO:625 to SEQ ID NO:673 (targeting PDCD-1).

[0299] In some embodiments, one of the two or more repressive RNAs is adapted to inhibit the expression of the target gene B2M, and another of the two or more repressive RNAs is adapted to inhibit the expression of the target gene STAT6. In some embodiments, one of the two or more repressive RNAs inhibits the expression of the target gene B2M, and another of the two or more repressive RNAs inhibits the expression of the target gene STAT6. In some embodiments, one of the two or more repressive RNAs is selected from SEQ ID NO:1 or 18 (silencing element 8), SEQ ID NO:5 or 22 (silencing element 20), SEQ ID NO:9 or 26 (silencing element 29), SEQ ID NO:10 or 27 (silencing element 30), SEQ ID NO:348 to SEQ ID NO:411 or SEQ ID NO:412 to SEQ ID NO:475 (targeting B2M), and another of the two or more repressive RNAs is adapted to inhibit the expression of the target gene STAT6. In some embodiments, one of the two or more repressive RNAs is selected from SEQ ID NO:1 or 18 (silencing element 8), SEQ ID NO:5 or 22 (silencing element 20), SEQ ID NO:9 or 26 (silencing element 29), SEQ ID NO:10 or 27 (silencing element 30), SEQ ID NO:348 to SEQ ID NO:411 or SEQ ID NO:412 to SEQ ID NO:475 (targeting B2M), and the other of the two or more repressive RNAs represses the expression of the target gene STAT6. In some embodiments, one of the two or more repressive RNAs is selected from SEQ ID NO:1 or 18 (silencing element 8), SEQ ID NO:5 or 22 (silencing element 20), SEQ ID NO:9 or 26 (silencing element 29), SEQ ID NO:10 or 27 (silencing element 30), SEQ ID NO:348 to SEQ ID NO:411 or SEQ ID NO:412 to SEQ ID NO:475 (targeting B2M), and the other of the two or more repressive RNAs is selected from SEQ ID NO:206 to SEQ ID NO:229 or SEQ ID NO:230 to SEQ ID NO:253 (targeting STAT6).

[0300] In some embodiments, one of the two or more repressive RNAs is selected from SEQ ID NO:1 or 18 (silencing element 8), SEQ ID NO:5 or 22 (silencing element 20), SEQ ID NO:9 or 26 (silencing element 29), SEQ ID NO:10 or 27 (silencing element 30), SEQ ID NO:348 to SEQ ID NO:411 or SEQ ID NO:412 to SEQ ID NO:475 (targeting B2M), and another of the two or more repressive RNAs is selected from SEQ ID NO:216 and / or SEQ ID NO:240 (targeting STAT6), SEQ ID NO:222 and / or SEQ ID NO:246 (targeting STAT6); SEQ ID NO:127 and / or SEQ ID NO:151 (targeting IRF4); and SEQ ID NO:177 and / or SEQ ID NO:201 (targeting KDM6B).

[0301] In some embodiments, one of the target genes is PPARG, and the other target gene is selected from IRF4, KDM6B, and STAT6. In some embodiments, one of the target genes is PPARG, and the other target gene is IRF4. In some embodiments, one of the two or more repressive RNAs is selected from SEQ ID NO:66 to SEQ ID NO:87 or SEQ ID NO:88 to SEQ ID NO:109 (targeting PPARG), and the other of the two or more repressive RNAs is selected from SEQ ID NO:110 to SEQ ID NO:133 or SEQ ID NO:134 to SEQ ID NO:157 (targeting IRF4). In some embodiments, one of the target genes is PPARG, and the other target gene is KDM6B. In some embodiments, one of the two or more repressive RNAs is selected from SEQ ID NO:66 to SEQ ID NO:87 or SEQ ID NO:88 to SEQ ID NO:109 (targeting PPARG), and the other of the two or more repressive RNAs is selected from SEQ ID NO:158 to SEQ ID NO:181 or SEQ ID NO:182 to SEQ ID NO:205 (targeting KDM6B).

[0302] In some embodiments, one of the target genes is PPARG, and another of the target genes is STAT6. In some embodiments, one of the two or more repressive RNAs is selected from SEQ ID NO:66 to SEQ ID NO:87 or SEQ ID NO:88 to SEQ ID NO:109 (targeting PPARG), and the other of the two or more repressive RNAs is selected from SEQ ID NO:206 to SEQ ID NO:229 or SEQ ID NO:230 to SEQ ID NO:253 (targeting STAT6).

[0303] In some embodiments, one of the target genes is IRF4, and the other target gene is selected from PPARG, KDM6B, and STAT6. In some embodiments, one of the target genes is IRF4, and the other target gene is KDM6B. In some embodiments, one of the two or more repressive RNAs is selected from SEQ ID NO:110 to SEQ ID NO:133 or SEQ ID NO:134 to SEQ ID NO:157 (targeting IRF4), and the other of the two or more repressive RNAs is selected from SEQ ID NO:158 to SEQ ID NO:181 or SEQ ID NO:182 to SEQ ID NO:205 (targeting KDM6B). In some embodiments, one of the target genes is IRF4, and the other target gene is STAT6. In some embodiments, one of the two or more repressive RNAs is selected from SEQ ID NO:110 to SEQ ID NO:133 or SEQ ID NO:134 to SEQ ID NO:157 (targeting IRF4), and the other of the two or more repressive RNAs is selected from SEQ ID NO:206 to SEQ ID NO:229 or SEQ ID NO:230 to SEQ ID NO:253 (targeting STAT6).

[0304] In some embodiments, one of the target genes is KDM6B, and the other target gene is selected from PPARG, IRF4, and STAT6. In some embodiments, one of the target genes is KDM6B, and the other target gene is STAT6. In some embodiments, one of the two or more repressive RNAs is selected from SEQ ID NO:158 to SEQ ID NO:181 or SEQ ID NO:182 to SEQ ID NO:205 (targeting KDM6B), and the other of the two or more repressive RNAs is selected from SEQ ID NO:206 to SEQ ID NO:229 or SEQ ID NO:230 to SEQ ID NO:253 (targeting STAT6).

[0305] In some embodiments, one of the target genes is FOXP3, and another of the target genes is PDCD-1. In some embodiments, one of the two or more repressive RNAs is selected from SEQ ID NO:476 to SEQ ID NO:525 or SEQ ID NO:526 to SEQ ID NO:575 (targeting FOXP3), and another of the two or more repressive RNAs is selected from SEQ ID NO:576 to SEQ ID NO:624 or SEQ ID NO:625 to SEQ ID NO:673 (targeting PDCD-1). In some embodiments, one of the target genes is STAT6, and another of the target genes is selected from PPARG, IRF4, and KDM6B.

[0306] In some implementations, the method suitably includes providing pancreatic cells with a nucleic acid construct adapted to express two or more repressive RNAs adapted to suppress the expression of two or more target genes (i.e., two or more repressive RNAs with different targets).

[0307] In some implementations, the method suitably includes providing T cells with a nucleic acid construct adapted to express two or more repressive RNAs adapted to suppress the expression of two or more target genes (i.e., two or more repressive RNAs with different targets).

[0308] In some implementations, the method suitably includes providing macrophages with nucleic acid constructs adapted to express two or more repressive RNAs adapted to suppress the expression of two or more target genes (i.e., two or more repressive RNAs with different targets).

[0309] Cells and cellular environment

[0310] As can be clearly seen from the above, the present invention relates to repressive RNAs that are active in cells under specific (first) conditions. In a specific embodiment, the repressive RNA is a modified form of endogenous non-coding RNA, such as repressive RNA, which has modified target specificity to target a desired target gene. It is evident that the target gene is different from the (original) gene typically targeted by endogenous non-coding RNAs.

[0311] In some embodiments, the modified cells may be situated in a given environment in which the repressor RNA is inactive, and wherein the repressor RNA becomes active when the cells are situated in different environments. As a non-limiting example, stem cells may be modified to contain a sequence encoding a repressor RNA that becomes active when the cell differentiates into a desired cell type. Alternatively, immune cells or their progenitor cells may be modified to contain a sequence encoding a repressor RNA that becomes active when the immune cell is activated or polarized in a particular manner or enters a specific tissue. In all such cases, the repressor RNA is active in the desired (first) environment but substantially inactive in another environment.

[0312] In some embodiments of the invention, the repressor RNA may be selectively expressed or selectively processed in specific cell or tissue types, or in cells under certain conditions or states. As a non-limiting example, the repressor RNA may suitably be a repressor RNA expressed in the cell type of interest (e.g., cells expressing pancreatic endocrine hormones or immune cells, such as T cells or tumor-associated macrophages) but not in alternative states of cells expressing pancreatic endocrine hormones or immune cells (e.g., inactivated, unresponsive, dysfunctional, or degenerate states) or not expressed in another type of cell (e.g., precursor / progenitor cells of pancreatic cells or immune cells).

[0313] In some embodiments of the invention, the method includes modifying cells to include a nucleic acid construct suitable for expressing repressive RNA adapted to suppress the expression of a target gene, wherein the repressive RNA becomes active in the cell after alteration of the cellular environment. Thus, the repressive RNA is initially inactive in the cell, but becomes active once the cell is in a different environment (e.g., after activation, polarization, when the cell is present in a specific tissue, etc.).

[0314] In some embodiments of the invention, the method includes modifying progenitor cells to include a nucleic acid construct suitable for expressing repressive RNA adapted to suppress the expression of a target gene, wherein the repressive RNA becomes active in the cells after differentiation, preferably wherein the repressive RNA is active in cells after complete differentiation. Thus, the repressive RNA is initially inactive in the progenitor cells but becomes active later in the differentiation process.

[0315] In some embodiments of the invention, the method includes modifying a progenitor cell (e.g., a stem cell, such as an iPSC) such that when the progenitor cell differentiates into a desired cell type (e.g., fully differentiated), RNA activity in the cell is inhibited.

[0316] In some embodiments of the invention, the method includes modifying progenitor cells (e.g., stem cells, such as iPSCs) such that when the cells differentiate into a desired state (e.g., fully differentiated) and when the cells are in a specific environment (e.g., after activation, polarization, when the cells are present in a specific tissue, etc.), RNA activity in the cells is inhibited.

[0317] In some implementations, the repressive RNA may be selectively, specifically, or preferentially active in a particular cell type. Appropriately, the repressive RNA may be inactive or have only low levels of activity in other cell types.

[0318] In some embodiments, the first environment is a cell type in which the inhibitory RNA is active, and the second environment is another cell type in which the inhibition of the target gene is not desired. In some embodiments, the first environment is a cell type in which the inhibitory RNA is active, and the second environment is any other cell type.

[0319] In some implementations, the repressor RNA has selective activity (e.g., selective expression or selective processing) in a specific cell type or tissue type or in a specific cell type under specific conditions. For example, the repressor RNA may suitably be a repressor RNA expressed in the cell type of interest (e.g., enteroendocrine cells, such as pancreatic β cells; or immune cells, such as macrophages or T cells) but not in another cell type (e.g., precursor / progenitor cells of pancreatic β cells or immune cells).

[0320] In some embodiments, the repressor RNA may be selectively, specifically, or preferentially active in cells at a particular stage of differentiation. Suitable, the repressor RNA may be inactive, or have low levels of activity only in cells of the same lineage but at different stages of differentiation. In such embodiments, the first environment is cells at a differentiation stage where the repressor RNA is active, and the second environment can be any other differentiation stage. In some embodiments, the first environment is when cells are fully differentiated into, for example, therapeutic cells, and the second environment is when cells are undifferentiated or partially differentiated. In some embodiments, the first environment is IPSC-derived pancreatic progenitor cells, IPSC-derived monocytes, or IPSC-derived macrophages, and the second environment is undifferentiated iPSCs. In some embodiments, the first environment is IPSC-derived pancreatic progenitor cells, and the second environment is undifferentiated iPSCs. In some embodiments, the first environment is IPSC-derived monocytes or IPSC-derived macrophages, and the second environment is undifferentiated iPSCs. The ability to conditionally silence genes in differentiated (progenitor) iPSC-derived cells, rather than genes in undifferentiated iPSCs, is advantageous in cell therapy. In iPSCs and differentiated progenitor cells used in cell therapy, routine constitutive knockout of genes designed to regulate the recipient's immune response to therapeutic cells (e.g., MHC-I, see above) is associated with risk. After implantation, trace amounts of constitutively knocked-out (e.g., MHC-I) contaminated undifferentiated iPSCs in the therapeutic agent may go undetected by the recipient's immune system, begin to proliferate, and form teratomas. On the other hand, silencing such genes only in iPSC-derived differentiated (progenitor) cells means that any contaminated undifferentiated iPSCs will be recognized as "non-self" (e.g., not MHC-I-suppressing) and eliminated by the recipient's immune system after implantation.

[0321] In some embodiments, the repressor RNA may be active in the cell only when the cell is in a specific state. For example, the repressor RNA may be selectively, specifically, or preferentially active in cells activated in a specific manner, stressed cells, cells present in a specific tissue, cells in the tumor microenvironment, cells infected by a virus, etc. In such embodiments, the first environment is the cell state in which the repressor RNA is active, and the second environment can be any other cell state. In some embodiments, the first environment is a Treg cell state, and the second environment is a T cell effector state. In some embodiments, the first environment is cells in the tumor microenvironment (TME).

[0322] In a preferred embodiment of the invention, the cell is a eukaryotic cell. According to some embodiments, the eukaryotic cell is derived from a eukaryote selected from mammals, insects, nematodes, birds, reptiles, fish, crustaceans, fungi, and algae. According to a preferred embodiment, the eukaryotic cell is a mammalian cell. According to a further preferred embodiment, the mammalian cell is a human cell.

[0323] In some specific embodiments, the cells are differentiated cells, including but not limited to dendritic cells, lymphocytes, erythrocytes, platelets, hematopoietic cells, pancreatic islet cells (e.g., β cells), hepatocytes, myocytes, keratinocytes, cardiomyocytes, neurons, skeletal muscle cells, eye cells, mesenchymal cells, fibroblasts, lung cells, gastrointestinal cells, vascular cells, endocrine cells, and adipocytes. In a particularly preferred embodiment, the cells are therapeutic forms of any of the said cells. In some preferred embodiments, the inhibitory RNA is active in the relevant differentiated cells, but inactive or with low activity in the precursors of said cells.

[0324] In some specific embodiments, the cells are stem cells, such as therapeutic stem cells. In some embodiments, the stem cells are adapted to differentiate into various cell types, including but not limited to dendritic cells, lymphocytes, erythrocytes, platelets, hematopoietic cells, pancreatic islet cells (e.g., β cells), hepatocytes, myocytes, keratinocytes, cardiomyocytes, neurons, skeletal muscle cells, eye cells, mesenchymal cells, fibroblasts, lung cells, gastrointestinal cells, vascular cells, endocrine cells, or adipocytes. In some preferred embodiments, the repressive RNA is active in the relevant stem cells, but is inactive or has low activity during said stem cell differentiation.

[0325] In some preferred embodiments, the cells are pluripotent cells, such as embryonic stem cells or iPSCs.

[0326] In some preferred embodiments, the cells are iPSCs or cells derived from iPSCs.

[0327] In some preferred embodiments, the cells are hematopoietic stem cells (HSCs).

[0328] According to some particularly preferred embodiments, the cell is a therapeutic cell. A therapeutic cell is a cell suitable for administration to a subject with the intent or expectation of providing the subject with some therapeutic benefit. In some embodiments, the cell is a therapeutic endocrine cell. In some embodiments, the cell is a therapeutic immune cell.

[0329] In some preferred embodiments of the invention, the cells are environment-specific low-immunogenic cells. More preferably, in some embodiments, the cells are environment-specific low-immunogenic therapeutic cells. Even more preferably, the cells are low-immunogenic allogeneic therapeutic cells. In such embodiments, the target gene is suitably a gene associated with the MHC-I system.

[0330] In some implementations, the inhibitory RNA has specific activity in a cell that is in an environment selected from:

[0331] - Cells in a specific differentiation state, such as fully differentiated cells, cells in the intermediate differentiation stage, or undifferentiated cells;

[0332] -Totipotent cells, pluripotent cells, or pluripotent cells;

[0333] - Cells that exist in specific tissues;

[0334] - Cancerous or precancerous cells;

[0335] - Tumor-associated cells, such as tumor-associated immune cells or immune cells in the tumor microenvironment;

[0336] - Activate cells, such as macrophages that are polarized to a specific functional state;

[0337] - Immune cells that are in a memory or quiescent stem cell state rather than an effector state;

[0338] - Hypoxic cells; or

[0339] - Cells that have undergone the reaction of unfolded proteins.

[0340] In some preferred embodiments, the cells are cells of the endocrine system, preferably therapeutic cells of the endocrine system. In some embodiments, the cells are enteroendocrine cells, preferably therapeutic enteroendocrine cells. Endocrine cells are found in a range of endocrine glands in the human and animal body. In some embodiments, the cells are derived from: the pancreas, thyroid gland, parathyroid gland, pituitary gland, pineal gland, testis, ovary, adrenal gland, thymus, and hypothalamus. Therefore, the repressive RNA may be selectively, specifically, or preferentially active in endocrine cells derived from one of the said endocrine glands.

[0341] In some preferred embodiments, the cells are pancreatic cells, more preferably in cells expressing pancreatic endocrine hormones (e.g., β cells, α cells, δ cells, or ε cells, most preferably β cells). In such cases, it is generally preferred that the repressive RNA is selectively, specifically, or preferentially active in such pancreatic cells. In some preferred embodiments, the repressive RNA is expressed at reduced levels in precursor / progenitor cells of pancreatic cells expressing the endocrine hormones, and is not expressed in stem cells such as iPSCs.

[0342] In some preferred embodiments, the cells are pancreatic β cells. Therefore, the repressive RNA is selectively, specifically, or preferentially active in pancreatic β cells. In some preferred embodiments, the repressive RNA is inactive or has significantly low activity levels in pancreatic β cell precursor / progenitor cells (such as stem cells, e.g., iPSCs).

[0343] In some embodiments of the invention, the repressive RNA has selective activity (e.g., selective expression or selective processing) in cells expressing pancreatic endocrine hormones. Suitable repressive RNAs exhibit selective activity when these cells are adequately vascularized and respond within the expected range of normal fasting blood glucose concentrations (70 mg / dL (3.9 mmol / L) to 100 mg / dL (5.6 mmol / L)). Appropriately, the repressive RNA is inactive or has low activity when cells are in a substitute state due to exposure to hypoxia, oxidative stress, inactivation, glucose unresponsiveness, glucose-responsive but electrically silent state, hormone unresponsiveness, dysfunction (failure to secrete insulin, glucagon, somatostatin, etc.), degeneration, or excessive proliferation.

[0344] In another preferred embodiment of the invention, the cells are immune cells. Immune cells of interest include neutrophils, eosinophils, basophils, mast cells, monocytes, macrophages, dendritic cells, natural killer cells, and lymphocytes (B cells and T cells). Cells of particular interest include T cells, preferably cytotoxic T cells, such as T cells suitable for T cell therapy (such as CAR-T cell therapy), and macrophages. Appropriately, inhibitory RNA has selective activity in such immune cells.

[0345] In some embodiments, the immune cells are macrophages, such as M1 macrophages, M2 macrophages (e.g., M2a, M2b, M2c, and M2d macrophages), Treg macrophages, or tumor-associated macrophages (TAMs). In some preferred embodiments, the inhibitory RNA is selectively, specifically, or preferentially active in macrophages, suitably in M1 macrophages, M2 macrophages, Treg macrophages, or tumor-associated macrophages (TAMs). In some preferred embodiments, the inhibitory RNA is selectively, specifically, or preferentially active in macrophages that do not have a specified function, preferably tumor-associated macrophages, such as macrophages suitable for macrophage therapy (e.g., CAR-M cell therapy) or macrophages suitable for CARs targeting tumor antigens.

[0346] In some preferred embodiments, the repressive RNA is selectively, specifically, or preferentially active in monocytes and macrophages. Suitably, the repressive RNA is inactive or has low activity in cells other than monocytes and macrophages. Suitably, the repressive RNA is inactive in progenitor cells of monocytes and macrophages, such as stem cells (e.g., hematopoietic stem cells, monocytes, or iPSCs). As a non-limiting example, in such embodiments, the repressive RNA can be used, for example, to drive monocytes or macrophages toward a pro-inflammatory or anti-inflammatory phenotype by silencing one or more anti-inflammatory or pro-inflammatory genes, respectively.

[0347] In some preferred embodiments, the repressive RNA is selectively, specifically, or preferentially active in M2 macrophages (also known as alternatively activated macrophages). Suitably, the repressive RNA is inactive or has low activity in M1 macrophages (also known as classically activated macrophages) and / or non-polarized macrophages. As a non-limiting example, in such embodiments, the repressive RNA can be used, for example, to drive M2 macrophages toward a pro-inflammatory phenotype by silencing one or more anti-inflammatory genes in M1 macrophages. Suitably, the M2 macrophages can be M2a, M2b, M2c, or M2d macrophages.

[0348] In some preferred embodiments, the repressive RNA is selectively, specifically, or preferentially active in M1 macrophages. Suitable, the repressive RNA is inactive or has low activity in M2 macrophages and / or non-polarized macrophages. As a non-limiting example, in such embodiments, the repressive RNA can be used, for example, to drive M1 macrophages toward an anti-inflammatory phenotype by silencing one or more pro-inflammatory genes in M1 macrophages.

[0349] In some preferred embodiments, the repressive RNA is selectively, specifically, or preferentially active in non-polarized macrophages. Suitable, the repressive RNA is inactive or has low activity in polarized macrophages (e.g., M1 or M2 macrophages). As a non-limiting example, in such embodiments, the repressive RNA can be used, for example, to drive monocytes or macrophages toward a pro-inflammatory or anti-inflammatory phenotype by silencing one or more anti-inflammatory or pro-inflammatory genes, respectively.

[0350] In some preferred embodiments, the repressive RNA is selectively, specifically, or preferentially active in tumor-associated macrophages (TAMs) or macrophages exposed to the tumor microenvironment (TME). Suitablely, the repressive RNA is inactive or has low activity in M1 macrophages (also known as classically activated macrophages) and / or non-polarized macrophages, or when macrophages are not exposed to the TME. As a non-limiting example, in such embodiments, the repressive RNA can be used, for example, to drive TAMs or TME-exposed macrophages toward a pro-inflammatory (anti-tumor) phenotype by silencing one or more anti-inflammatory genes in M1 macrophages.

[0351] Therefore, in some preferred embodiments, the inhibitory RNA is selectively, specifically, or preferentially active in T cells. In some preferred embodiments, the inhibitory RNA is selectively, specifically, or preferentially active in tumor-infiltrating cytotoxic T cells (e.g., T cells suitable for T cell therapy such as CAR-T cell therapy).

[0352] In some preferred embodiments, the repressive RNA is not expressed or is expressed at a significantly low level in the progenitor / precursor cells of these immune cells (such as stem cells, e.g., iPSCs or partially differentiated immune cell progenitor cells).

[0353] In some preferred embodiments, the repressive RNA is selectively, specifically, or preferentially active in immune cells when in a specific activated state. In some embodiments, when the repressive RNA is not in the activated state, it is not expressed in immune cells or is expressed at a significantly low level. In some preferred embodiments, the repressive RNA is inactive or has a significantly low level of activity in progenitor / precursor cells of immune cells (such as stem cells, e.g., iPSCs). As a non-limiting example, the repressive RNA can be used to promote the activity of T cells in the tumor microenvironment (see [link to relevant documentation]). Figure 13 For example, by targeting genes associated with immunosuppressive states (PD-1 (PDCD-1), CTLA4, etc.) in an environment-specific manner.

[0354] In some embodiments of the invention, the inhibitory RNA can be selectively active in immune cells within the tumor microenvironment (TME). For example, the inhibitory RNA can be selectively active when these cells respond to tumor-derived chemokines (e.g., CXCL9 / 10 / 11 / 12, CCL2 / 5, CCL17 / 22), hypoxia (ppO2 8-10 mmHg or lower), tumor-associated immunosuppressive cytokines (e.g., IL10, TGF-β, IL4, IL13), immune cell checkpoint ligands (e.g., those targeting receptor PD-1 (PDCD-1), LAG3, TIM3, CTLA-4, Clever-1), cancer-associated fibroblast (CAF) signaling (e.g., IL-11, CXCL12, GDF), tumor stroma (e.g., fibronectin, multifunctional proteoglycans, collagen-11A1, SFRP2), or metabolites (e.g., lactate). Appropriately, when cells are in a replacement state or have migrated out of the tumor microenvironment or remain inactive, depleted, non-immune, or polarized into an immunosuppressive state, the inhibitory RNA is inactive or has a low level of activity.

[0355] In some embodiments of the invention, when the inhibitory RNA migrates out of the tumor microenvironment or is altered as described above, the inhibitory RNA becomes inactive or less active in immune cells, and thus can no longer silence the expression of receptor genes, their signal transduction components, transcription factors that control immune checkpoints (e.g., PD-1 (PDCD-1), LAG3, TIM3, CTLA-4, Clever-1), tumor-derived chemokines, immunosuppressive cytokines, CAF ligands, tumor matrix molecules fibronectin, multifunctional proteoglycans, collagen-11A1, SFRP2, metabolite transport molecules (e.g., lactate, monocarboxylic acid transporter-1 (SLC16A1)), L-kynurenine receptors (aromatic receptors (RP85; bHLHe76)) or mitochondrial fission regulators DRP1 (initiator-associated protein 1), and thus immune cells become inactive, exhausted, immunosuppressed, or anti-inflammatory.

[0356] In some preferred embodiments, the inhibitory RNA is selectively, specifically, or preferentially active in the following cells:

[0357] -M2 macrophages compared to M0 macrophages, or vice versa;

[0358] - Comparison of M2 macrophages with M1 macrophages, or vice versa;

[0359] - Comparison of M1 macrophages with M0 macrophages, or vice versa;

[0360] - Comparison of M2a macrophages with M0 macrophages, or vice versa;

[0361] - Comparison of M2a macrophages with M1 macrophages, or vice versa;

[0362] - Comparison of M2c macrophages with M0 macrophages, or vice versa;

[0363] - Comparison of M2c macrophages with M1 macrophages, or vice versa;

[0364] - Comparison of M2c macrophages and M2a macrophages, or vice versa;

[0365] -M0, M1, or M2 macrophages compared to monocytes, or vice versa;

[0366] - Immune cells in the TME (e.g., T cells or TAMs) compared to immune cells not in the TME; or

[0367] - Stimulated T cells compared to naive T cells, or vice versa.

[0368] In some embodiments of the invention, the repressor RNA is expressed in cells as a modified form of endogenous non-coding (typically repressor) RNA, which is selectively, specifically, or preferentially expressed in a first environment (e.g., the cell type or tissue type of interest) when the cells are in a specific state of activation or differentiation. This can be achieved by modifying the endogenous repressor RNA in the cells or by introducing a modified form of the endogenous repressor RNA. Preferably, this is achieved by in situ modification of the endogenous repressor RNA, for example, by GEiGS.

[0369] Various databases providing detailed tissue and cellular expression profiles of repressive RNAs are well known. These can be readily used by those skilled in the art to identify suitable endogenous repressive RNAs for modification to provide the environment-specific activity of the repressive RNAs as conceived in this invention. See, for example, the miRmine human miRNA expression database, Panwar et al. Bioinformatics. 2017 May 15; 33(10):1554–1560, https: / / guanfiles.dcmb.med.umich.edu / mirmine / ; DIANA-miTED microRNA tissue expression database—see Kavaciotis et al., “DIANA-miTED: a microRNA tissue expression database”, Nucleic Acids Research, Volume 50, Issue D1, 7 January 2022, Pages D1055–D1061 http: / / www.microrna.gr / mited)

[0370] Furthermore, techniques for experimentally analyzing the expression profiles of repressed RNAs are well known in the art. Therefore, for any given environment (e.g., cell type or conditions), those skilled in the art can readily determine which endogenous RNAs are expressed at high or low levels, thereby selecting one or more suitable endogenous RNAs for modification to target the desired RNA, thus silencing the desired target gene.

[0371] Suitable methods for analyzing miRNA expression in a given cell are known in the art, and one method suitable for this invention is as follows: Small RNA and miRNA isolation—Small RNAs including miRNAs are isolated using the miRvana RNA Isolation Kit (Ambion, Austin, TX, USA) according to the manufacturer's protocol. RNA is quantified using a Qubit or Nanodrop spectrophotometer (Thermo Fisher, Wilmington, DE, USA) and its quality is determined using an Agilent 6000 nanoarray (Agilent Technologies, Palo Alto, CA, USA). miRNA measurement: Quantitative real-time PCR analysis is performed as follows: RNA is reverse transcribed and PCR amplified using an ABI 7500 real-time PCR system according to the manufacturer's protocol using the miScript Reverse Transcription Kit and the miScript SYBR PCR Kit (Qiagen, Valencia, CA, USA). The values ​​from the repeated responses were averaged and normalized relative to the level of U6 SnoRNA. Relative expression levels were calculated using the comparative Ct method as described above (Schmittgen and Livak. Nat Protoc (2008) 3:1101-1108). Alternatively, small RNA sequence analysis was used to detect and relatively quantify miRNAs (as described in www.illumina.com / techniques / sequencing / rna-sequencing / small-rna-seq.html or Wake et al., BMC Genomics (2016) 17(1):1).

[0372] In some implementations, the repressive RNA is expressed at the following levels: at least 1000 RPM (number of reads per million mapped reads) in cells under a first environment, at least 2000 RPM in cells under a first environment, at least 3000 RPM in cells under a first environment, at least 4000 RPM in cells under a first environment, at least 5000 RPM in cells under a first environment, at least 10000 RPM in cells under a first environment, at least 20000 RPM in cells under a first environment, or at least 50000 RPM in cells under a first environment, or at least 100000 RPM in cells under a first environment.

[0373] In some embodiments, where it is desired that the repressive RNA is inactive or has low activity in a second environment, the repressive RNA is expressed at a level of less than 25%, less than 20%, less than 15%, less than 10%, less than 5%, or less than 1% compared to cells in a first environment. In some embodiments, the repressive RNA is expressed at the following levels: less than 5000 RPM in cells in the second environment, less than 4000 RPM in cells in the second environment, less than 3000 RPM in cells in the second environment, less than 2000 RPM in cells in the second environment, less than 1000 RPM in cells in the second environment, less than 500 RPM in cells in the second environment, less than 300 RPM in cells in the second environment, less than 200 RPM in cells in the second environment, less than 100 RPM in cells in the second environment, or less than 50 RPM in cells in the second environment.

[0374] In some embodiments, the endogenous repressive RNA modified to provide the repressive RNA of the present invention is expressed at the following levels: at least 1000 RPM (number of reads per million mapped reads) in cells under a first environment, at least 2000 RPM in cells under a first environment, at least 3000 RPM in cells under a first environment, at least 4000 RPM in cells under a first environment, at least 5000 RPM in cells under a first environment, at least 10000 RPM in cells under a first environment, at least 20000 RPM in cells under a first environment, or at least 50000 RPM in cells under a first environment, or at least 100000 RPM in cells under a first environment.

[0375] In some embodiments, in a second environment, compared to cells in a first environment, the endogenous repressive RNA modified to provide the repressive RNA of the present invention is expressed at a level of less than 25%, 20%, 15%, 10%, 5%, or 1%.

[0376] In some embodiments, the endogenous repressive RNA modified to provide the repressive RNA of the present invention is expressed at the following levels in cells under a second environment: less than 5000 RPM, less than 4000 RPM, less than 3000 RPM, less than 2000 RPM, less than 1000 RPM, less than 500 RPM, less than 300 RPM, less than 200 RPM, less than 100 RPM, or less than 50 RPM in cells under a second environment.

[0377] In pancreatic tissue, hsa-miR-375, hsa-miR-143, and hsa-miR-21 were expressed at particularly high levels (189,993.6 RPM, 186,579.2 RPM, and 65,231.3 RPM, respectively, according to the miRmine database), while a number of other miRNAs were also expressed at significant but more moderate levels (e.g., hsa-miR-30d, hsa-miR-192, hsa-miR-30a, hsa-miR-182, hsa-miR-148a, hsa-miR-127, hsa-miR-200c, etc.).

[0378] In liver tissue, hsa-miR-143, hsa-miR-10a, and hsa-miR-122 are expressed at particularly high levels (93940.6 RPM, 92139.6 RPM, and 80063.1 RPM, respectively, according to the miRmine database), while a number of other miRNAs are also expressed at significant but more moderate levels (e.g., hsa-miR-22, hsa-miR-192, hsa-miR-146b, hsa-miR-26a, hsa-miR-125a, hsa-miR-150, etc.).

[0379] In brain tissue, for example, hsa-miR-10b and hsa-miR-181a are expressed at particularly high levels (198,835.2 RPM and 51,936.2 RPM, respectively, according to the miRmine database), while a number of other miRNAs are also expressed at significant but more moderate levels (e.g., hsa-miR-26a, hsa-miR-92a, hsa-miR-143, hsa-miR-10a, hsa-miR-21, etc.).

[0380] For T cells, miRNAs are known to be key regulators of tumor-associated T lymphocytes (Xing Y, et al. Tumor Immune Microenvironment and Its Related miRNAs in Tumor Progression. Front Immunol. 2021 May 18; 12:624725. doi:10.3389 / fimmu.2021.624725.PMID:34084160; PMCID:PMC8167795).

[0381] For macrophages and monocytes, for example, in some embodiments, the repressor RNA is a modified form of MIR146A (e.g., hsa-miR-146a-5p), MIR20A (e.g., hsa-miR-20a-5p), LET7C (hsa-miR-let-7c-5p), or LET7i (hsa-let-7i-5p). For example, such miRNAs can be used to induce silencing during monocyte differentiation into macrophages and will maintain silencing to block the initiation of the M2-specific program.

[0382] NGS analysis showed that MIR146A (hsa-miR-146a-5p) was highly expressed in M0, M1, and M2 macrophages; qPCR also showed a strong induction of M0-like state from proliferating THP-1 monocytes. Therefore, in contrast to monocyte precursors, MIR146A (hsa-miR-146a-5p) is of particular interest as a repressive RNA for differentiating macrophages (e.g., M0, M1, and M2 macrophages).

[0383] For MIR20A (hsa-miR-20a-5p), the combination of NGS and qPCR showed high expression in proliferating THP-1 monocytes as well as M0, M1 and M2-like cells, thus MIR20A (hsa-miR-20a-5p) is of particular interest as a repressive RNA for monocytes and differentiated macrophages.

[0384] NGS showed that LET7C(hsa-miR-let-7c-5p) was specifically induced by M2a (to be confirmed by qPCR). Therefore, LET7C(hsa-miR-let-7c-5p) is of particular interest as a repressive RNA for differentiated macrophages, especially M2 and / or M2a macrophages.

[0385] For LET7i(hsa-let-7i-5p), NGS showed very strong expression in M0, M1, M2a, and M2c macrophages, with moderate induction levels compared to proliferating THP-1 monocytes. Therefore, LET7i(hsa-let-7i-5p) is of particular interest as a repressive RNA for differentiating macrophages, and its expression levels are reduced in monocytes. Thus, LET7i(hsa-let-7i-5p) may be of particular interest as a repressive RNA for differentiating macrophages in both macrophages and monocytes, but its repression of target genes in monocytes is reduced (i.e., silencing is decreased) compared to macrophages.

[0386] Further examples of differentially expressed miRNAs in macrophages are listed in Tables 15 through 20. Tables 15 through 20 below provide a summary of the results for differentially expressed miRNAs identified in different macrophage states, as follows:

[0387] Table 15 - Comparison of M1 macrophages and M0 macrophages.

[0388] Table 16 - Comparison of M2a macrophages and M0 macrophages.

[0389] Table 17 - Comparison of M2a macrophages and M1 macrophages.

[0390] Table 18 - Comparison of M2c macrophages and M0 macrophages.

[0391] Table 19 - Comparison of M2c macrophages and M1 macrophages.

[0392] Table 20 - Comparison of M2c macrophages and M2a macrophages.

[0393] Suitable miRNAs for use in this invention can be selected from these tables. Note that a positive fold change indicates an increase in the expression of the first named cell type compared to the second named cell type, while a negative fold change indicates an increase in the expression of the second named cell type compared to the first named cell type. Thus, in Table 15, a positive fold change indicates an increase in the expression of M1 compared to M0, while a negative fold change indicates an increase in the expression of M0 compared to M1. Generally, miRNAs with higher differential expression levels (i.e., high log FC values) are preferred to provide more specific silencing in a given cell state. In some cases, miRNAs with higher expression levels may also be preferred.

[0394] Further examples of differentially expressed miRNAs in stimulated T cells and naive T cells are listed in Table 21. Table 21 summarizes the results of the NGS differential analysis, equivalent to the analyses performed to determine the results shown in Tables 15 through 20. Again, miRNAs with higher differential expression levels (i.e., high log FC values) are generally preferred to provide more specific silencing in a given cell state. In some cases, miRNAs with higher expression levels may also be preferred.

[0395] More generally, miRNAs are known to be key regulators of tumor-associated macrophages (Chatterjee, et al. MicroRNAs: As Critical Regulators of Tumor-Associated Macrophages. Int J Mol Sci. 2020 Sep27; 21(19):7117. doi:10.3390 / ijms21197117.PMID:32992449; PMCID:PMC7582892). This suggests the existence of more miRNAs that could be used for environment-specific gene silencing in TAMs, for example, to silence genes that promote M2-like immunosuppression or quiescent phenotypes.

[0396] Other examples of miRNAs associated with M2-like macrophages in the literature include (Table 1):

[0397]

[0398]

[0399]

[0400] Therefore, variants of these miRNAs may be particularly meaningful for environment-specific repression in M2 macrophages. For example, in some embodiments, these miRNA variants can be used to silence appropriate target genes to induce a pro-inflammatory state in macrophages (e.g., an M1-like state). miRNAs selectively expressed at high levels in M2 macrophages may be particularly meaningful for environment-specific silencing of target genes in therapeutic macrophages, potentially for cancer treatment.

[0401] Other examples of miRNAs associated with M1-like macrophages in the literature include (Table 2):

[0402]

[0403] Therefore, these miRNA variants may be meaningful for environment-specific repression in M1 macrophages. For example, in some embodiments, these miRNA variants can be used to silence appropriate target genes and convert macrophages to an anti-inflammatory or pro-regenerative (tissue repair) state (e.g., an M2-like state). miRNAs selectively expressed at high levels in M1 macrophages may be particularly meaningful for environment-specific silencing of target genes in therapeutic macrophages, potentially for treating chronic inflammatory and fibrotic conditions.

[0404] As a non-limiting example, the present invention relates in some preferred embodiments to cell type conditional mRNA target silencing, such as:

[0405] (1) Generate low-immunogenic cells for therapy by partially silencing B2M or classical HLA-(A / B / C) molecules;

[0406] (2) Specialization of therapeutic macrophages targeting the solid tumor microenvironment by silencing mRNA targets (and mechanisms) that define the immunosuppressive state in these cells; or

[0407] (3) Enhance the persistence of therapeutic T cells by silencing immune checkpoints.

[0408] Table 3 provides more non-limiting exemplary cellular environments in which environment-specific gene silencing can be provided according to the present invention.

[0409] Table 3 - Exemplary Environment-Specific (Cellular State) Target Gene Silencing

[0410]

[0411]

[0412] The high-level selective expression of miRNAs in M2 macrophages may be particularly significant for the environment-specific silencing of target genes in therapeutic macrophages, and could be used to treat cancer.

[0413] References in Table 3:

[0414] (1)Liu Y, et al..LAIR-1 suppresses cell growth of ovarian cancer cellvia the PI3K-AKT-mTOR pathway.Aging(Albany NY).2020 Sep 5;12(16):16142-16154.doi:10.18632 / aging.103589.PMID:32628130; PMCID:PMC7485720.

[0415] (2)Zhou M, et al..Role of Epithelial-Mesenchymal Transition in RetinalPigment Epithelium Dysfunction.Front Cell Dev Biol.2020 Jun 25;8:501.doi:10.3389 / fcell.2020.00501.PMID:32671066;PMCID:PMC7329994.

[0416] (3)Mathewson ND,et al..Inhibitory CD161 receptor identified inglioma-infiltrating T cells by single-cell analysis.Cell.2021 Mar 4;184(5):1281-1298.e26.doi:10.1016 / j.cell.2021.01.022.Epub 2021Feb 15.PMID:33592174;PMCID:PMC7935772.

[0417] Roth P et al..Malignant glioma cells counteract antitumor immuneresponses through expression of lectin-like transcript-1.Cancer Res.2007 Apr15;67(8):3540-4.doi:10.1158 / 0008-5472.CAN-06-4783.PMID:17440061.

[0418] Di W,et al..Clinical characterization and immunosuppressiveregulation of CD161(KLRB1)in glioma through 916 samples.Cancer Sci.2022 Feb;113(2):756-769.doi:10.1111 / cas.15236.Epub 2021 Dec 24.PMID:34881489;PMCID:PMC8819299.

[0419] (4)BenetóN,et al..Sanfilippo Syndrome:Molecular Basis,Disease Modelsand Therapeutic Approaches.Int J Mol Sci.2020 Oct 22;21(21):7819.doi:10.3390 / ijms21217819.PMID:33105639;PMCID:PMC7659972.

[0420] (5)Liu J,Wang F.Role of Neuroinflammation in Amyotrophic LateralSclerosis:Cellular Mechanisms and Therapeutic Implications.Front Immunol.2017Aug 21;8:1005.doi:10.3389 / fimmu.2017.01005.PMID:28871262; PMCID:PMC5567007.

[0421] (6)Chen YJ, et al.Use of "MGE enhancers" for labeling and selection ofembryonic stem cell-derived medial ganglionic eminence(MGE) progenitors andneurons.PLoS One.2013 May 1;8(5):e61956.doi:10.1371 / journal.pone.0061956.PMID:23658702; PMCID:PMC3641041.

[0422] (7)Kohno K, et al..A spinal microglia population involved in remitting and relapsing neuropathic pain.Science.2022 Apr;376(6588):86-90.doi:10.1126 / science.abf6805.Epub 2022 Mar 31.PMID:35357926.

[0423] Nucleic acid constructs suitable for expressing repressor RNA

[0424] In some implementations, the nucleic acid construct suitable for expressing repressive RNA is part of the cell genome (i.e., it is a genome sequence).

[0425] In some embodiments of the present invention, the nucleic acid construct suitable for expressing repressor RNA is free.

[0426] In a preferred embodiment, the nucleic acid construct is suitable for expressing miRNA.

[0427] In a preferred embodiment, the nucleic acid construct expresses a modified form of endogenous repressor RNA expressed in an environment-specific manner, wherein the repressor RNA has been modified to suppress the expression of a target gene compared to the endogenous RNA. Therefore, the environment-specific expression of the endogenous repressor RNA is maintained, but the target specificity of the repressor RNA is redirected to suppress the expression of a target gene (which is different from the gene targeted by the endogenous repressor RNA).

[0428] In some implementations, the nucleic acid construct suitable for expressing repressive RNA is part of the cell genome and is located in an endogenous locus in the genome that encodes endogenous non-coding RNA (e.g., endogenous repressive RNA).

[0429] In some implementations, the nucleic acid construct suitable for expressing repressive RNA is a modified endogenous nucleic acid sequence that encodes an endogenous non-coding RNA, such as an in situ modified retargeting endogenous repressive RNA.

[0430] In some embodiments of the invention, a sequence encoding repressor RNA (preferably a promoter-free sequence encoding repressor RNA) is inserted into an endogenous miRNA locus, preferably without disrupting or inactivating any endogenous miRNA. The endogenous miRNA locus may encode an endogenous miRNA that has been modified to target a new target mRNA. Therefore, in some embodiments, a modified form of the endogenous miRNA is inserted into a genomic locus containing the original (unmodified) endogenous miRNA, wherein the original miRNA is not disrupted or inactivated. Thus, the expression or activity of the original (unmodified) endogenous miRNA may remain unchanged.

[0431] In some embodiments, the nucleic acid construct suitable for expressing repressor RNA is a modified endogenous nucleic acid sequence encoding an endogenous non-coding RNA, wherein the endogenous non-coding RNA (e.g., endogenous repressor RNA) has been modified such that it represses the expression of a target gene (e.g., a transcript targeting a target gene). In some embodiments, the nucleic acid construct suitable for expressing repressor RNA is contained in a synthetic expression cassette. In some embodiments, the construct suitable for expressing repressor RNA...

[0432] The RNA nucleic acid construct is contained in the expression vector.

[0433] In some embodiments of the present invention, the nucleic acid construct suitable for expressing repressive RNA is part of the cellular genome and is located at a locus that does not encode endogenous non-coding RNA.

[0434] Nucleic acid constructs suitable for expressing repressive RNA can be introduced into cells via any method known to those skilled in the art, the repressive RNA being adapted to suppress the expression of a target gene. In some embodiments, the nucleic acid constructs suitable for expressing repressive RNA are introduced via lentiviral delivery, the repressive RNA being adapted to suppress the expression of a target gene.

[0435] target genes

[0436] It is evident that this invention provides for the targeting of a variety of target genes in any given environment. Of particular interest in this invention are target genes that can be partially or completely silenced to induce a specific phenotype, characteristic, or behavior of cells in a given environment. For example, one might attempt to alter the immunogenicity of cells, to activate or quiescent them, or to make them pro-inflammatory or anti-inflammatory.

[0437] In some embodiments of the invention, it is desirable to target and modify, preferably reduce, genes that reduce the immunogenicity of cells. This is particularly meaningful for therapeutic cells, especially allogeneic therapeutic cells (e.g., pancreatic islet cells derived from allogeneic stem cells). As discussed herein, genes related to the MHC-I complex are particularly important for generating cells with low immunogenicity.

[0438] Therefore, in some embodiments, the target gene is a gene of the MHC-I complex. In some preferred embodiments, the target gene is β2-microglobulin (B2M). In other embodiments, the target gene is the HLA-A, HLA-B, and / or HLA-C gene. In some embodiments, the target gene is a combination of HLA-A and B or C, or HLA-B and C, or HLA-A / B / C genes.

[0439] In some embodiments, the target genes for altering, preferably reducing, the immunogenicity of cells unrelated to the MHC-I complex and for use in allogeneic stem cell-derived therapeutic cells (e.g., pancreatic islet cells) for inflammatory pathways are selected from: TAP1 / 2, CD74, PSMB9, chemokine ligand 10 (CXCL10), CXCL5, CXCL9, signal transduction molecules STAT1, JAK1 / 2, HNRNPA1P48, GBP2, and TRIM.

[0440] In some embodiments of the invention, it is desirable to target genes that alter the activity of immune cells. For example, it may be desirable to target genes that, when suppressed, lead to a pro-inflammatory phenotype or an immunosuppressive (anti-inflammatory) phenotype.

[0441] It is evident that there are conditions where pro-inflammatory immune cells are desired, such as in tumors. In other conditions, immunosuppression or anti-inflammatory effects of immune cells are desired, such as in autoimmune diseases or other inflammatory conditions. Macrophages and T cells are of particular interest given their crucial roles in immune activity and signaling in many settings.

[0442] As a non-limiting example, in macrophages, it may be desirable to target one or more genes to induce cellular pro-inflammatory states or at least prevent immunosuppressive states. This could be particularly meaningful for environment-specific expression in the TME, where macrophages typically transform into tumor-associated macrophages (TAMs), key cells that create the immunosuppressive microenvironment by producing cytokines, chemokines, growth factors, and triggering the release of inhibitory immune checkpoint proteins in T cells. Therefore, it is desirable to modify macrophages such that one or more repressive RNAs are active in the TME targeting one or more genes, where inhibition of said genes promotes either a pro-inflammatory or non-immunosuppressive state.

[0443] Therefore, in some embodiments, the target gene is preferably one or more genes associated with promoting an immunosuppressive state in immune cells, particularly macrophages (and thus promoting a pro-inflammatory phenotype). For example, the target gene may be one or more selected from the group consisting of: STAT6, IRF4, DRP1, PPARG, KDM6B, Clever-1 (also known as STAB1 or FEEL-1), LAIR1 / 2, P-selective glycoprotein ligand (PSGL-1), signal regulatory protein α (SIRPa), trigger receptor 2 (TREM2) expressed on myeloid cells, proton-sensing GPCR (GPR65), the inhibitory leukocyte immunoglobulin-like receptor subfamily B4 (LILRB4), and PD-1 (PDCD-1).

[0444] In some embodiments, the target gene is preferably selected from one or more genes expressed in tumor-associated macrophages (TAMs). For example, the target gene may be one or more selected from the group consisting of: TREM2, Clever-1 (also known as FEEL-1 and STAB-1), LAIR1 / 2, and the inhibitory leukocyte immunoglobulin-like receptor subfamily B4 (LILRB4).

[0445] TREM2 plays an immunosuppressive role in cancer development, as demonstrated by Katzenelenbogen, et al., which is incorporated herein by reference [Katzenelenbogen, Y., Sheban, F., Yalin, A., Yofe, I., Svetlichnyy, D., Jaitin, DA., Bornstein, C., Moshe, A., Keren-Shaul, H., Cohen, M., Wang, SY., Li, B., David, E., Salame, TM., Weiner, A., & Amit, I. (2020). Coupled scRNA-Seq and Intracellular Protein Activity Reveal an Immunosuppressive Role of TREM2 in Cancer. Cell, 182(4), 872-885.e19.] [https: / / doi.org / 10.1016 / J.CELL.2020.06.032]Systemic blockade of Clever-1 (also known as FEEL-1 and STAB-1) with antibodies can induce lymphocyte activation in patients with solid tumors, but many tissues express this molecule, which can act as a “sink point” to limit “tumor-targeting effects,” as shown by Virtakoivu, et al., which is incorporated herein by reference [Virtakoivu, R., Rannikko, JH, Viitala, M., Vaura, F., Takeda, A., Lonnberg, T., Koivunen, J., Jaakkola, P., Pasanen, A., Shetty, S., de Jonge, MJA, Robbrecht, D., Ma, YT, Skytta, T., Minchom, A., Jalkanen, S., Karvonen, MK, Mandelin, J., Bono, P., & Hollmen, M. (2021). Systemic Blockade of Clever-1 Elicits Lymphocyte Activation Alongside Checkpoint MoleculeDownregulation in Patients with Solid Tumors:Results from a Phase I / IIClinical Trial.Clinical Cancer Research:An Official Journal of the American Association for Cancer Research, 27(15),4205–4220. https: / / doi.org / 10.1158 / 1078-0432.CCR-20-4862 Tumor-specific allotypes of collagen activate LAIR-1 in vitro, inhibiting the pro-inflammatory macrophage phenotype, as shown by Keerthivasan et al., which is incorporated herein by reference [Keerthivasan, S., Y.,Martinez-Martin,N.,Husain,B.,Verschueren,E.,Wong,A.,Yang,YA,Sun,Y.,Pham,V.,Hinkle,T.,Oei,Y.,Madireddi,S.,C orpuz,R.,Tam,L.,Carlisle,S.,Roose-Girma,M.,Modrusan,Z.,Ye,Z.,Koerber,JT,&Turley,SJ(2021).Homeostaticfunctions of monocytes and interstitial lung macrophages are regulated viacollagen domain-binding receptor LAIR1.Immunity,54(7),1511-1526.e8.https: / / doi.org / 10.1016 / J.IMMUNI.2021.06.012]. Suppressive leukocyte immunoglobulin-like receptor subfamily B4 (LILRB4) [Sharma, N., Atolagbe, OT, Ge, Z., & Allison, JP (2021). LILRB4 suppresses immunity in solid tumors and is a potential target for immunotherapy. The Journal of Experimental Medicine, 218(7). https: / / doi.org / 10.1084 / JEM.20201811 [It acts as a checkpoint for myeloid cells and also inhibits the anti-tumor and pro-inflammatory states of macrophages, as shown by Sharma et al., which is incorporated herein by reference.]

[0446] T cells also play a crucial role in the TME. Tumor-infiltrating lymphocytes (TILs) and CAR-T cells typically achieve tolerance through the activity of immune checkpoint pathways such as PD-1 (PDCD-1), CTLA4, LAG3, and TIM3. Therefore, in some embodiments, the target gene is preferably one or more genes associated with the tolerance state in T cells. For example, the target gene may be one or more selected from the group consisting of: PD-1 (PDCD-1), CTLA4, LAG3, TIGIT (a T cell immune receptor with Ig and ITIM domains), and TIM3. The target gene may also preferably be one or more genes upregulated in T cells under exhaustion. For example, the target gene may be one or more selected from the group consisting of: the TOX subfamily (thymocyte selection-associated high-mobility box cassette proteins), NR4A1 (nuclear receptor 4A1; Nur77, TR3, NGFI-B), and CBL-B (E3 ubiquitin ligase).

[0447] Another example of a target gene in T cells is RASA-2.

[0448] Ablation of RASA-2 (RAS GTPase-activating protein) in T cells enhances antigen sensitivity and long-term function, as shown by Carnevale et al., which is incorporated herein by reference [Carnevale J, Shifrut E, Kale N, Nyberg WA, Blaeschke F, Chen YY, Li Z, Bapat SP, Diolaiti ME, O'Leary P, Vedova S, Belk J, Daniel B, Roth TL, Bachl S, Anido AA, Prinzing B, J,Lange S,Haydar D,Luetke-Eversloh M,Born-Bony M,Hegde B,Kogan S,Feuchtinger T,Okada H,Satpathy AT,Shannon K,Gottschalk S,Eyquem J,Krenciute G,Ashworth A,MarsonA.RASA2 ablation in T cells boosts antigen sensitivity and long-term function.Nature.2022Sep;609(7925):174-182.doi:10.1038 / s41586-022-05126-w.Epub2022Aug 24.PMID:36002574;PMCID:PMC9433322].

[0449] In some embodiments of the invention, it is desirable to target genes expressed on the cell surface. For example, it may be desirable to silence genes encoding antigens to prevent cells from being recognized by antibodies that recognize antigens. Therefore, in some embodiments, the target gene is preferably one or more genes expressed on the surface of cells such as T cells or their progenitor cells (e.g., hematopoietic stem cells (HSCs) or other T cell progenitor cells, such as common lymphocyte progenitor cells or small lymphocytes). For example, the target gene may be a T cell-specific surface protein, such as CD52. Genes encoding other cell surface proteins may also be of interest, and therefore the invention contemplates environment-specific silencing of genes encoding cell surface proteins other than CD52. Appropriately, the target gene encodes any marker protein that is specific to a given cell type (e.g., an immune cell type). In some preferred embodiments, the target gene encodes a cell surface protein that is a target of antibodies for the depletion of immune cells or their progenitor cells (e.g., lymphocyte depletion), such that cells in which the target gene is silenced are protected from the effects of antibodies. As a non-limiting example, this method can be used to target one or more genes selected from those encoding CD117, CD27, CD45, CD90, CD110, and CD184. See, for example, Czechowicz et al. 'Selective hematopoietic stem cell ablation using CD117-antibody-drug-conjugates enables safe and effective transplantation with immunity preservation Nat Commun.' 2019 Feb 6; 10(1):617.

[0450] In some preferred embodiments, the target gene encodes CD52. In some preferred embodiments of the invention, CD52 is silenced in an environment-specific manner in activated T cells. In some embodiments, the genes encoding both B2M and CD52 are target genes for environment-specific silencing. In some embodiments, the target genes encoding both B2M and CD52 are downregulated in the same environment, for example, in T cells, in activated T cells, and / or in T cell progenitor cells. Environment-specific silencing of CD52 and / or B2M in activated T cells is a particularly preferred embodiment.

[0451] In some cases, it may be desirable to environment-specifically silence target genes in cells where other genes are constitutively silenced, such as by knockout or knockdown (e.g., via CRISPR). Constitutive silencing can also be achieved using GEiGS, for example, using silencing elements based on miRNA scaffolds with broad expression patterns (e.g., miRNAs expressed in T cells, in both active and quiescent T cells). For example, the method of the present invention can be used for environment-specific silencing of B2M in modified T cells or T cell progenitor cells (e.g., in active T cells) where CD52 has been constitutively silenced, such as by knockout (i.e., CD52-CAR-T cells).

[0452] CD52 silencing is particularly well-suited for cell therapies, such as cell-based cancer therapies, where anti-CD52 antibodies are used to "condition" the patient before the administration of therapeutic cells. A particularly important example is the use of anti-CD52 antibodies before allogeneic T-cell therapy, but anti-CD52 antibodies can also be used in allogeneic hematopoietic stem cell transplantation (HSCT). To illustrate, anti-CD52 antibodies (such as alemtuzumab) are administered to patients about to receive allogeneic CAR-T cell infusion or allogeneic HSCT. This treatment kills the patient's own T cells, creating a niche for the transplanted cells to expand and / or target the cancer after infusion. In patients receiving therapeutic CAR-T or HSC cells, CD52 silencing prevents the elimination of therapeutic cells by circulating anti-CD52 antibodies, thus providing a window for the therapeutic cells to survive and kill cancer cells. In some cases, environment-specific silencing of CD52 may be advantageous, for example, to reduce the risk of undesirable T cell phenotypes, since knocking out CD52 can lead to the production of dysfunctional T cells (see Kinsella, et al. 'CD52 / GPI-T-CellsAre Enriched for Alloreactive Specificity and Predict Acute Graft-Versus-Host-Disease After Stem Cell Transplantation', Transplantation and Cellular Therapy, Volume 27, Issue 6, 2021, Pages 475.e1-475.e9). Therefore, as described above, silencing CD52 in activated T cells is a particularly preferred embodiment of the invention. However, in other cases, constitutive silencing of CD52 may be desirable, for example, via CD52KO or via GEiGS using silencing elements based on miRNA scaffolds with broad expression patterns in T cells (i.e., expressed in both activated and quiescent T cells).See also Zhao et al., 'The Immunological Function of CD52 and its Targeting in Organ Transplantation', Inflamm. Res. (2017) 66(7):571–8; and Kamali et al., 'CRISPR / Cas9-mediated knockout of clinically relevant alloantigenes in human primary T cells', BMC Biotechnology (2021) 21:9, for more information on CD52 and its silencing. It should be understood that other immune cell markers associated with cell exhaustion can be targeted and silenced to protect cells from other cell exhaustion methods.

[0453] In other embodiments, one or more of CD117, CD27, CD45, CD90, CD110, and CD184 may be silenced in the cell constitutively or in an environment-specific manner. In some embodiments, B2M is silenced in an environment-specific manner, and one or more of CD117, CD27, CD45, CD90, CD110, and / or CD184 are also silenced in an environment-specific manner in the same environment as B2M. In some embodiments, B2M is silenced in an environment-specific manner, and one or more of CD117, CD27, CD45, CD90, CD110, and / or CD184 are constitutively silenced. CD117, CD27, CD45, CD90, CD110, and / or CD184 represent other targets of immune cell exhaustion.

[0454] In some approaches (such as allogeneic adoptive T-cell therapy), it may also be desirable to silence the endogenous T-cell receptor (TCR) to reduce tumor exogenous graft-versus-host disease (GvHD). Silencing of the endogenous TCR is typically permanent, for example, via knockout of the TRAC gene. Therefore, in some embodiments, the endogenous TCR is silenced in the cell, appropriately by knockout or otherwise silencing the TRAC gene, for example via GEiGS using a silencing element based on a miRNA scaffold with a broad expression pattern in T cells. However, silencing of the endogenous TCR can also be environment-specific, for example, where the TRAC gene is a target gene according to the invention. Therefore, in some embodiments, the TRAC gene is a target gene for environment-specific silencing, for example, for specific silencing in T cells or activated T cells.

[0455] In some embodiments, both CD52 and TCR are silenced in T cells. In some embodiments, CD52, TCR, and B2M are silenced in T cells. In some preferred embodiments, TCR is constitutively silenced, suitably by knocking out TCR in T cells (e.g., by knocking out the TRAC gene), or via GEiGS, for example using a silencing element based on a miRNA scaffold with a broad expression pattern in T cells (i.e., expressed in both activated and quiescent T cells). In some embodiments, TCR is knocked out in T cells, and CD52 and B2M are silenced in an environment-specific manner, suitably wherein CD52 and B2M are silenced in activated T cells. In some embodiments, TCR and CD52 are knocked out in T cells, and B2M is silenced in an environment-specific manner, suitably wherein B2M is silenced in activated T cells. Suitable methods for environment-specific silencing of target genes, generally in T cells or in activated T cells, are discussed herein.

[0456] Methods of modifying cells

[0457] In some implementations, the method includes a step of modifying cells to provide a nucleic acid construct suitable for expressing repressive RNA.

[0458] In some implementations, the method uses gene editing technology to provide repressive RNA molecules that are designed to target and interfere with the RNA molecule of interest (which may be endogenous or exogenous for eukaryotic cells, preferably endogenous for eukaryotic cells).

[0459] Some embodiments of the gene editing techniques of this invention include genome editing of repressive RNA molecules (e.g., endogenous ones), where the repressive RNA molecules are stable and heritable. The inventors use a genome editing-induced gene silencing (GEiGS) platform, which is capable of utilizing endogenous non-coding RNA molecules from eukaryotic cells, including, for example, RNA silencing molecules (e.g., siRNA, miRNA, piRNA, tasiRNA, tRNA, rRNA, antisense RNA, etc.), and modifying them to target any RNA target of interest. Using GEiGS, technicians can screen potential non-coding RNA molecules, edit a few nucleotides in these endogenous RNA molecules, thereby redirecting their activity and / or specificity to effectively and specifically target any RNA of interest, including, for example, mRNA encoding the B2M protein.

[0460] Therefore, a method is provided for inhibiting the translation of RNA transcripts derived from a target protein-coding gene (e.g., B2M) in a cell, the method comprising introducing an RNA editing agent into the cell that confers silencing specificity to a non-coding RNA molecule for a target RNA of interest, wherein the non-coding RNA molecule is modified such that its sequence is altered to target the RNA transcript of the target gene of interest, thereby modifying the translation of the RNA transcript into a protein molecule.

[0461] According to specific embodiments of the present invention, various non-limiting examples of genome editing methods and RNA editing agents for inhibiting the introduction of nucleic acid alterations into RNA molecules can be used.

[0462] Genome editing using engineered nucleases—a reverse genetics approach—uses engineered nucleases to typically cut and create specific double-strand breaks (DSBs) at desired locations in the genome, which are then repaired through endogenous cellular processes such as homologous recombination (HR) or non-homologous end joining (NHEJ). NHEJ directly joins the DNA ends of the DSB, with or without minimal end trimming, while HR uses a homologous donor sequence as a template (i.e., sister chromatids formed during S phase) to regenerate / replicate the missing DNA sequence at the break site. For a specific nucleotide modification to be introduced into the genomic DNA, a donor DNA repair template containing the desired sequence must be present during HR (exogenously provided single-stranded or double-stranded DNA).

[0463] Genome editing cannot be performed using traditional restriction endonucleases because most restriction enzymes recognize a few base pairs on the DNA as their targets, and these sequences are typically found at multiple locations in the genome, resulting in multiple cuts not limited to the desired location. To overcome this challenge and create site-specific single-strand or double-strand breaks (DSBs), several different classes of nucleases have been discovered and bioengineered to date. These nucleases include broad-spectrum nucleases, zinc finger nucleases (ZFNs), transcription activator-like effector nucleases (TALENs), and the CRISPR / Cas9 system.

[0464] Macronucleases—Macronucleases are generally classified into four families: the LAGLIDADG family, the GIY-YIG family, the His-Cys box family, and the HNH family. These families are characterized by structural motifs that influence catalytic activity and recognition sequences. For example, members of the LAGLIDADG family are characterized by having one or two copies of the conserved LAGLIDADG motif. These four macronuclease families vary considerably from one another in terms of conserved structural elements and therefore DNA recognition sequence specificity and catalytic activity. Macronucleases are typically found in microbial species and possess the unique property of having very long recognition sequences (>14 bp), thus they are naturally highly specific for cleavage at desired locations.

[0465] This can be used to generate site-specific double-strand breaks (DSBs) in genome editing. Those skilled in the art can use these naturally occurring broad-spectrum nucleases; however, the number of such naturally occurring broad-spectrum nucleases is limited. To overcome this challenge, mutagenesis and high-throughput screening methods have been used to generate broad-spectrum nuclease variants that recognize unique sequences. For example, various broad-spectrum nucleases have been fused to generate hybridases that recognize novel sequences.

[0466] Alternatively, the DNA-interacting amino acids of a broad range of nucleases can be altered to design sequence-specific broad range nucleases. Alternatively, broad range nucleases with site-specific cleavage characteristics can be developed using commercially available technologies (e.g., Precision Biosciences' Directed Nuclease Editor). TM (Genome editing technology) was used to obtain it.

[0467] ZFN and TALEN—two distinct classes of engineered nucleases, namely zinc finger nucleases (ZFN) and transcription activator-like effector nucleases (TALEN), have both been shown to be effective in generating targeted double-strand breaks (DSBs).

[0468] ZFN and TALEN restriction endonuclease technologies utilize nonspecific DNA-cutting enzymes linked to specific DNA-binding domains (a series of zinc finger domains or TALE repeat sequences, respectively). Restriction enzymes are typically chosen whose DNA recognition and cleavage sites are separate from each other. The cleavage moiety is separated and then linked to the DNA-binding domain, resulting in an endonuclease with very high specificity for the desired sequence. An exemplary restriction enzyme with this property is Fokl. Additionally, Fokl has the advantage of requiring dimerization to acquire nuclease activity, meaning that specificity is significantly increased when each nuclease partner recognizes a unique DNA sequence. To enhance this effect, Fokl nucleases have been engineered to function only as heterodimers and possess increased catalytic activity. Heterodimer-functionalized nucleases avoid the possibility of unwanted homodimer activity, thus increasing double-strand break (DSB) specificity.

[0469] Therefore, for example, to target specific sites, ZFN and TALEN are constructed as nuclease pairs, where each member of the pair is designed to bind an adjacent sequence at the target site. After transient expression in the cell, the nucleases bind to their target sites, and the Fokl domain heterodimerizes to generate double-strand breaks (DSBs). Repair of these DSBs via non-homologous end joining (NHEJ) typically results in small deletions or small indels. Because each repair performed by NHEJ is unique, using a single nuclease pair can generate a series of alleles with a range of different insertions or deletions at the target site.

[0470] Typically, NHEJ is relatively accurate (approximately 75%-85% of DSBs in human cells are repaired by NHEJ within about 30 minutes of detection). In gene editing, erroneous NHEJ is relied upon because when repair is accurate, the nuclease will continue cutting until the repair product is mutagenic and the recognition / cleavage site / PAM motif disappears / mutates, or the transiently introduced nuclease is no longer present. The length of deletions typically ranges from a few base pairs to hundreds of base pairs, but larger deletions have been successfully generated in cell culture by using two pairs of nucleases simultaneously. Furthermore, when a DNA fragment homologous to the target region is introduced along with a nuclease pair, double-strand breaks (DSBs) can be repaired via homologous recombination (HR) (e.g., in the presence of a donor template) to produce specific modifications.

[0471] Although the nuclease portions of ZFN and TALEN share similar properties, the difference between these engineered nucleases lies in their DNA recognition peptides. ZFN relies on the Cys2-His2 zinc finger, while TALEN relies on TALE. Both DNA recognition peptide domains are characterized by their natural presence in their proteins in combinatorial form. The Cys2-His2 zinc finger is typically found in repeating sequences spaced 3 bp apart and exists in various combinations in a variety of nucleic acid-interacting proteins. On the other hand, TALE is found in repeating sequences with a 1:1 recognition ratio between amino acids and the recognized nucleotide pairs. Because both zinc fingers and TALEs appear in repeating patterns, different combinations can be explored to generate a wide variety of sequence specificities. Methods for preparing site-specific zinc finger endonucleases include, for example, modular assembly (where zinc fingers associated with triplet sequences are linked in rows to cover the desired sequence), OPEN (in bacterial systems, low-strength-selective peptide domains are combined with triplet nucleotides, followed by high-strength-selective peptide combinations with the final target), and bacterial one-hybrid screening of zinc finger libraries. ZFN is also available from, for example, Sangamo Biosciences. TM Designed and commercially available (Richmond, CA).

[0472] The T-GEE system (TargetGene's genome editing engine) is provided—a programmable nucleoprotein molecular complex containing a polypeptide moiety and a specifically conferred nucleic acid (SCNA). This nucleoprotein molecular complex is assembled in vivo in target cells and is capable of interacting with a predetermined target nucleic acid sequence. The programmable nucleoprotein molecular complex can specifically modify and / or edit target sites within the target nucleic acid sequence and / or modify the function of the target nucleic acid sequence. The nucleoprotein composition comprises (a) a polynucleotide molecule encoding a chimeric polypeptide and including (i) a functional domain capable of modifying the target site, and (ii) a linker domain capable of interacting with the specifically conferred nucleic acid, and (b) a specifically conferred nucleic acid (SCNA) containing (i) a nucleotide sequence complementary to a region of the target nucleic acid flanking the target site, and (ii) a recognition region specifically linked to the linker domain of the polypeptide. This composition enables precise, reliable, and cost-effective modification of predetermined nucleic acid sequence targets by specifically conferred base pairing between the nucleic acid and the target nucleic acid, with the molecular complex exhibiting high specificity and binding ability to the target nucleic acid. The composition exhibits low genotoxicity, modular assembly, and the use of a single platform without customization. It can be used independently outside of dedicated core facilities and offers a shorter development timeframe and reduced costs.

[0473] The CRISPR-Cas system and all its variants (also referred to as “CRISPR” in this paper) – many bacteria and archaea contain an adaptive immune system based on endogenous RNA that degrades the nucleic acids of invading bacteriophages and plasmids. These systems consist of clusters of regularly spaced short palindromic repeat (CRISPR) nucleotide sequences that produce RNA components and CRISPR-associated (Cas) genes that encode protein components. CRISPR RNA (crRNA) contains short fragments homologous to the DNA of specific viruses and plasmids and acts as a guide to direct Cas nucleases to degrade the complementary nucleic acids of the corresponding pathogens. Studies of the type II CRISPR / Cas system in Streptococcus pyogenes have shown that the three components form an RNA / protein complex and together are sufficient to exert sequence-specific nuclease activity: the Cas9 nuclease, the crRNA containing 20 base pairs homologous to the target sequence, and the trans-activating crRNA (tracrRNA) (Jinek et al. Science (2012) 337:816-821).

[0474] This further demonstrates that the synthetic chimeric guide RNA (sgRNA), composed of a fusion between crRNA and tracrRNA, can guide Cas9 to cleave DNA targets complementary to crRNA in vitro. It was also demonstrated that transient expression of Cas9 bound to synthetic sgRNA can be used to generate targeted double-strand breaks (DSBs) in a variety of different species (Cho et al, 2013 (Targeted genome engineering in human cells with the Cas9 RNA-guided endonuclease. Nat Biotechnol. 2013; 31(3):230-232.); Cong et al, 2013 (Multiplex genome engineering using CRISPR / Cas systems. Science. 2013; 339(6121):819-823.); DiCarlo et al, 2013 (Genome engineering in Saccharomyces cerevisiae using CRISPR-Cas systems. Nucleic Acids Res. 2013; 41(7):4336-4343); Hwang et al., 2013a,b (Nature Biotechnology volume 31, pages227–229(2013); Heritable and precise zebrafishgenome editing using a CRISPR-Cas system.PLoS One.2013;8(7):e68708; Jinek etal., 2013 (RNA-programmed genome editing in human cells eLife2:e00471); Mali etal, 2013 (RNA-guided human genome engineering via Cas9.Science.2013Feb15;339(6121):823-6)).

[0475] The CRISPR / Cas system used for genome editing comprises two distinct components: sgRNA and a nuclease such as Cas9. The sgRNA (also referred to herein as short guide RNA) is typically a 20-nucleotide sequence encoding a combination of a target homologous sequence (crRNA) and endogenous bacterial RNA, which in a single chimeric transcript links the crRNA to the Cas9 nuclease (tracrRNA). The gRNA / Cas9 complex is recruited to the target sequence via base pairing between the sgRNA sequence and complementary genomic DNA / RNA. For successful Cas9 binding, the genomic target sequence must also contain the correct prototypical spacer adjacent motif (PAM) sequence immediately following the target sequence. The binding of the gRNA / Cas9 complex positions Cas9 to the genomic target sequence, allowing Cas9 to cleave both strands of DNA, resulting in a double-strand break (DSB). Double-strand breaks (DSBs) generated by CRISPR / Cas can undergo homologous recombination or NHEJ and are susceptible to specific sequence modifications during DNA repair.

[0476] The Cas9 nuclease has two functional domains: RuvC and HNH, each cleaving a different DNA strand. When both domains are active, Cas9 induces double-strand breaks (DSBs) in genomic DNA or RNA.

[0477] A significant advantage of CRISPR / Cas is the combination of the system's high efficiency and the ability to easily create synthetic sgRNAs. This results in a system that can be easily modified to target modifications at different genomic sites and / or different modifications at the same site. Furthermore, protocols capable of simultaneously targeting multiple genes have been established. Most cells carrying mutations have biallelic mutations in the target genes.

[0478] However, the apparent flexibility of base pairing interactions between the sgRNA sequence and the genomic DNA target sequence allows for imperfect matches with the target sequence via Cas9 cleavage.

[0479] Modified forms of Cas9 enzymes containing a single inactive catalytic domain (RuvC- or HNH-) are called "nicking enzymes." With only one active nuclease domain, a Cas9 nicking enzyme cleaves only one strand of the target DNA, resulting in a single-strand break or "nick." Single-strand breaks or nicks are primarily repaired by single-strand break repair mechanisms involving proteins such as, but not limited to, PARP (sensors) and the XRCC1 / LIG III complex (connectors). If single-strand breaks (SSBs) are generated by topoisomerase I poisons or by drugs that capture PARP1 on naturally occurring SSBs, these breaks may persist and become single-ended DSBs that can only be repaired by HR when the cell enters S phase and the replication fork encounters such an SSB. However, two proximal opposing strand cuts introduced by a Cas9 nicking enzyme are considered double-strand breaks, which is often referred to as a "double-nick" CRISPR system. Double nicks in nonparallel DSBs can be repaired by HR or NHEJ, much like other DSBs, depending on the desired action on the gene target, the presence of the donor sequence, and the cell cycle stage (HR is much less abundant and may only occur in the S and G2 phases of the cell cycle). Therefore, if specificity and reduced off-target effects are critical, using the Cas9 nickase to generate double nicks by designing two sgRNAs with very close target sequences and on opposite strands of the genomic DNA would reduce off-target effects, as either sgRNA alone would result in a nick that is unlikely to alter the genomic DNA, even if such events are not improbable.

[0480] Modified forms of Cas9 enzymes containing two inactive catalytic domains (dead Cas9 or dCas9) lack nuclease activity but can still bind to DNA specifically based on sgRNA. dCas9 can be used as a platform for DNA transcriptional regulators to activate or repress gene expression by fusing the inactive enzyme with a known regulatory domain. For example, the binding of dCas9 alone to a target sequence in genomic DNA can interfere with gene transcription.

[0481] Other variants of Cas9 that can be used by some embodiments of the present invention include, but are not limited to, CasX and Cpfl (also known as Cas12a). The CasX enzyme comprises a unique family of RNA-guided genome editors, is smaller in size compared to Cas9, and is found in bacteria (not typically in humans), thus making it less likely to trigger a human immune system / response. Furthermore, CasX utilizes a different PAM motif compared to Cas9, and can therefore be used to target sequences in which the Cas9 PAM motif is not found.

[0482] The CRISPR system can be fused with a variety of effector domains, such as DNA cleavage domains. DNA cleavage domains can be derived from any endonuclease or exonuclease. Non-limiting examples of endonucleases from which DNA cleavage domains can be derived include, but are not limited to, restriction endonucleases and homing endonucleases (see, for example, New England Biolabs Catalog or Belfort et al. (1997) Nucleic Acids Res.). In exemplary embodiments, the cleavage domain of the CRISPR system is a Fokl endonuclease domain or a modified Fokl endonuclease domain. Furthermore, the use of homing endonucleases (HEs) is another option. HEs are small proteins (<300 amino acids) found in bacteria, archaea, and single-celled eukaryotes. HEs are distinguished by recognizing relatively long sequences (14 bp–40 bp) compared to other site-specific endonucleases such as restriction enzymes (4 bp–8 bp). HEs have historically been classified by their small, conserved amino acid motifs. At least five such families have been identified: LAGLIDADG, GIY-YIG, HNH, His-Cys box, and PD-(D / E)xK, which are associated with EDxHD enzymes and are considered by some to be separate families. At the structural level, HNH and His-Cys box share a common fold (called bba-metal) with PD-(D / E)xK and EDxHD enzymes. Each family has different catalytic and DNA recognition strategies and is suitable for varying degrees of engineering to suit a variety of applications. Exemplary homing endonucleases that can be used according to some embodiments of the invention include, but are not limited to, I-Crel, I-Tevl, I-Hmul, I-Ppol, and I-Ssp68031.

[0483] Modified forms of CRISPR, such as death CRISPR (dCRISPR-endonuclease), can also be used for CRISPR transcriptional repression (CRISPRi) or CRISPR transcriptional activation (CRISPRa).

[0484] Other forms of CRISPR that can be used according to some embodiments of the present invention include genome editing using components from the CRISPR system along with other enzymes to directly insert point mutations into cellular DNA or RNA.

[0485] Therefore, according to one embodiment, the editing agent is a DNA editing agent. Preferably, the DNA editing agent comprises a DNA editing system. More preferably, the DNA editing system comprises a wide range of nucleases, zinc finger nucleases (ZFNs), transcription activator-like effector nucleases (TALENs), homology-directed repair (HDR), CRISPR-endonucleases, dCRISPR-endonucleases, or homing endonucleases.

[0486] According to one embodiment, the DNA editing agent does not include a nuclease. According to another embodiment, the DNA editing agent includes a nuclease. Suitably, in some embodiments, the nuclease is any one of Cas9, Cas12a, CasX, CasY, CasPhi, MAD7, or Cas13 or a functional variant thereof. According to a preferred embodiment, the nuclease is Cas9. According to another preferred embodiment, the nuclease includes a non-catalytically active nuclease.

[0487] According to another embodiment of the invention, the DNA editing agent is linked to a reporter molecule for monitoring expression in cells (e.g., eukaryotic cells). The reporter molecule may be a fluorescent reporter protein. The term "fluorescent protein" refers to a polypeptide that emits fluorescence and is generally detectable by flow cytometry, microscopy, or any fluorescence imaging system, and thus can be used as a basis for selecting cells expressing such proteins. Examples of fluorescent proteins that can be used as reporter proteins are, but are not limited to, green fluorescent protein (GFP), blue fluorescent protein (BFP), and red fluorescent protein (e.g., dsRed, mCherry, RFP). A non-limiting list of fluorescent reporter molecules or other reporter molecules includes proteins that can be detected by luminescence (e.g., luciferase) or colorimetric assays (e.g., GUS). According to a specific embodiment, the fluorescent reporter molecule is a red fluorescent protein (e.g., dsRed, mCherry, RFP) or GFP.

[0488] Cell therapy

[0489] This invention is applicable to a variety of therapeutic cells. In some preferred embodiments, the cells have reduced immunogenicity, for example, through environment-specific silencing of the MHC-I system. However, in many other settings, the silencing of other genes may be associated with modifying the cell's phenotype (e.g., promoting a pro-inflammatory or anti-inflammatory phenotype).

[0490] Therapeutic cells may be appropriately derived from pluripotent stem cell lines, such as embryonic stem cell lines or induced pluripotent stem cell lines. Other therapeutic cells may be appropriately derived from tissue-resident pluripotent stem cells or progenitor cells with different developmental origins, such as hematopoietic stem cells (HSCs, angiogenic cells), bone, cartilage, and adipose stem cells (mesenchyma, lateral plates), skeletal muscle stem cells (skeletal muscle (satellites), myocardium, epicardium), smooth muscle stem cells (perivascular cells), angiogenic endothelial stem cells, neural stem cells, glial progenitor cells, Müller glial cells, non-myelinating Schwann cells, hair follicle stem (protuberance) cells, liver stem cells, bile duct cells, epidermis (skin), basal epithelial stem cells in the proximal trachea / bronchioles and gastrointestinal (GI) tract, type II alveolar cells in the lungs, and renal mesenchyme.

[0491] These stem cells / progenitor cells are suitable for differentiation into fractionated cells, including but not limited to dendritic cells, lymphocytes, myeloid cells, erythrocytes, platelets, hematopoietic cells, pancreatic islet cells (e.g., β cells, α cells), hepatocytes (hepatocytes, bile duct cells), skeletal muscle cells (multinucleated myotubules), keratinocytes, cardiomyocytes (atria, ventricles), conduction cardiomyocytes, vascular smooth muscle cells, neurons, glial cells, choroidal cells of the pia mater, eye (corneal) cells, photoreceptor cells, retinal interneurons, retinal ganglion cells, mesenchymal cells, fibroblasts, lung cells, gastrointestinal cells, vascular cells, endocrine cells, or adipocytes.

[0492] Therapeutic cells are cells that are suitable for administration to a subject with the intention or expectation of providing the subject with some therapeutic benefit.

[0493] Non-limiting examples of specific cell and tissue therapies of interest in this invention include: replacement (regeneration, restoration) of the cornea, retinal cells (retinal ganglia, aprocesses, photoreceptors), retinal pigment epithelium; anti-inflammatory cell therapies for acute and chronic CNS injury and degeneration; neuronal replacements such as inhibitory interneurons; glial replacements for white matter degeneration and multiple sclerosis, neuropathic pain; therapeutic endocrine cells for regenerating pancreatic, thyroid, or adrenal function; therapeutic hepatocytes for detoxification; replacement (regeneration, restoration) of skeletal and cardiac muscle; and immune cells such as macrophages, (CAR) T cells, regulatory T cells, neutrophils, granulocytes, NK cells, NK / T cells, and eosinophils.

[0494] Therapeutic cells of the endocrine system preferably include enteroendocrine cells, and more preferably therapeutic enteroendocrine cells, such as cells of the pancreas, thyroid gland, parathyroid gland, pituitary gland, pineal gland, adrenal gland, thymus, and hypothalamus.

[0495] The preferred therapeutic cells for the pancreas are endocrine hormone-expressing cells (β cells, α cells, δ cells, ε cells, with β cells being the most preferred).

[0496] Preferred therapeutic macrophages are those that are anti-tumor and pro-inflammatory cells used in cancer treatment.

[0497] Other preferred therapeutic macrophages are anti-inflammatory, regenerative, angiogenic, and tissue remodeling macrophages for the treatment of chronic fibrotic diseases such as idiopathic pulmonary fibrosis, chronic kidney disease, non-alcoholic steatohepatitis (NASH), scleroderma, rheumatoid arthritis, ulcerative colitis, and myelofibrosis.

[0498] Preferred therapeutic T cells are anti-tumor effector cells or memory T cells used for refractory cancers, or alternative regulatory T cells used to treat autoimmune diseases such as psoriasis, systemic lupus erythematosus, multiple sclerosis, myasthenia gravis, and pernicious anemia.

[0499] Composition

[0500] The cells or cell populations of the present invention can be formulated for delivery in a composition. The compositions of the present invention suitably comprise the cells or cell populations of the present invention. The compositions may be provided in the form of a kit.

[0501] Therefore, in one embodiment of the invention, a composition comprising the cells or cell populations of the invention is provided. The compositions of the invention may also contain other compounds, which may be biologically active or non-biologically active. Suitably, the compositions of the invention are sterile compositions suitable for parenteral administration.

[0502] While many acceptable carriers known to those skilled in the art can be used in the compositions of the present invention, the optimal type of carrier will vary depending on the mode of administration. The compositions of the present invention can be formulated for any suitable mode of administration, including, for example, parenteral, topical, oral, nasal, intravenous, intracranial, intraperitoneal, subcutaneous, or intramuscular administration, preferably parenteral, such as intramuscular, subcutaneous, or intravenous administration. For parenteral administration, the carrier preferably comprises water and may contain buffers for pH control, stabilizers (e.g., surfactants and amino acids), and tonic modifiers (e.g., salts and sugars). If the composition is intended to be provided in lyophilized form for dilution upon use, the formulation may contain a lyophilization protectant, such as sugars, such as trehalose. For oral administration, any of the above-described carriers or solid carriers, such as mannitol, lactose, starch, magnesium stearate, sodium saccharin, talc, cellulose, glucose, sucrose, and magnesium carbonate, can be used.

[0503] Therefore, the compositions of the present invention may comprise buffer solutions (e.g., neutral buffered saline or phosphate buffered saline), carbohydrates (e.g., glucose, mannose, sucrose, or dextran), mannitol, proteins, polypeptides, or amino acids (such as glycine), antioxidants, antibacterial agents, chelating agents (such as EDTA or glutathione), solutes that make the formulation isotonic, hypotonic, or weakly hypertonic with the recipient's blood, suspending agents, thickeners, and / or preservatives. Alternatively, the compositions of the present invention may be formulated as lyophilized products.

[0504] The effective amount of cells isolated by this invention for transplantation or for treating disease conditions depends on many factors, such as tissue type, severity of the disease condition, transplant response, reason for transplantation, and the patient's age and overall health. The effective amount can be determined by a skilled researcher or clinician through routine practice. Because the transplanted cells have reduced immunogenicity, patients can tolerate relatively large numbers of cells to achieve the desired therapeutic effect. Alternatively, cells can be repeatedly transplanted at intervals until the desired therapeutic effect is achieved.

[0505] The administration route of the cells of this invention is not limited to any particular method. Exemplary delivery routes include, but are not limited to, intravenous, intramuscular, subcutaneous, intraperitoneal, percutaneous, intradermal, and subcutaneous routes. The cells of this invention can also be administered locally by injection. For example, the cells can be injected into injured joints, fractured bones, infarct sites, ischemic sites, or their surroundings.

[0506] In some specific embodiments, cells are administered via a delivery device (including, but not limited to, a syringe). For example, cells may be suspended in a solution or pharmaceutical composition contained in such a delivery device. The “solution” or “pharmaceutical composition” comprises a physiologically compatible buffer and optionally a pharmaceutically acceptable carrier or diluent in which the cells of the present invention remain viable. The use of such carriers and diluents is well known in the art. The solution includes, but is not limited to, physiologically compatible buffers such as Hank's solution, Ringer's solution, or physiologically buffered saline. Cells can be preserved in the solution or pharmaceutical composition for short-term storage without loss of viability. In some specific embodiments, cells are frozen for long-term storage without loss of viability according to cryopreservation methods well known in the art.

[0507] Aqueous injectable suspensions may contain substances that increase the viscosity of the suspension, such as sodium carboxymethyl cellulose, sorbitol, or dextran, but still maintain fluidity suitable for easy delivery via syringe injection. The solution is preferably sterile, stable under preparation and storage conditions, and free from microbial contamination from the use of substances such as parabens, chlorobutanol, phenol, ascorbic acid, thimerosal, etc. The cells contained in the solution may be stem cells or differentiated cells as described herein, in pharmaceutically acceptable carriers or diluents, and, as needed, in other components described above.

[0508] Cells can be administered systemically (e.g., intravenously) or locally (e.g., directly to myocardial defects under echocardiographic guidance, or by direct application to damaged tissue or organs accessible during open surgery). For injection, cells can be in injectable liquid suspensions or in biocompatible media that can be injected in liquid form and become semi-solid at the site of damage. Syringes, controlled endoscopic delivery devices, or other similar devices can be used, provided the needle lumen has a sufficient diameter (e.g., at least 30 gauge or greater) to avoid physical damage to the cells during delivery.

[0509] In some other embodiments, cells can be transplanted via a solid support (e.g., a planar surface or a three-dimensional matrix). The matrix or planar surface is surgically implanted into the appropriate site within the patient's body. For example, a patient requiring a pancreas transplant may have differentiated cells on a solid support surgically implanted into the peritoneum or portal vein of the liver. Exemplary solid supports include, but are not limited to, patches, gel matrices (such as those from Pharmacia-Upjohn). Polyvinyl alcohol sponge (PVA) collagen gel implants (such as IVALON, Unipoint Industries, High Point, NC, North Carolina) and other similar or equivalent devices. A variety of other encapsulation techniques can be used with the cells of this invention, such as WO 91 / 10470; WO 91 / 10425; U.S. Patent No. 5,837,234; U.S. Patent No. 5,011,472; U.S. Patent No. 4,892,538).

[0510] Various aspects of the present invention are further illustrated by the following non-limiting embodiments.

[0511] Example

[0512] introduction

[0513] Advantages of GEiGS

[0514] Since its discovery in the 1990s, RNAi has been used in various forms to silence desired target genes, primarily using oligonucleotides (siRNA) or ectopically expressed hairpins (shRNA). miRNA-based vectors for shRNA have been widely used—these vectors are mimics of endogenous miRNAs in which the stem sequence has been replaced with a selected shRNA sequence. Several scaffolds have been used, the most common being miR-30 (Fellmann et al., 2013). miR-30-based vectors are more effective than standard hairpin constructs in silencing targets and have a superior off-target profile, and are therefore now used in clinical applications of shRNA (Esrick et al., 2021).

[0515] In its current form, miR-based shRNAs are still implemented via ectopic expression, typically as lentiviral transgenes randomly integrated into the genome or integrated into safe harbor loci (such as AAVS1), where they are transcribed from exogenous regulatory elements. GEiGS, on the other hand, uses modifications to endogenous loci encoding silencing molecules to redirect the silencing specificity of silencing RNAs encoded at these loci, leveraging the expression programs of endogenous loci. This offers a significant advantage in inducing stable, tunable, programmable, and specific gene silencing.

[0516] 1. Stability. siRNA oligonucleotides are inherently transient, while shRNA can exhibit diverse expression due to transgene inactivation via epigenetic mechanisms. In contrast, endogenous loci are never unpredictably silenced, therefore GEiGS silencing RNA (sRNA) is stably expressed.

[0517] 2. Tunability. GEiGS allows for the retargeting of miRNA scaffolds with different expression levels, thus enabling the adjustment of GEiGS sRNA abundance according to cell engineering requirements. This is well known to be difficult to achieve with current RNAi methods and is not possible with CRISPR KO, which is inherently binary.

[0518] 3. Programmability. Importantly, GEiGS offers programmable gene silencing. By redirecting developmentally regulated or cell-state-specific miRNAs, GEiGS silencing can be programmed to deploy only when therapeutic cells reach a specific stage of differentiation.

[0519] 4. Specificity. It is important to ensure the retargeting of miRNA scaffold expression levels and therefore ensure... The abundance of sRNA in cells remains at physiological levels, and the normal biological pathways for sRNA production are not oversaturated, thus significantly reducing the incidence of off-target gene silencing effects. This contrasts sharply with shRNA and siRNA methods, the latter of which are known to produce artificial off-target gene effects.

[0520] GEiGS technology is deployed through the following workflow (see below) Figure 4 ):

[0521] 1. Computational design of silent components.

[0522] 2. Experimentally verify the silencing activity of silencing elements through ectopic expression.

[0523] 3. Gene editing of endogenous miRNA scaffolds in desired cell types.

[0524] Experimentally validated GEiGS silencing elements can be used for therapeutic applications, such as as lentiviral transgenes or edited into the genome to express from endogenous miRNA loci to silence, for example, B2M in primary human cells. More information on GEiGS can be found in WO2019 / 058253, WO2020 / 183414, and WO2020 / 183419.

[0525] As an alternative to GEiGS, a suitable repressor RNA construct can be inserted into the genome, for example, into a locus encoding one or more endogenous miRNAs. Such a method applicable to the present invention is described, for example, by Senis et al. ('TALEN / CRISPR-mediated engineering of a promoterless anti-viral RNAi hairpin into an endogenous miRNA locus'. Nucleic Acids Research, 2017, Vol.45, No.1e3 doi:10.1093 / nar / gkw805). Therefore, in some embodiments of the present invention, a promoterless sequence encoding repressor RNA can be inserted into an endogenous miRNA locus, preferably without disrupting or inactivating any endogenous miRNA.

[0526] Conditional low immunogenicity therapeutic cells:

[0527] Of particular interest in this invention are conditionally low immunogenic therapeutic cells. Cell therapy is a class of advanced medical therapies in which patients are treated by transplanting cells, which may or may not have been pre-engineered to enhance their function. Cell therapies such as bone marrow transplantation or blood transfusion are well-known examples of cell therapies that have existed in medicine for decades. However, recently, new cell therapies have been developed using genetic engineering techniques and have been successfully used for many different disease indications, such as diabetes, cancer, and blindness.

[0528] Cell therapy can be autologous, meaning the therapeutic cells originate from the patient being treated, or allogeneic, where the cells originate from an unrelated donor. Autologous methods have the advantage of maximizing the likelihood of successful implantation after transplantation, but they are expensive to prepare and may not be suitable for patients who cannot donate their cells for preparation or who are terminally ill.

[0529] In contrast, allogeneic cell therapy can, in principle, be produced more efficiently from healthy donors, thus reducing costs, and theoretically, can utilize readily available treatment methods for acute illnesses and newly diagnosed patients. However, allogeneic therapy currently requires aggressive immunosuppression to reduce the risk of transplant rejection. Even so, immunosuppression cannot guarantee graft rejection over a prolonged period. To become mainstream, allogeneic cell therapy must overcome the barrier of transplant rejection.

[0530] Transplant rejection is primarily driven by the host's adaptive immune system's response to a mismatch in the expression of major histocompatibility complex I (MHC-I complex) on the surface of transplanted cells. MHC proteins, also known as human leukocyte antigens, are encoded by a group of genes called the human leukocyte antigen (HLA) system. HLA genes are codominantly expressed and exhibit high polymorphism. The expression of many different alleles benefits the adaptive immune system's defense against cancer cells or pathogens such as viruses or bacteria. However, it is precisely this high polymorphism that constitutes a major obstacle to allogeneic transplantation, such as allogeneic cell therapy.

[0531] MHC-I is present on the surface of almost all human cells and, as discussed, plays a role in immune surveillance. Figure 1MHC-I plays a crucial role in recognizing self- and non-self MHC variants. MHC-I is a dimer of β2-microglobulin and the HLA chain. The HLA chain is highly polymorphic, meaning that individuals express a wide variety of dimer combinations within a population. Therefore, the immune system is trained to selectively tolerate only those MHC-I variants expressed by the individual. In a transplant setting, unless the donor and host express the exact same HLA variants (which is extremely unlikely unless close kinship is involved), the host immune system will recognize non-self MHC-I variants on the surface of donor cells and will generate a response (also known as alloimmunity). Therefore, MHC-I is a major source of immunogenicity in allogeneic transplantation.

[0532] Many approaches have been explored to overcome transplant rejection. Traditionally, transplant recipients are subjected to lifelong immunosuppression, which is not only not always effective but also makes them susceptible to serious diseases such as infectious diseases or cancer. Genetic engineering approaches have also been considered. One such approach is to generate hypoimmunogenic cells by completely knocking out (KO) MHC-I expression (see, for example, WO2012 / 145384). While this strategy successfully evades the host's adaptive immune response, it exposes the graft to rejection by innate immune system cells through the activity of natural killer (NK) cells. NK cells play a crucial role in the detection of abnormal cells and respond strongly to cells lacking MHC-I expression, as this is sometimes a marker of malignant cells. The complete absence of MHC-I is also known as the "self-deficient" phenotype, and these cells are effectively detected and lysed by NK cells. Mechanistically, this is triggered by the MHC-I molecule acting as an inhibitory ligand for NK cells. MHC-I KO cells require additional engineering to stably express tolerance ligands to avoid being killed by innate immune cells. Figure 2 ).

[0533] This invention aims to address this problem by generating conditionally hypoimmunogenic cells through environment-specific partial silencing of MHC-I. As discussed, the MHC-I complex is a heterodimer composed of hypervariable HLA proteins and β-2 microglobulin (B2M). By partially knocking down B2M expression, partial silencing of MHC-I occurs, which allows transplanted cells to evade rejection driven by both innate (NK-mediated) and adaptive (T-cell-mediated) immune systems.

[0534] One approach to generating conditionally hypoimmunogenic cells is to use repressive RNA, such as the gene silencing system induced by gene editing (GEiGS), to downregulate MHC-I expression to a level that prevents a significant adaptive immune response while still being sufficient to suppress NK cell-mediated responses.

[0535] The potential for partial MHC-I silencing has been demonstrated in in vivo studies, where hypoimmunogenic pancreatic islet cells were generated via siRNA-mediated MHC-I knockdown and subsequently transplanted into NOD mice, resulting in improved graft survival (Wang et al., 2012, Diabetes. 2012 Dec; 61(12):3247-54). While this study demonstrates the efficiency of RNAi-mediated gene silencing in partially silencing MHC-I, the transient nature of siRNA means this approach is not feasible for clinical application. On the other hand, GEiGS, for example, would be perfectly suited for this approach because it has the potential to provide stable and tunable silencing.

[0536] However, the risk of low-immunogenic therapeutic cells is that, because they are highly adapted to evade the immune system, they will not be targeted by the immune system if they migrate and / or dedifferentiate, for example, from their intended location. This is a particularly worrying problem because therapeutic cells may dedifferentiate, for example, revert to an earlier stage of differentiation, at which point they may be more likely to proliferate and / or migrate away from their intended location.

[0537] Therefore, it would be advantageous to conditioned low immunogenicity on cells being in their desired environment (i.e., at their desired level of differentiation and / or in their desired location).

[0538] Therefore, in some implementations, the cells are conditionally low immunogenic cells, typically low immunogenic therapeutic cells.

[0539] In some implementations, the RNA targeting B2M (e.g., containing a sequence according to any one of SEQ ID NO:1-17) is inhibited and has selective activity in therapeutic cells in the desired environment.

[0540] For example, in the desired environment, the B2M-targeting repressive RNA is expressed in cells at a level of at least 1000 RPM, at least 2000 RPM (number of reads per million mapped reads), at least 3000 RPM, at least 4000 RPM, at least 5000 RPM, at least 10000 RPM, at least 20000 RPM, or at least 50000 RPM, or at least 100000 RPM. Preferably, in the desired environment, the repressive RNA is expressed in cells at a level of at least 50000 RPM or at least 100000 RPM.

[0541] In pancreatic tissue, hsa-miR-375, hsa-miR-143, and hsa-miR-21 were expressed at particularly high levels (189,993.6 RPM, 186,579.2 RPM, and 65,231.3 RPM, respectively, according to the miRmine database), while a number of other miRNAs were also expressed at significant but more moderate levels (e.g., hsa-miR-30d, hsa-miR-192, hsa-miR-30a, hsa-miR-182, hsa-miR-148a, hsa-miR-127, hsa-miR-200c, etc.).

[0542] In some embodiments, the repressor RNA is hsa-miR-375, hsa-miR-143, or hsa-miR-21, which have been modified to target B2M. In some embodiments, the repressor RNA is hsa-miR-30d, hsa-miR-192, hsa-miR-30a, hsa-miR-182, hsa-miR-148a, hsa-miR-127, or hsa-miR-200c, which have been modified to target B2M.

[0543] In one exemplary embodiment of the invention, the target gene is B2M. In some embodiments of the invention, when compared with control cells, the expression of B2M in cells in a first environment is modified in the range of 1%-90%, optionally 5%-90%, optionally 10%-90%.

[0544] According to the present invention, B2M expression can be modified, degraded, reduced, or silenced. In any embodiment of the invention, B2M expression is modified in the range of 1%-90%, optionally 5%-90%, optionally 10%-90%. Suitably, for example, compared with control cells, protein expression is modified in the ranges of 1%-80%, 1%-70%, 1%-60%, 1%-50%, 1%-40%, 1%-30%, 1%-20%, 1%-10%, 1%-5%, 5%-80%, 5%-70%, 5%-60%, 5%-50%, 5%-40%, 5%-30%, 5%-20%, 5%-10%, 10%-80%. The expression levels are within the ranges of 10%-70%, 10%-60%, 10%-50%, 10%-40%, 10%-30%, 10%-20%, 20%-90%, 30%-90%, 40%-90%, 50%-90%, 10%-20%, 20%-30%, 30%-40%, 40%-50%, 50%-60%, 60%-70%, 70%-80%, or 80%-90%. One advantage of this invention is that, compared to control cells, those skilled in the art can adjust (typically reduce) protein expression as desired, e.g., adjust it to an appropriate level. In some embodiments, the expression level of B2M or any other cell surface protein in the cells is determined by the amount of B2M or other proteins expressed on the cell surface. The amount of B2M present on the cell surface can be determined by various conventional techniques, such as flow cytometry.

[0545] In some embodiments of the invention, when cells expressing pancreatic endocrine hormones are altered as mentioned, the repressive RNA becomes inactive or less active, and thus can no longer silence the expression of B2M or HLA-A / B / C and becomes immunogenic.

[0546] Environment-specific gene silencing in immune cells:

[0547] As described above, in some embodiments of the present invention, the inhibitory RNA has specific activity in immune cells, for example, in specific types of immune cells or in immune cells in a specific activated or polarized state.

[0548] For example, the tumor microenvironment (TME) presents unique challenges for developers of CAR-T and other engineered immune effector cell therapies. Solid tumors are composed of a variety of other cells besides the cancer cells themselves, such as the stroma (cancer-associated fibroblasts (CAF)) and immune cells, such as macrophages and T cells (helper, cytotoxic, and regulatory). Solid tumors create a microenvironment that allows them to recruit, control, and suppress immune effector cells to maintain immune tolerance and promote tumor growth. There is evidence that TMEs can disrupt the activity of tumor-infiltrating T cells, even those engineered to be highly active against tumors expressing specific antigens (Sterner RC, Sterner RM. CAR-T cell therapy: current limitations and potential strategies. Blood Cancer J. 2021 Apr 6; 11(4):69. doi:10.1038 / s41408-021-00459-7.PMID:33824268;PMCID:PMC8024391). Tumor cells use cytokines, immune checkpoint signals, and metabolic intermediates as signals to maintain tolerance. Metabolic intermediates are effective signals for cell differentiation in immune cells, such as lactate produced by tumor cells (Colegio OR, Chu NQ, Szabo AL, Chu T, Rhebergen AM, Jairam V, Cyrus N, Brokowski CE, Eisenbarth SC, Phillips GM, Cline GW, Phillips AJ, Medzhitov R. Functional polarization of tumor-associated macrophages by tumor-derived lactic acid. Nature. 2014 Sep 25; 513(7519):559-63. doi:10.1038 / nature13490.Epub). (2014 Jul 13. PMID:25043024; PMCID:PMC4301845) has been shown to polarize macrophages into an immunosuppressive state—tumor-associated macrophages (TAMs)—through a HIF1α-dependent mechanism, which can play an important role in tumor growth. CAFs and extracellular matrix generated in the TME of high-grade cancers also contribute to the production of immunomodulatory phenotypes that support tumor growth (Puttock et al., 2022.bioRxiv.doi.org / 10.1101 / 2022.08.11.503568).Extracellular matrix (ECM) remodeling is associated with aggressive cancer, the establishment of an immunosuppressive environment, and adverse clinical responses to immunotherapy (Chakravarthy et al 2018. Nature Comms. 9, 4692, doi:10.1038 / s41467-018-06654-8). These ECM components are positively correlated with tumor-associated macrophage (TAM) infiltration.

[0549] TAMs are a key cell type in the TME and are abundant in solid tumors. This is a state of alternative activation (M2-like) and is associated with poor prognosis in various malignancies, including ovarian cancer (Zhang et al. 2014. J Ovarian Res7, 19, doi:10.1186 / 1757-2215-7-19). TAMs are widely considered key cell types for establishing and maintaining immune-tolerant TMEs. They are currently targets of several anticancer therapies (PI3K-γ inhibitor Eganelisib, InfinityPharm. https: / / www.infi.com / home / our-development-program / ipi-549 / ). TAMs are crucial for the generation of immunosuppressive TMEs, and they achieve this by producing cytokines, chemokines, growth factors, and triggering inhibitory immune checkpoint proteins in T cells. Multiple pathways within the TME contribute to macrophage polarization into TAMs.

[0550] Therapeutic CAR-T cells are suppressed in the TME via a similar pathway. TILs and CAR-T cells achieve tolerance through the activity of immune checkpoint pathways such as PD-1 (PDCD-1), CTLA4, LAG3, and TIM3.

[0551] Different states of immune cells are associated with different metabolic programs due to their different energy requirements, and their fate can be affected by altering their cellular metabolism (Chang CH, Curtis JD, Maggi LBJr, Faubert B, Villarino AV, O'Sullivan D, Huang SC, van der Windt GJ, Blagih J, Qiu J, Weber JD, Pearce EJ, Jones RG, Pearce EL. Cell. 2013 Jun 6;153(6):1239-51. doi:10.1016 / j.cell.2013.05.016.). Studies have shown that mitochondrial structure controls cell metabolism and affects cell fate (Buck MD, O'Sullivan D, Klein Geltink RI, Curtis JD, Chang CH, Sanin DE, Qiu J, Kretz O, Braas D, van der Windt GJ, Chen Q, Huang SC, O'Neill CM, Edelson BT, Pearce EJ, Sesaki H, Huber TB, Rambold AS, Pearce EL. Cell. 2016 Jun 30;166(1):63-76. doi:10.1016 / j.cell.2016.05.035. Epub 2016 Jun 9).

[0552] Promoting mitochondrial fusion increases oxidative phosphorylation and fatty acid oxidation in activated antitumor T cells, which is beneficial for the formation of memory T cells, thereby improving the persistence of antitumor activity. Inhibition of the DRP1 gene promotes mitochondrial fusion (preventing its division) and leads to increased oxidative phosphorylation and fatty acid oxidation.

[0553] Other metabolic targets that regulate T cell fate include mammalian target of rapamycin (mTORC1). Drug inhibition of mTORC1 increases fatty acid oxidation and the formation of memory T cells, while complete knockout of the gene is undesirable because it reduces the formation of memory and effector T cells.

[0554] In solid tumors, antagonism of a single pathway or combined inhibition of disease pathways is unlikely to prevent TAM formation. Macrophage polarization toward TAM is miRNA-dependent, as macrophage-specific loss in DICER completely blocks this process (Baer C, Squadrito ML, Laoui D, Thompson D, Hansen SK, Kiialainen A, Hoves S, Ries CH, Ooi CH, De Palma M. Suppression of microRNA activity amplifies IFN-γ-induced macrophage activation and promotes anti-tumour immunity. Nat Cell Biol. 2016 Jul; 18(7):790-802. doi:10.1038 / ncb3371), and T cell activation induces the expression of specific miRNAs. GEiGS-modified cells enable inducible and conditional target silencing, making combination cell immunotherapy possible.

[0555] Modified (e.g., GEiGS-modified) macrophages or T / CAR-T cells can utilize changes in miRNA expression induced in response to the tumor microenvironment (TME). TME-responsive (e.g., GEiGS-modified) macrophages expressing appropriate repressive miRNAs can promote pro-inflammatory programs within the TME, thereby promoting the activation of tumor-infiltrating lymphocytes (TILs) and other T cells (CAR-Ts). MiRNA loci in the TME, or normally induced or upregulated by the TME, can be redirected to silence their targets, thereby preventing or reversing the TAM state and promoting a pro-inflammatory phenotype. The maintenance of the pro-inflammatory polarization state is conditioned by exposure to TME cues. If cells escape the solid TME, the miRNAs driving the pro-inflammatory phenotype will be downregulated, and systemic immune-related extratumor toxicity (e.g., cytokine release syndrome) will be avoided. Other approaches utilize constitutively induced pro-inflammatory macrophage polarization, but lack controls to prevent unintended detumoritoxic effects.

[0556] In treatment, generating T / CAR-T cells that respond to the TME is also beneficial. Modified (e.g., GEiGS-modified) T cells will detect the presence and silencing of TME signals, such as PD-1 (PDCD-1), CTLA4, LAG3, or TIM3, thereby blocking the activity of these immune checkpoint pathways. Other approaches are based on constitutive silencing of these checkpoints, but this can lead to severe immune-related adverse reactions (cytokine release syndrome) in patients. Furthermore, conditional silencing of DRP1 via redirected miRNAs, and conditional (e.g., GEiGS-mediated) blockade of mitochondrial division in the TME, is beneficial for the differentiation and persistence of memory T cells, while allowing mitochondrial dynamics to continue and contributing to mitochondrial homeostasis (such as mitophagy).

[0557] Modifications to such cells as described herein (e.g., GEiGS modification) would allow these pathways to be specifically silenced only when immune cells (e.g., T cells or macrophages) arrive at the tumor.

[0558] These are just some of the potential applications of the invention described herein, and those skilled in the art can apply the method in many other cell types and environments.

[0559] Example 1—Computational Design of GEiGS Silent Components

[0560] The computational pipeline was used to generate B2M silencing elements. The pipeline inputs for B2M-targeting GEiGS were: the B2M mRNA sequence (GenBank accession number: NM_004048.4), the human genome reference sequence (GRCh38), miRNA annotation (miRbase v22), and cell type-specific miRNA quantification.

[0561] The expression of miRNAs in human iPSCs and ESCs was quantified using publicly available next-generation sequencing (NGS) datasets: ENCODE accession numbers ENCSR958UOC and ENCSR430YFL.

[0562] The computational pipeline generated 50 instances that were expected to silence B2M. A short list of silent components. The silencing element design consists of a modified sequence of an endogenous pre-miRNA (hairpin) (also known as an endogenous miRNA scaffold) that is modified to encode a novel silencing RNAi trigger instead of its natural guide strand. The silencing RNA matches B2M mRNA through sequence complementarity and is predicted to cause B2M silencing through the RNA interference pathway.

[0563] The silencing element design process also generates a corresponding negative control construct (also known as a "virtual" silencing element), which corresponds to... The same endogenous miRNA scaffold in the silencing element was modified, but expression was different. Scrambling sequence of silent RNA.

[0564] Example 2—Validation of GEiGS silencing element silencing activity via plasmid-based ectopic expression

[0565] Nineteen designs (17 B2M GEiGS silencing elements and 2 “virtual” controls) were used to generate extended GEiGS silencing elements. Each extended silencing element consists of a GEiGS silencing element designed using a computational pipeline, plus 50-150 bases of genomic sequence flanking the endogenous pre-miRNA on which the corresponding GEiGS silencing element is based. Extended silencing elements were included to avoid omitting important sequences that serve as the signaling pathway for the enzyme Drosha.

[0566] The silent components tested are as follows:

[0567] Table 4. Computationally designed RNAi trigger sequences targeting B2M and sequences of GEiGS silencing elements

[0568]

[0569] The sequence of the extended silencing element is as follows [SEQ ID NO:#]:

[0570] hsa-mir-302a_11_B2M-exon2-2

[0571] GCCAGCACACCTTTTGTTACAAAATTTTTTTGTTATTGTGTTTTAAGGTTACTAAGCTTG

[0572] TTACAGGTTAAAGGATTCTAACTTTTTCCAAGACTGGGCTCCCCACAAGATTGGAGAG

[0573] AGTATTGAAACTTTGAAACTAAAGAAGTTTCAATTCTCTCTCCATTCTTCTGGTAAGTC

[0574] TTCCTTTTACATTTTTATTATTTTTTTAGAAAATAACTTTATTGTATTGACCGCAGCTCAT ATATTTAAGCTTTATTTTGTATTTTTACATCTGTTA

[35]

[0575] >hsa-mir-302a_35_B2M-exon4

[0576] GCCAGCACACCTTTTGTTACAAAATTTTTTTGTTATTGTGTTTTAAGGTTACTAAGCTTGTTACAGGTTAAAGGATTCTAACTTTTTCCAAGACTGGGCTCCCCACGGGGTAAAATTTAGTAATATAACTTTGAAACTAAAGAAGTTATATTTCTAAATTTTCCCCCATGGTAAGTCTTCCTTTTACATTTTTATTATTTTTTTAGAAAATAACTTTATTGTATTGACCGCAGCTCATATATTTAAGCTTTATTTTGTATTTTTACATCTGTTA

[36]

[0577] >hsa-mir-302c_12_B2M-exon2-2

[0578] TTTACTTCTCCAAAATAGAACACGCTAACCTCATTTGAAGGGATCCCCTACATTTTAGTTGACTTACTGCAGCTGTGTGAAACAAAAGTTTCAGTAAGTCAACTTCAATGTAGGTGTCTCCAAGCCAGCACACCTTTTGTTACAAAATTTTTTTGTTATTGTGTTTTAAGGTTACTAAGCTTGTTACAGGTTAAAGGATTCTAACTTTTTCCAAGA

[37]

[0579] >hsa-mir-302c_36_B2M-exon4

[0580] TTTACTTCTCCAAAATAGAACACGCTAACCTCATTTGAAGGGATCCCCTATGTATTGTTATAATAATGTCAGCTGTGTGAAACAAAAGTTAACATTATTATAACCCTACATAGGTGTCTCCAAGCCAGCACACCTTTTGTTACAAAATTTTTTTGTTATTGTGTTTTAAGGTTACTAAGCTTGTTACAGGTTAAAGGATTCTAACTTTTTCCAAGA

[38]

[0581] >hsa-mir-20a_29_B2M-exon4

[0582] GAATGATTTTTACTAATTTTGTGTACTTTTATTGTGTCGATGTAGAATCTGCCTGGTCTATCTGATGTGACAGCTTCTGTAGCACTAACAAATTTCCAATAATCCTGTTGTTTAGTTATACAGATTATTGGAAATTTGTAAAGTACTGCTAGCTGTAGAACTCCAGCTTCGGCCTGTCGCCCAATCAAACTGTCCTGTTA

[39]

[0583] >hsa-mir-200c_27_B2M-exon4

[0584] AGCAGGGCTCACCAGGAAGTGTCCCCAGGGACTCGGGTGGTGGGGGGATGGGAGCCAGGGATCTGCAGCTTTTCCGCAGGGATCCTGGGCCTGAAGCTGCCTGACCCAAGGTGGGCGGGCTGGGCGGGGGCCCACTGACTTCTTAATAATTCTTGGGTGCGGTTGGGAGTCTCT

[0585] AGAATTATAAAGAAGATCATGTGGCCCCTGTCCCTGTGTCAGCAACATCCATCGCCTCAGGTCCCCAGCCCTTAGCTGGCTGCAGCCCCCTCCCCACTTCCCACGCACCCCGGAAGCCCCTCGTCTTGAGCTGAGAGCGTTGCACAAGGGGTGG

[40]

[0586] >hsa-mir-21_30_B2M-exon4

[0587] GTTCGATCTTAACAGGCCAGAATGCCTGGGTTTTTTTGGTTGTTTTTGTTTTTGTTTTTTTATCAAATCCTGCCTGACTGTCTGCTTGTTTTGCCTACCATCGTGACATCTCCATGGCTGTACCACCTTGTCGGGTGTTAACATTATTATAACCCTACTGTTGAAT CTCATGGAGGGTCATAATATGTTAACATCTGACATTTTGGTATCTTTCATCTGACCATCCATATCCAATGTTCTCATTTAAACATTACCCAGCATCATTGTTTATAATCAGAAACTCTGGTCCTTCTGTCTGGTGGCACTTAGAGTCTTTTGTGCCATAATGCA

[41]

[0588] >hsa-mir-363_41_B2M-exon4

[0589] TATCGTCTTATTTTAACTTTTAAAAGCCGTAAGTTCTGATATTTAGTCATTGTAAAATGATCTGTTTTGCTGTTGTCAAAATGTACAGTATATAATATTGATGAGTATCATAGGAGAAATATTATAACCCTACATTTTGTGAACCGCAGGACCTTTGTTGGCGACATTCCTGATCAGCGCTACAGTAAGCTAGATGGTAAAAAATCCTTTCTCTAGTTGCTGCTATTAAAAAAATAATTTGAAATATATTTGGATTTCTAAAAACTATGATAGCTA

[42]

[0590] >hsa-mir-93_19_B2M-exon2-2

[0591] AGGCCTTTTCCCCACTTCTTAACCTTCACTGAGAGGGTGGTTGGGGTCTGTTTCACTCCATGTGTCCTAGATCCTGTGCTACAGACCTTCCTTTCTGTCCTCCCGTCTTGGACCTCAGTCCTGGGGGCTCTTCAGTGTAGTACAAGAGATAGATGTGATTACCCAACTCTTCTCTGTACTTACACTGCCCGAGCCCCCGGGACACGTTCTCTCTGCCAATTGTCTTCTTGGCTGAGCTCCCCAAGCTCCATCTGTCATGCTGGGGAGCCCAGTGGCGTTCAAAAGGGTCTGGT

[43]

[0592] >hsa-mir-93_49_B2M-exon4

[0593] AGGCCTTTTCCCCACTTCTTAACCTTCACTGAGAGGGTGGTTGGGGTCTGTTTCACTCCATGTGTCCTAGATCCTGTGCTACAGACCTTCCTTTCTGTCCTCCCGTCTTGGACCTCAGTCCTGGGGGCTCTTACTTTATCAAATGTATAAGAATGTGATTACCCAACTTCTATAATTTGTATAAAGTCCCGAGCCCCCGGGACACGTTCTCTCTGCCAATTGTCTTCTTGGCTGAGCTCCCCAAGCTCCATCTGTCATGCTGGGGAGCCCAGTGGCGTTCAAAAGGGTCTGGT

[44]

[0594] >hsa-mir-106a_20_B2M-exon4

[0595] TTTACTTGTTTAGTTTCTAATATGTGTGTGTTTGTTTTGTTGTTTTAACCAGGTGAGTCTGCATGGATCTGTGAGGACGGAAAAGAAGAGCTCCTGGAAGACTTAAAATTTTGCTACAGGAATAGGCCTTGGCCATGTTAAATTTTCCCCCAAATTCTAAGCTTTTTGAGATCTTGAATTAGGGGGAAAATTCTAACATTACCATGGTGATTTAGTCAATGGCTACTGAGAACTGTAGTTTGTGCATAATTAAGTAGTTGATGCTTTTGAGCTGCTTCTTATAATGT

[45]

[0596] >hsa-mir-106b_21_B2M-exon4

[0597] TGCTGGCTATCCTGCGCCTTTCCACTGCTCTGGTAAGTGCCCAAATTGCTGGAGGGCCATCTGTTTTGACCCTTAAAGGGGTAGCTCCTTACCGTGCTCTCATTGCCGCCTCCCCACCTCCCGCTCCAGCCCTGCCGGGGCTATATGACAAAATGTTTCATTCGTGGTCCTCTCCGTGCGACCAAACATTGTGTCATAGCTGCTCCAGCAGGGCACGCACAGCGTCCGTGGAGGGAAAGGCCTTTTCCCCACTTCTTAACCTTCACTGAGAGGGTGGTTGGGGTCTGTTTCACTCCATGTGTCCTAGATCCTGTGCTACAGACCTTCCTTTCTGTCCTCCCG

[46]

[0598] >hsa-mir-191_8_B2M-exon2-2

[0599] GTCTTGTTCCCTCTAGACTCCGTTTCACAACCTACTCCCGGGTCTTCCTCCTGGGACTGGGGATGGGCGGGTTCTGATGTGGCCCCAGGGCGAGTGACCTGGGGGCAGGAGCTCCCCCGCCCCCCGCCAACGGCTGGACAGCGGGTTCAGTGTAGTACAAGAGATAGATTGTCTCCAGAGCATTCTCTATCTGCTGACTACACTGCCCCTGCTCTCCTGCCTGAGCAGCGCCCTGGCCCAGATGGGGTGCCCCTGACCCCCAGACATACTTTACTGAGCTGCTTGGGTCTCAGTTCCTCTCAGTTGCGCCCTCAGGCTGGAGGTGATGGGTGTAGACGTGGGAGAGCCGAGG

[47]

[0600] >hsa-mir-191_26_B2M-exon4

[0601] GTCTTGTTCCCTCTAGACTCCGTTTCACAACCTACTCCCGGGTCTTCCTCCTGGGACTGGGGATGGGCGGGTTCTGATGTGGCCCCAGGGCGAGTGACCTGGGGGCAGGAGCTCCCCCGCCCCCCGCCAACGGCTGGACAGCGGGTACTTTATCAAATGTATAAGAAGTTGTCTCCAGAGCATTCCTTCTTAGCCATTGATAAAGCCCCTGCTCTCCTGCCTGAGCAGCGCCCTGGCCCAGATGGGGTGCCCCTGACCCCCAGACATACTTTACTGAGCTGCTTGGGTCTCAGTTCCTCTCAGTTGCGCCCTCAGGCTGGAGGTGATGGGTGTAGACGTGGGAGAGCCGAGG

[48]

[0602] >hsa-mir-744_47_B2M-exon4

[0603] CATTAACATGTTTTAAACTTCAGGCCCTTCTACTGCCAAGGTGAGTTCAGGCTGGGCGGCTGCACCCCTGGGAGCAGGGCAGTGCTGCACTGAGCCAGGCGGGAGCTGGAAGAAGACGCAGCACACTGGGTTGGGCAAGGTAACTATCTTAACAAGCTTTGAGTCTTACTGAAGGTTTCCTGGAAACCACGCACATCAAAGCTGTATAAAATAGAACCTTACTCGGTCCTGACCGGCTCGGCTTCTGTTTGTTTATTTCATCTCTACTCAGTACTGCCCTGTTCCCTGGTTTTAAAGTTGTACTGAAATGCATACCTTGTGATAATGTTGTCACATTTTGTCCTTATTGTGTCGTGCC

[49]

[0604] >hsa-mir-518b_43_B2M-exon4

[0605] TTTATGTTCTGGATTCCAGAAAACATGCAAACAGGGCAAATAAATGCATCTTTATTTTGTGTCCATTTTAACCTGGTCAAGGAAAATTCCAACAGCAACATCAAAAAACCAGTGTTGGAGCAAGAATATGTCATGCTGTGGCAGTTCAGCGTGAATAAGTTTCAATTGTCTGAAAGAAAATTAACTTATGCACGCTTAACTATTACGGTTTGAGTAAAGCAGCGTTGAAGTTGATGCTGATCTTGGTAATACATTTGCAGAGCGTGCTTATCATCAGACGTGGACGATGGTGGGGTTCTGTTTTGGTTTTGTTTTTTTCTAAGACAGGGTCTCCGTTGCCCAG

[50]

[0606] >hsa-mir-99b_50_B2M-exon4

[0607] CTTCTGGGTTCTTTAGGGAGGAGGGGGATGAGAGCCTTGACTCCAGGGTCCCTGATGAGGAAGGGGCTGAGGGCCTGGACTCCTGGGTTCCTTGGGGAGGAGGGGCCGGGGGCCCGGACTCCTGGGTCCTGGCACCTTTATCAAATGTATAAGAAGTAGGGCCTTCGCTACTCACATCCTATTGATTTGATAACCGTGTCGGGGGCTCACCATCGCGGCTGGGGCCTCCCCGGCCCTCCCCCTCATCCCTGGTCCTCCTGGTCCCTGTCTGTCTGTCTGTCGGGTCTGTCCACC

[51]

[0608] >hsa-mir-302a_23_No (negative control)

[0609] GCCAGCACACCTTTTGTTACAAAATTTTTTTGTTATTGTGTTTTAAGGTTACTAAGCTTGTTACAGGTTAAAGGATTCTAACTTTTTCCAAGACTGGGCTCCCCAACCCTTTAACTAAACAACAACAAACAGGAAACAAAATTGTTTGTTGTGGTTTAGTTGTGGGGATGGTAAGTCTTCCTTTTACATTTTTATTATTTTTTTAGAAAATAACTTTATTGTATTGACCGCAGCTCATATATTTAAGCTTTATTTTGTATTTTTACATCTGTTA

[56]

[0610] >hsa-mir-200c_13_No (negative control)

[0611] AGCAGGGCTCACCAGGAAGTGTCCCCAGGGACTCGGGTGGTGGGGGGATGGGAGCCAGGGATCTGCAGCTTTTCCGCAGGGATCCTGGGCCTGAAGCTGCCTGACCCAAGGTGGGCGGGCTGGGCGGGGGCCCGTTCCGATTTAACGACGTAATGGGTGCGGTTGG GAGTCTCTTTACGTCGATAAATCAGGACACGGCCCCTGTCCCTGTGTCAGCAACATCCATCGCCTCAGGTCCCCAGCCCTTAGCTGGCTGCAGCCCCCTCCCCACTTCCCACGCACCCCGGAAGCCCCTCGTCTTGAGCTGAGAGCGTTGCACAAGGGGTGG

[57]

[0612] In addition to the negative control constructs listed in Table 4 above, the other miR30-based constructs were purchased from VectorBuilder (negative control 0).

[0613] The extended silencing element was synthesized and cloned into a custom expression plasmid (plasmid VB210602-1567ytv, see [link]). Figure 5 The plasmid is a mammalian expression system in which the EF1 alpha (EF1a) promoter drives the transcription of the extended GEiGS silencing element. On the same plasmid, DsRed Express 2 (DsRed) cDNA is expressed from the human PGK (hPGK) promoter. Upon transfection into mammalian / human cells, both the GEiGS silencing element and the DsRed cDNA are transcribed. DsRed can be used as a transfection marker to indicate successfully transfected cells. The expression level (fluorescence intensity) of DsRed in cells can be determined by flow cytometry and can be used as a surrogate for the expression level / abundance of the GEiGS silencing element.

[0614] The cloned silencing element was individually transfected into the human iPSC line WTC-11 (Allen Institute of Cell Science) via nuclear transfection (Lonza). The expression of GEiGS sRNA in the transfected cells was measured by qPCR and compared with the expression of the corresponding endogenous miRNA scaffold. This indicates that GEiGS sRNA is expressed at a level comparable to that of the endogenous miRNA scaffold. Figure 6 This indicates that expression from plasmids is not supraphysiological and therefore unlikely to cause significant off-target effects or interfere with the normal function of the RNAi pathway in cells.

[0615] To evaluate the effectiveness of the silencing element in silencing B2M, transfected cells were collected 72 hours post-transfection, and surface B2M expression was stained with an APC-conjugated antibody and analyzed by flow cytometry. If the GEiGS silencing element design is effective, transcription of the extended GEiGS silencing element should lead to successful sequential post-transcriptional processing via DROSHA and DICER, expression of mature GEiGS silenced RNA, incorporation into RISC, and ultimately, B2M mRNA degradation. The post-transcriptional processing efficiency, RISC incorporation efficiency, and the potential of GEiGS sRNA to trigger B2M mRNA degradation were evaluated and validated.

[0616] By simultaneously measuring the expression of DsRed (a reporter gene for transfection and silencing element expression) and B2M (a target of GEiGS silencing elements) using flow cytometry, we were able to generate dose-dependent curves showing the relationship between residual B2M expression and silencing element abundance in cells. Figure 7 As expected, B2M levels remained unchanged in the negative control construct, regardless of the expression level of the GEiGS silencing element. For effective silencing elements, B2M levels decreased in a direct correlation with the level of expression of the silencing element in cells. In other words, cells in which transfection resulted in higher levels of DsRed / silencing element expression showed reduced B2M levels.

[0617] pass Figure 7 The flow cytometry gating shown was used to quantify the efficiency of GEiGS silencing elements. Debris was excluded by gating through the FSC-A and SSC-A flow cytometry channels, and subsequent duplexes were excluded by gating through the FSC-A and FSC-H channels. The filtered data were then plotted as B2M to DsRed. Quantification was performed in two different ways:

[0618] Gating was set for all cells expressing DsRed (when compared with untransfected controls), and then the average B2M fluorescence intensity was extracted from that subset.

[0619] A more selective gate was set only for cells that expressed high levels of DsRed (the top 20%), and then the average fluorescence intensity of B2M in this subpopulation was calculated.

[0620] These two methods are consistent and allow for comparison of the effectiveness of different GEiGS silencing elements targeting B2M. Broad-spectrum B2M silencing, ranging from 10% to 90%, was achieved among the 17 silencing elements tested experimentally. Figure 8The most effective silencing elements exhibited strong silencing activity. At intermediate expression levels, 2 of the 17 silencing elements tested knocked down endogenous B2M by >80%, and 4 of the 17 silencing elements tested knocked down endogenous B2M by >65%. At high expression levels, 3 of the 17 silencing elements tested knocked down endogenous B2M by >80%, and 7 of the 17 silencing elements tested knocked down endogenous B2M by >65%. The activity of the silencing elements was reproducible between experimental replicates (mean CV = 14%, median CV = 11%), indicating that the assay was robust.

[0621] Therefore, this set of silencing elements can be used to achieve different levels of MHC-I silencing across a wide range of MHC-I expression in engineered cells, thereby allowing the identification of MHC-I levels that can evade adaptive and innate immune responses after host transplantation.

[0622] Example 3—Gene editing of endogenous miRNA scaffolds in desired cell types.

[0623] Silencing elements 8, 20, 29, and 30 (see Table 2) were used as part of the complete GEiGS implementation, i.e., by editing the endogenous loci of the corresponding miRNA scaffold. Gene editing was performed via CRISPR knock-in using the following gRNA and HDR template sequences:

[0624] Table 5:

[0625]

[0626]

[0627]

[0628] The gRNA, synthesized as sgRNA, was obtained from Integrated DNA Technologies (IDT). The Cas9 protein was also obtained from IDT. sgRNA / Cas9 ribonucleoprotein (RNP) was transfected into iPSCs using nuclear transfection. Five days post-transfection, CRISPR pools were cloned into 96-well plates using the F.SIGHT platform (Cytena), and single-cell deposition was confirmed using the NYONE imaging system (Synentec). Cell colonies were expanded for 7–10 days, followed by genotyping via PCR, Sanger sequencing, and NGS amplicon sequencing. The confirmed GEiGS line was analyzed by flow cytometry to assess B2M expression levels.

[0629] For silencing element 29, heterozygous (WT / KI) and homozygous (KI / KI) clones were isolated to express sRNA monoally and bially, respectively. Because MIR106A is X-linked (hemiszygous), the GEiGS clones isolated for silencing element 20 expressed sRNA monoally only. For silencing element 30, homozygous (KI / KI) clones were generated more efficiently using the Cas12a (Cpf1) protein (also derived from IDT) instead of Cas9.

[0630] The GEiGS line showed homogeneous silencing of B2M, exhibiting very similar differences in B2M expression between the control parental line (WT / WT) and the GEiGS line. Figure 9 Quantification of B2M silencing in multiple clones showed consistent B2M silencing among different clones with the same genotype, reflecting the reproducible silencing activity of GEiGS. Figure 10 On average, heterozygous WT / KI clones of the silencing element 29 showed 89% ± SD 2% B2M silencing (n = 4), while homozygous KI / KI clones of the same silencing element showed 96% ± SD 0.5% silencing (n = 2). Figure 10 For silencing element 20, semi-synthetic KI clones showed 65% ± SD 1.2% B2M silencing (n = 4). Figure 9 and Figure 10 Furthermore, for the silencing element 30, homozygous KI clones showed approximately 31% level of B2M silencing (n=1).

[0631] Example 4—Gene editing of endogenous miRNA scaffolds in primary human T lymphocytes.

[0632] The silencing element 30 (see Example 2 and Tables 4 and 5) was implemented as a complete GEiGS, i.e., by editing the endogenous loci of the corresponding miRNA scaffold. Many stimulus-induced miRNAs were detectable in primary T cells (see Amarelet al.2017-EMBO J.2017Feb 1;36(3):346-360.doi:10.15252 / embj.201694335).

[0633] Gene editing was performed via CRISPR knock-in using the method described in Roth et al.’s 2018 paper (Nature. 2018 Jul; 559(7714): 405-409. doi: 10.1038 / s41586-018-0326-5).

[0634] The method used by Roth et al. (2018) preferably recommends fresh cells, large numbers of T cells or subpopulations sorted by fluorescence-activated cell sorting (FACS), and cells from whole blood or leukocyte removal, although it is also used with cells recovered from cryopreservation.

[0635] Table 6:

[0636]

[0637]

[0638] Sol-30 gRNA was obtained as the synthetic sgRNA from Integrated DNA Technologies (IDT). Cas9 protein was obtained from IDT. Immediately after isolation from donor peripheral blood mononuclear cell isolates (PBMCs), the cells were treated with anti-human CD3 / CD28 magnetic dynabeads (ThermoFisher) at a 1:1 bead-to-cell concentration and 200 U / ml. -1 IL-2, 5 ng / ml -1 IL-7 and 5ng ml -1 T cells were stimulated for 2 days with a cytokine mixture containing IL-15. Beads were removed prior to electroporation according to standard procedures (see, for example, Roth et al.). Primary human T cells were transfected with sgRNA / Cas9 ribonucleoprotein (RNP) using electroporation. After electroporation, T cells were placed in a solution containing 500 U / ml of [a specific cytokine mixture]. -1 T cells were cultured in IL-2 medium. Throughout the culture period, T cells were maintained at a density of approximately 1 million cells / ml of medium. Three days after electroporation, cells were isolated for analysis of surface B2M expression using flow cytometry, and gDNA and RNA were extracted for PCR, Sanger sequencing, and NGS amplicon sequencing to assess the efficiency of gene editing.

[0639] The results showed that surface B2M expression was reduced ( Figure 4 In a mixed population of CD3-positive T cells, approximately 24% of cells exhibited B2M silencing compared to unedited control cells. Figure 12a The average fluorescence intensity decreased by 80% (n=1). Analysis confirmed that both CD4- and CD8-edited T cells showed a similar decrease in B2M surface expression. Figure 12b ).

[0640] Example 5—Demonstrating the effect of T cell and NK cell-mediated immune responses on clone GEiGS-modified cells in culture. The escape of the system

[0641] To determine whether partial silencing of B2M enables cells to evade both adaptive and innate immune cellular responses, published methods were used to determine the responsiveness of donor-derived cytotoxic T lymphocytes (CTLs) or NK cells (natural killer cells or LAKs, lymphokine-activated killer cells) in cell cultures to GEiGS-modified cell lines (Haga K et al. 2006; Hacke K et al. 2009; Han X et al. 2019). Donor CTLs and NK cells were conveniently isolated from commercial suppliers of peripheral blood mononuclear cells (PBMCs).

[0642] T lymphocytes are initially pre-activated in tissue cultures to make them allogeneic receptive. This is done by stimulating them with cells that present HLA antigens, cell extracts, or stimulated cells that are recognized as foreign by the donor T lymphocytes (because they are mismatched). Once activated, the donor cells are then mixed in cultures with GEiGS-modified cell lines in a defined ratio (typically 10 donor cells: 1 GEiGS-modified cell), but other ratios are also tested. After a defined time period (48 hours) in mixed cell cultures, effector donor T lymphocyte activation in GEiGS-modified cell lines was analyzed by measuring proliferation or inflammatory cytokine secretion (measured by ELISA), or by quantifying GEiGS-modified cell line death by measuring the release of the cytoplasmic enzyme lactate dehydrogenase into the culture medium and / or the release of pre-loaded calcein AM and / or by staining with cell death markers (e.g., propidium iodide) and / or by visualizing the time course of pre-loaded fluorescently labeled (e.g., CFSC) GEiGS-modified cells, thereby assessing the extent of T lymphocyte-mediated GEiGS-modified cytotoxicity. Undifferentiated iPSC lines (knock-in of silencing element 20 or 29) and iPSC lines differentiating into pancreatic progenitor cells (knock-in of silencing element 30) did not quantitatively express the same levels of B2M as the parental iPSC lines.

[0643] NK cells are non-HLA-restricted and potent effectors that recognize and kill cells lacking MHC-I surface expression (“self-deficient”), such as malignant cells. In relevant co-culture assays using NK cells from the same PBMC donor, these cells are mixed in cultures with GEiGS-modified cell lines at a defined ratio (typically 5:1 or 1:1). After a defined period (4-48 hours) in the mixed cell cultures, the extent of NK cell-mediated GEiGS-modified cytotoxicity is assessed by quantifying GEiGS-modified cell line death (as described above). Undifferentiated iPSC lines (knock-in of silencing element 20 or 29) and iPSC lines differentiating into pancreatic progenitor cells (knock-in of silencing element 30) do not quantitatively express the same levels of B2M as the parental iPSC lines.

[0644] Therefore, we demonstrate that effective and dose-dependent reduction of HLA surface expression in human cells produces enhanced resistance to allogeneic reactive T lymphocyte-mediated cytotoxicity while avoiding non-MHC-restricted killing.

[0645] Example 6—Selection of miRNAs for B2M partial silencing using an environment-specific miRNA scaffold. GEiGS silencing elements were validated via plasmid-based ectopic expression and GEiGS.

[0646] Table 7. Computationally designed RNAi trigger sequences targeting B2M and sequences of GEiGS silencing elements based on miRNAs that are more highly expressed in differentiated cells (pancreas and primary human T cells):

[0647]

[0648] Many of the extended designs tested were based on endogenous pre-miRNAs that are more highly expressed in undifferentiated iPSCs rather than in differentiated progeny derived from stem cells. These silencing elements are listed below:

[0649] Table 8. Computationally designed RNAi trigger sequences targeting B2M and sequences of GEiGS silencing elements based on miRNAs highly expressed in undifferentiated iPSCs:

[0650]

[0651]

[0652] hsa-mir-191_8_B2M-exon2-2

[0653] GTCTTGTTCCCTCTAGACTCCGTTTCACAACCTACTCCCGGGTCTTCCTCCTGGGACTGGGGATGGGCGGGTTCTGATGTGGCCCCAGGGCGAGTGACCTGGGGGCAGGAGCTCCCCCGCCCCCCGCCAACGGCTGGACAGCGGGTTCAGTGTAGTACAAGAGATAGATTGTCTCCAGAGCATTCTCTATCTGCTGACTACACTGCCCCTGCTCTCCTGCCTGAGCAGCGCCCTGGCCCAGATGGGGTGCCCCTGACCCCCAGACATACTTTACTGAGCTGCTTGGGTCTCAGTTCCTCTCAGTTGCGCCCTCAGGCTGGAGGTGATGGGTGTAGACGTGGGAGAGCCGAGG

[47]

[0654] >hsa-mir-302c_12_B2M-exon2-2

[0655] TTTACTTCTCCAAAATAGAACACGCTAACCTCATTTGAAGGGATCCCCTACATTTTAGTTGACTTACTGCAGCTGTGTGAAACAAAAGTTTCAGTAAGTCAACTTCAATGTAGGTGTCTCCAAGCCAGCACACCTTTTGTTACAAAATTTTTTTGTTATTGTGTTTTAAGGTTACTAAGCTTGTTACAGGTTAAAGGATTCTAACTTTTTCCAAGA

[37]

[0656] >hsa-mir-106a_20_B2M-exon4

[0657] TTTACTTGTTTAGTTTCTAATATGTGTGTGTTTGTTTTGTTGTTTTAACCAGGTGAGTCTGCATGGATCTGTGAGGACGGAAAAGAAGAGCTCCTGGAAGACTTAAAATTTTGCTACAGGAATAGGCCTTGGCCATGTTAAATTTTCCCCCAAATTCTAAGCTTTTTGAGATCTTGAATTAGGGGGAAAATTCTAACATTACCATGGTGATTTAGTCAATGGCTACTGAGAACTGTAGTTTGTGCATAATTAAGTAGTTGATGCTTTTGAGCTGCTTCTTATAATGT

[45]

[0658] >hsa-mir-20a_29_B2M-exon4

[0659] GAATGATTTTTACTAATTTTGTGTACTTTTATTGTGTCGATGTAGAATCTGCCTGGTCTATCTGATGTGACAGCTTCTGTAGCACTAACAAATTTCCAATAATCCTGTTGTTTAGTTATACAGATTATTGGAAATTTGTAAAGTACTGCTAGCTGTAGAACTCCAGCTTCGGCCTGTCGCCCAATCAAACTGTCCTGTTA

[39]

[0660] >hsa-mir-21_30_B2M-exon4

[0661] GTTCGATCTTAACAGGCCAGAATGCCTGGGTTTTTTTGGTTGTTTTTGTTTTTGTTTTTTTATCAAATCCTGCCTGACTGTCTGCTTGTTTTGCCTACCATCGTGACATCTCCATGGCTGTACCACCTTGTCGGGTGTTAACATTATTATAACCCTACTGTTGAAT CTCATGGAGGGTCATAATATGTTAACATCTGACATTTTGGTATCTTTCATCTGACCATCCATATCCAATGTTCTCATTTAAACATTACCCAGCATCATTGTTTATAATCAGAAACTCTGGTCCTTCTGTCTGGTGGCACTTAGAGTCTTTTGTGCCATAATGCA

[41]

[0662] hsa-mir-518b_43_B2M-exon4

[0663] TTTATGTTCTGGATTCCAGAAAACATGCAAACAGGGCAAATAAATGCATCTTTATTTTGTGTCCATTTTAACCTGGTCAAGGAAAATTCCAACAGCAACATCAAAAAACCAGTGTTGGAGCAAGAATATGTCATGCTGTGGCAGTTCAGCGTGAATAAGTTTCAATTGTCTGA AAGAAAATTAACTTATGCACGCTTAACTATTACGGTTTGAGTAAAGCAGCGTTGAAGTTGATGCTGATCTTGGTAATACATTTGCAGAGCGTGCTTATCATCAGACGTGGACGATGGTGGGGTTCTGTTTTGGTTTTGTTTTTTTCTAAGACAGGGTCTCCGTTGCCCAG

[50]

[0664] Example 7—Demonstrating pancreatic progenitor cells specialized in cultures derived from cloned GEiGS-modified iPSCs B2M silence

[0665] The silencing element 30 (see Table 7) was implemented as a complete GEiGS to demonstrate that B2M silencing can be programmed to deploy only when therapeutic cells reach a specific differentiation stage, as is the case with iPSC-derived pancreatic cells. The endogenous locus of the corresponding miRNA (hsa-mir-21) was modified (as described in Example 3) because this miRNA scaffold is known to be expressed in pancreatic cells in a developmentally regulated and cell-state-specific manner (Jin W et al 2019, see also). Figure 11 ).

[0666] Using a set of commercially available reagents and validated methods (Stem Cell Technologies; STEMDiff) TM A pancreatic progenitor cell kit was used to generate pancreatic progenitor cells from a control parental line (WT / WT). This validated method reproducibly generates progenitor cells through a four-stage process involving the formation of the endoderm, primitive intestinal tract, foregut endoderm, and pancreatic progenitor cells. Specialized progenitor cells were isolated after 14 days of continuous culture, and the staining levels of pancreatic progenitor cell markers (PDX-1, NKX6.1, and co-staining with B2M) were assessed by flow cytometry. Results showed that a significant proportion of specialized progenitor cells were positive for both pancreatic cell markers, and most PDX-1-positive cells also stained for B2M.

[0667] For silencing element 30, heterozygous (WT / KI) and homozygous (KI / KI) clones were isolated to express sRNA as monoallelic and bialelic lines, respectively. Homogeneous, quantitative, and reproducible B2M silencing levels in the GEiGS clones during pancreatic progenitor cell specialization were assessed when cells were differentiated from iPSCs using the current method, with B2M expression compared to the control parental line (WT / WT). The level of B2M silencing was dependent on whether the progenitor cells maintained their differentiated state; this level was lost when the progenitor cells dedifferentiated, proliferated, or became degenerate.

[0668] Example 8—Demonstration of B2M in mononuclear cells specialized in cultures derived from cloned GEiGS-modified iPSCs silence

[0669] The silencing element 30, as a complete implementation of GEiGS (see Table 7), demonstrates that B2M silencing can be programmed to be deployed in other types of therapeutic cells, including iPSC-derived monocytes. As in Example 3, the endogenous locus of the corresponding miRNA (hsa-mir-21) was modified. Homozygous (KI / KI) clones of silencing element 30 were isolated to express the sRNA biallelicly. Homogeneous, quantitative, and reproducible B2M silencing levels of the GEiGS silencing element 30 clones were assessed when cells differentiated from iPSCs into monocytes. The has-mir-21 scaffold is expressed in monocytes in a developmentally regulated and cell state-specific manner (Sheedy FJ. Turning 21: Induction of miR-21 as a Key Switch in the Inflammatory Response. Front Immunol. 2015 Jan 29; 6:19. doi:10.3389 / fimmu.2015.00019.PMID:25688245; PMCID:PMC4310327).

[0670] Numerous publicly available protocols exist for generating monocytes and macrophages from human pluripotent stem cells (e.g., Happle, C., Lachmann, N., Ackermann, M., Mirenska, A., Gohring, G., Thomasy, K., Mucci, A., Hetzel, M., Glomb, T., Suzuki, T., et al. (2018). Pulmonary transplantation of human induced pluripotent stem cell-derived macrophages ameliorates pulmonary alveolar proteinosis. Am. J. Respir. Crit. Care Med. 198, 350–360; Lachmann, N., Ackermann, M., Frenzel, E., Liebhaber, S., Brennig, S., Happle, C., Hoffmann, D., Klimenkova, O., Luttge, D., Buchegger, T., et al.). al.(2015).Large-scale hematopoieticdifferentiation of human induced pluripotent stem cells provides granulocytes or macrophages for cell replacement therapies.Stem Cell Reports 4,282–296; and Zhang, H., Mendelian disease. Circ. Res. 117,17–28.

[0671] Using a validated embryoid-based protocol, monocytes were generated over 3–4 weeks from homozygous clones of syngeneic control parental lines (parental control WT / WT lines) and silencing element 30 (KI / KI) clones. Undifferentiated iPSCs were first differentiated into myeloid precursors, and then X-VIVO cells supplemented with cytokines IL-3 and macrophage colony-stimulating factor (M-CSF) were used. TM 15. Serum-free hematopoietic cell culture medium (Lonza) was used to produce monocytes. All reagents were commercially available.

[0672] After approximately 3 weeks of continuous culture, monocytes were efficiently generated and isolated, and the staining levels of the monocyte markers CD14 and CD45 were assessed by flow cytometry (see [link to relevant documentation]). Figure 19a Greater than 90% of the cells were double-positive for the known monocyte markers CD14 and CD45. Monocytes were also generated using iPSC lines (GEiGS silencing element 30 (S30 / S30 genotype) and syngeneic controls), and these monocytes were then stained by flow cytometry for residual B2M expression on the cell surface. When expanded as undifferentiated iPSCs, greater than 93% of cells in both the syngeneic control and the GEiGS silencing element 30 clones expressed B2M, while after differentiation into monocytes, the GEiGS silencing element 30 line showed a significantly reduced number of cells with the same amount of B2M expression on the cell surface compared to the syngeneic control line (16% of cells had residual B2M compared to 77%) (see [link to original text]). Figure 19b ).

[0673] The identified silencing elements for silencing B2M (e.g., silencing element 30) were implemented as a complete GEiGS, which involves editing the endogenous loci of the corresponding miRNA scaffold in iPSCs and differentiating stem cells into myeloid cells.

[0674] For the individual silencing element 30, GEiGS was performed using gRNA obtained from Integrated DNA Technologies (IDT) as the synthetic sgRNA. Cas9 protein was obtained from IDT. Isolated iPSCs were electroporated using a Lonza 4D-Nucleofector device (4D-25 Nucleofector core unit: Lonza, AAF-1002B; 4D-Nucleofector X unit: AAF-1002X) (buffer P3, device setup CM-137) and then contacted with the sgRNA / Cas9 ribonucleoprotein complex (RNP) and an appropriate dsDNA HDR template (IDT or Genewiz) produced internally or commercially.

[0675] Following electroporation, clone selection, and characterization, homozygous knockout or silencing elements 30 of the miRNA-21 gene were designed into homozygous knock-in clones of iPSC cell lines and differentiated into monocytes. These monocytes were then differentiated into macrophages in macrophage medium (high glucose DMEM supplemented with 10% FBS [Gibco], 2 mM GlutaMAX, 100 U / mL penicillin, 100 μg / mL streptomycin, and 100 ng / mL M-CSF [Peprotech]). The medium was changed every 2–3 days by adding half the volume of medium containing 1× cytokines to each well.

[0676] After several days of differentiation in culture, cells were isolated to analyze the expression of target MHC-I proteins (B2M or HLA-A / B / C) compared to control cells (KO / KO) in which endogenous miR-21 was knocked out, as well as the relative expression of B2M and HLA-A / B / C in GEiGS-modified iPSCs, monocytes, and macrophages (miR-21 redirected to target B2M, i.e., silencing element 30). GEiGS and control lines were first differentiated in vitro into monocytes, followed by macrophages. B2M and HLA-A / B / C were measured by flow cytometry, showing effective silencing (84%–88% silencing) in myeloid cells, but not in iPSCs. Figures 21c to 21f ).

[0677] The relative B2M protein expression levels were roughly the same between undifferentiated S30 iPSCs and their undifferentiated homozygous KO control iPSC lines, indicating that disruption of the endogenous miR-21 locus did not produce a nonspecific B2M silencing effect during the iPSC stage. Subsequently, upon iPSC differentiation, myeloid progenitor cells, monocytes, and macrophages from (wild-type) control (unedited), homozygous miR-21KO, and homozygous S30 (KI / KI) cell lines differentiated efficiently with similar efficiencies; however, the homozygous S30 (KI / KI) cell line showed a specific reduction in B2M protein expression only at the myeloid progenitor, monocyte, and macrophage stages. Figure 21a This indicates that modifying the miR-21 locus to incorporate the silencing element 30 does not interfere with the ability of stem cells to differentiate into bone marrow lineage cells, and that B2M cell surface expression is specifically reduced only in bone marrow lineage stage cells.

[0678] Antibodies targeting classic HLA-A / B / C expression on cell surfaces showed reduced HLA-A / B / C expression on cell surfaces, as predicted by silencing B2M via silencing element 30, since B2M is essential for the proper processing and distribution of the MHC-I complex protein on the cell surface. Figure 21e and Figure 21f ).

[0679] This example demonstrates that B2M silencing leads to reduced cell surface expression of HLA-A / B / C, and consequently, a reduction in the MHC-I complex in an environment-specific manner (only in bone marrow lineage cells, but not in undifferentiated iPSCs).

[0680] Example 9—Computational Design of GEiGS Silencing Elements for Silencing Genes in Macrophages

[0681] A computational pipeline was used to generate GEiGS silencing elements targeting genes in macrophages. The pipeline inputs were: mRNA sequences of the major transcripts of genes PPARG, STAT6, IRF4, and KDM6B (from the literature), a human genome reference sequence (GRCh38), miRNA annotations (miRbase v22), and cell type-specific miRNA quantifications from human primary donor macrophages analyzed using cytokine stimulation to polarize to either a classical (M1) or non-classical (M2) state.

[0682] From RNA-seq analysis of polarized macrophages, four individual miRNA scaffolds (LET7i, MIR146A, MIR20A, and LET7C) were selected based on differential expression in different cellular states. These miRNA scaffolds were selected based on their high expression levels in monocytes, M1, or M2 macrophages. Expression levels were determined experimentally using two methods: next-generation sequencing (NGS) using monocytes and macrophages activated to the M1 or M2 state. Figure 18a As shown, and qPCR was performed on macrophages generated when proliferating THP-1 cells were induced to differentiate into M0-like cells (see [reference]). Figure 18a and Figure 18c ). Figure 18c Both methods were confirmed to provide relevant results.

[0683] Tables 15 to 20 below provide a summary of the results of differentially expressed miRNAs identified using NGS in different macrophage states, as follows:

[0684] Table 15 - Comparison of M1 macrophages and M0 macrophages.

[0685] Table 16 - Comparison of M2a macrophages and M0 macrophages.

[0686] Table 17 - Comparison of M2a macrophages and M1 macrophages.

[0687] Table 18 - Comparison of M2c macrophages and M0 macrophages.

[0688] Table 19 - Comparison of M2c macrophages and M1 macrophages.

[0689] Table 20 - Comparison of M2c macrophages and M2a macrophages.

[0690] It also includes additional scaffolds based on the optimized miRNA 30 sequence.

[0691] The computational pipeline identified specific designs suitable for targeting genes of interest based on the modified forms of selected environment-specific miRNAs. The miRNA designs from the computational model were largely consistent with publicly available literature describing conventional siRNA designs targeting these genes, providing further assurance regarding the proposed silencing elements. These silencing elements were ranked based on their target score and predicted low off-target score. Both published and novel sequences were used to assist in the design of trigger sequences. Computational analyses were used to select the highest-ranking sequence for each target gene, ensuring the preservation of diversity based on the original data sources. Further computational analyses were used to screen for 22 to 25 individual GEiGS silencing elements designed for each macrophage target gene. This was based on an assessment of predictions for the formation of mature miRNAs and quantification of differential expression of each miRNA scaffold in polarized cell states after experimental induction.

[0692] The GEiGS silencing element is designed to consist of a modified sequence of an endogenous pre-miRNA (hairpin) (also known as an endogenous miRNA scaffold) that is modified to encode a novel silencing RNAi trigger instead of its natural guide strand. The novel GEiGS silencing RNA matches the mRNA target through sequence complementarity and is predicted to cause silencing of each target mRNA via an RNA interference pathway.

[0693] The silencing element design process also generates a corresponding negative control construct (also known as a “scrambled” silencing element), in which the same endogenous miRNA scaffold as the corresponding GEiGS silencing element is modified, but expresses the scrambled sequence of the GEiGS silencing RNA.

[0694] Example 10—Validation of GEiGS silencing element silencing activity in macrophages via plasmid-based ectopic expression

[0695] Approximately 102 silencing elements were designed based on the following distributions on the target genes:

[0696] Target gene PPARG: 22 silencing elements distributed on different miRNA scaffolds, plus 4 additional silencing elements based on miRNA 30;

[0697] Target gene IRF4: 24 silencing elements distributed on different miRNA scaffolds, plus 4 additional silencing elements based on miRNA 30;

[0698] Target gene KDM6B: 24 silencing elements distributed on different miRNA scaffolds, plus 4 additional silencing elements based on miRNA 30; and

[0699] Target gene STAT6: 24 silencing elements distributed on different miRNA scaffolds, plus 4 additional silencing elements based on miRNA 30.

[0700] These silencing elements are designed to prevent macrophages from adopting a pro-tumor (i.e., tumor-associated macrophage, TAM) state, thereby promoting an active inflammatory phenotype in the tumor...

Claims

1. A method for regulating the expression of target genes in cells in an environment-specific manner, the method comprising: - Provide cells with nucleic acid constructs suitable for expressing inhibitory RNA, which is adapted to inhibit the expression of the target gene; - wherein the repressor RNA is active in the cell in a context-specific manner, such that the repression of the target gene expression occurs specifically in the first environment in which the repressor RNA is active in the cell; Optionally, in at least a second environment where the inhibitory RNA is inactive or has low activity, inhibition does not occur or occurs in a reduced amount.

2. The method as described in claim 1, wherein, The nucleic acid construct is a modified form of an endogenous sequence encoding a repressive RNA (preferably miRNA), which has been modified to target transcripts from the target gene.

3. The method as described in claim 1 or 2, wherein, The method includes the step of genetically modifying endogenous repressive RNA to alter its targeting specificity, thereby targeting the transcript of a target gene.

4. The method as described in any of the preceding claims, wherein, The cells are environment-specific low immunogenic cells, preferably environment-specific low immunogenic therapeutic cells.

5. The method as claimed in any of the preceding claims, wherein, The cells are immune cells or their progenitor cells, for example, macrophages or T cells or their progenitor cells.

6. The method as claimed in any of the preceding claims, wherein, The repressive RNA targets target genes associated with the MHC-I complex, optionally wherein the target genes are B2M, HLA-A, HLA-B, and / or HLA-C genes, thereby reducing the expression of the MHC-I complex on cells when the repressive RNA is active, preferably when the target gene is B2M.

7. The method as claimed in any of the preceding claims, wherein, The repressive RNA has specific activity in cells in environments selected from: - Cells in a specific differentiation state, such as fully differentiated cells, cells in the intermediate differentiation stage, or undifferentiated cells; -Totipotent cells, pluripotent cells, or pluripotent cells; - Cells that exist in specific tissues; - Cancerous or precancerous cells; - Tumor-associated cells, such as tumor-associated immune cells or immune cells in the tumor microenvironment; -Polarized cells, such as macrophages; -Activated or polarized immune cells; - Hypoxic cells; or - Cells that have undergone the reaction of unfolded proteins.

8. The method as claimed in any of the preceding claims, wherein, The cells are selected from the following: - Therapeutic immune cells or their progenitor cells; - Therapeutic endocrine cells or their progenitor cells, preferably pancreatic β cells or their progenitor cells; - Therapeutic CNS cells or their progenitor cells, appropriately neurons or glial cells (such as astrocytes, oligodendrocytes, ependymal cells or microglia) or their progenitor cells; - Therapeutic epithelial cells or their progenitor cells; - Therapeutic muscle cells or their progenitor cells, such as cardiomyocytes, skeletal muscle cells and smooth muscle cells; -Therapeutic pluripotent stem cells The group consists of allogeneic therapeutic cells.

9. A cell or cell population obtained by the method as described in any of the preceding claims.

10. A genetically modified cell comprising a nucleic acid construct adapted to express repressive RNA, said repressive RNA being adapted to suppress the expression of a target gene; The repressor RNA is active in the cell in an environment-specific manner, such that the repression of the target gene expression occurs specifically in the first environment in which the repressor RNA is active in the cell; Optionally, in at least a second environment where the inhibitory RNA is inactive or has low activity, inhibition does not occur or is reduced.

11. The cell of claim 10, wherein, The nucleic acid construct is a modified endogenous sequence encoding a repressor RNA (preferably miRNA), which has been modified to target transcripts from a target gene.

12. The method according to any one of claims 1-8 or the cell according to any one of claims 10 or 11, wherein, The cell is adapted to express at least one additional repressive RNA that is active in the cell in an environment-specific manner; Optionally, the repression of expression of the second or another target gene specifically occurs in a first environment where the repressive RNA is active in the cell; or The expression inhibition of the second or another target gene specifically occurs in a second or another environment in which the at least one other repressive RNA is active in the cell.

13. The cell according to any one of claims 10-12, wherein, The cell includes a genetically modified sequence encoding an endogenous repressor RNA, which has altered targeting specificity to target the transcript of a target gene.

14. The cell of any one of claims 10-13, comprising a nucleic acid construct adapted to express repressive RNA, said repressive RNA being adapted to suppress the expression of a target gene, and wherein said repressive RNA becomes active in the cell in response to changes in the environment.

15. The cell according to any one of claims 10-14, wherein, The cells are environment-specific low immunogenic cells, preferably environment-specific low immunogenic therapeutic cells.

16. The method or cell as claimed in any of the preceding claims, wherein, The repressive RNA targets more than one target gene; optionally, one of the target genes is B2M and another target gene is selected from: PPARG, IRF4, KDM6B, FOXP3, PDCD-1, and STAT6; optionally, one of the two or more repressive RNAs is selected from: SEQ ID NO:1 or 18 (silencing element (Solution) 8), SEQ ID NO:5 or 22 (silencing element 20), SEQ ID NO:9 or 26 (silencing element 29), SEQ ID NO:10 or 27 (silencing element 30), SEQ ID NO:348 to SEQ ID NO:411 or SEQ ID NO:412 to SEQ ID NO:475 (targeting B2M); the other of the two or more repressive RNAs is selected from: SEQ ID NO:66 to SEQ ID NO:87 or SEQ ID NO:88 to SEQ ID NO:109 (targeting PPARG); SEQ ID NO:110 to SEQ ID NO:133 or SEQ ID NO:134 to SEQ ID NO:157 (targeting IRF4); SEQ SEQ ID NO:158 to SEQ ID NO:181 or SEQ ID NO:182 to SEQ ID NO:205 (targeting KDM6B); SEQ ID NO:476 to SEQ ID NO:525 or SEQ ID NO:526 to SEQ ID NO:575 (targeting FOXP3); SEQ ID NO:576 to SEQ ID NO:624 or SEQ ID NO:625 to SEQ ID NO:673 (targeting PDCD-1); or SEQ ID NO:206 to SEQ ID NO:229 or SEQ ID NO:230 to SEQ ID NO:253 (targeting STAT6); Alternatively, one of the target genes is PPARG and the other target gene is selected from IRF4, KDM6B and STAT6, or one of the target genes is IRF4 and the other target gene is selected from PPARG, KDM6B and STAT6, or one of the target genes is KDM6B and the other target gene is selected from PPARG, IRF4 and STAT6, or one of the target genes is FOXP3 and the other target gene is PDCD-1.

17. The method or cell as claimed in any of the preceding claims, wherein, The cell is a progenitor cell modified to contain a nucleic acid construct suitable for expressing repressive RNA, the repressive RNA being adapted to suppress the expression of the target gene, and wherein the repressive RNA is active in the differentiated cell, preferably wherein the repressive RNA is active when the cell is fully differentiated.

18. The method or cell as claimed in any of the preceding claims, wherein, The cells are differentiated cells selected from the group consisting of: leukocytes, dendritic cells, lymphocytes, monocytes, macrophages, erythrocytes, platelets, hematopoietic cells, pancreatic islet cells (e.g., β cells), hepatocytes, myocytes, keratinocytes, cardiomyocytes, neurons, skeletal muscle cells, ocular cells, mesenchymal cells, fibroblasts, lung cells, gastrointestinal cells, vascular cells, endocrine cells, and adipocytes; Alternatively, the cells may be stem cells, preferably stem cells adapted to differentiate into differentiating cells, selected from the group consisting of: leukocytes, dendritic cells, lymphocytes, erythrocytes, platelets, hematopoietic cells, pancreatic islet cells (e.g., β cells), hepatocytes, myocytes, keratinocytes, cardiomyocytes, neurons, skeletal muscle cells, ocular cells, mesenchymal cells, fibroblasts, lung cells, gastrointestinal cells, vascular cells, endocrine cells, or adipocytes.

19. The method or cell as claimed in any of the preceding claims, wherein, The repressor RNA is a modified form selected from the group consisting of the following endogenous miRNAs: hsa-miR-375, hsa-miR-143, hsa-miR-21, hsa-miR-30d, hsa-miR-192, hsa-miR-30a, hsa-miR-182, hsa-miR-148a, hsa-miR-127, and hsa-miR-200c; and / or, wherein the repressor RNA comprises one of the following sequences or a functional variant thereof: -SEQ ID NO:1 or 18 (silencing element 8), SEQ ID NO:5 or 22 (silencing element 20), SEQ ID NO:9 or 26 (silencing element 29) or SEQ ID NO:10 or 27 (silencing element 30) (targeting B2M); -SEQ ID NO:66 to SEQ ID NO:87 or SEQ ID NO:88 to SEQ ID NO:109 (targeting PPARG); -SEQ ID NO:110 to SEQ ID NO:133 or SEQ ID NO:134 to SEQ ID NO:157 (targeting IRF4); -SEQ ID NO:158 to SEQ ID NO:181 or SEQ ID NO:182 to SEQ ID NO:205 (targeting KDM6B); -SEQ ID NO:348 to SEQ ID NO:411 or SEQ ID NO:412 to SEQ ID NO:475 (targeting B2M); -SEQ ID NO:476 to SEQ ID NO:525 or SEQ ID NO:526 to SEQ ID NO:575 (targeting FOXP3); -SEQ ID NO:576 to SEQ ID NO:624 or SEQ ID NO:625 to SEQ ID NO:673 (targeting PDCD-1); or -SEQ ID NO:206 to SEQ ID NO:229 or SEQ ID NO:230 to SEQ ID NO:253 (targeting STAT6).

20. The method or cell as claimed in any of the preceding claims, wherein, The cell is a macrophage or its progenitor cell, and the repressive RNA is active in one of the following environments within the macrophage: -The macrophages are unpolarized macrophages; - The macrophages were classically activated (M1); -The macrophages are reactivated by replacement (M2); - The macrophages mentioned are regulatory macrophages (Mreg); or -The macrophages are in the TME; Alternatively, the miRNAs mentioned therein may be selected from the group consisting of MIR146A (e.g., hsa-miR-146a-5p), MIR20A (e.g., hsa-miR-20a-5p), LET7C (hsa-miR-let-7c-5p), and LET7i (hsa-let-7i-5p).

21. The method or cell as claimed in any of the preceding claims, wherein, The cell is a T cell or its progenitor cell, and the repressive RNA has specific activity in the T cell in any of the following environments: - The T cells are CD8+ T cells; - The T cells are CD4+ T cells; - The T cells are CD4+ T helper cells, optionally Th1, Th2, Th17, Th9, Tfh or Th22 cells; - The T cells mentioned are memory T cells; - The T cells are CD4+ T cells. reg Cells, optionally FOXP3+Treg cells or FOXP3-Treg cells; - The T cell exhaustion (e.g., cells; or - The T cells are in the TME.

22. A nucleic acid construct for environment-specific inhibition of the expression of a target gene in a cell, the nucleic acid construct encoding a repressive RNA adapted to inhibit the expression of the target gene, wherein the repressive RNA is active in the cell in an environment-specific manner such that inhibition of the expression of the target gene occurs specifically in a first environment in which the repressive RNA is active in the cell, wherein the repressive RNA is active in the cell, wherein the construct comprises a sequence selected from the following list or a functional variant thereof: -SEQ ID NO:1 or 18 (silencing element 8), SEQ ID NO:5 or 22 (silencing element 20), SEQ ID NO:9 or 26 (silencing element 29) or SEQ ID NO:10 or 27 (silencing element 30) (targeting B2M); -SEQ ID NO:66 to SEQ ID NO:87 or SEQ ID NO:88 to SEQ ID NO:109 (targeting PPARG); -SEQ ID NO:110 to SEQ ID NO:133 or SEQ ID NO:134 to SEQ ID NO:157 (targeting IRF4); -SEQ ID NO:158 to SEQ ID NO:181 or SEQ ID NO:182 to SEQ ID NO:205 (targeting KDM6B); -SEQ ID NO:348 to SEQ ID NO:411 or SEQ ID NO:412 to SEQ ID NO:475 (targeting B2M); -SEQ ID NO:476 to SEQ ID NO:525 or SEQ ID NO:526 to SEQ ID NO:575 (targeting FOXP3); -SEQ ID NO:576 to SEQ ID NO:624 or SEQ ID NO:625 to SEQ ID NO:673 (targeting PDCD-1); or -SEQ ID NO:206 to SEQ ID NO:229 or SEQ ID NO:230 to SEQ ID NO:253 (targeting STAT6).

23. A repressive RNA comprising or consisting of sequences selected from the following list or functional variants thereof: -SEQ ID NO:1 or 18 (silencing element 8), SEQ ID NO:5 or 22 (silencing element 20), SEQ ID NO:9 or 26 (silencing element 29) or SEQ ID NO:10 or 27 (silencing element 30) (targeting B2M); -SEQ ID NO:66 to SEQ ID NO:87 or SEQ ID NO:88 to SEQ ID NO:109 (targeting PPARG); -SEQ ID NO:110 to SEQ ID NO:133 or SEQ ID NO:134 to SEQ ID NO:157 (targeting IRF4); -SEQ ID NO:158 to SEQ ID NO:181 or SEQ ID NO:182 to SEQ ID NO:205 (targeting KDM6B); -SEQ ID NO:348 to SEQ ID NO:411 or SEQ ID NO:412 to SEQ ID NO:475 (targeting B2M); -SEQ ID NO:476 to SEQ ID NO:525 or SEQ ID NO:526 to SEQ ID NO:575 (targeting FOXP3); -SEQ ID NO:576 to SEQ ID NO:624 or SEQ ID NO:625 to SEQ ID NO:673 (targeting PDCD-1); or -SEQ ID NO:206 to SEQ ID NO:229 or SEQ ID NO:230 to SEQ ID NO:253 (targeting STAT6).

24. A composition comprising the cells as described in any one of claims 9-21.

25. The use of a cell as described in any one of claims 9-21 or a composition as described in claim 24 in a therapeutic context.

26. A reporter nucleic acid comprising or composed of a constitutive promoter operatively linked to a gene encoding a fluorescent protein and a target gene (or a portion thereof), wherein the fluorescent protein and the target gene are transcribed into polycistronic mRNA.

27. The report nucleic acid as described in claim 26, wherein, The target gene is inserted into the 3' untranslated region of the fluorescent protein.

28. The report nucleic acid as described in claim 26 or 27, wherein, The target gene is a target gene of repressive RNA and / or the target gene is selected from: PDCD-1, B2M, PPARG, IRF4, KDM6B, FOXP3 or STAT6.

29. The reporter nucleic acid as described in claims 26-28, wherein, The constitutive promoter is EF1a and / or the fluorescent protein is GFP, optionally CopGFP.

30. The reporter nucleic acid as described in claims 26-29, further comprising: -WPRE - Lateralized long terminal repeat (LTR) sequences; and / or - A gene for a cell surface protein operatively linked to a constitutive promoter, wherein the constitutive promoter is optionally PGK and the cell surface protein is optionally tNGFR.

31. The reporter nucleic acid as described in claims 26-30, used for detecting inhibition or silencing of a target gene by one or more inhibitory RNAs.

32. The use of a reporter nucleic acid as described in claims 26-30 in detecting the inhibition or silencing of a target gene by means of one or more inhibitory RNAs.

33. An expression system, comprising: - The reporting nucleic acid as described in claims 26-31; and - An expressed nucleic acid comprising a constitutive promoter operatively linked to a nucleic acid sequence encoding a repressor RNA.

34. The expression system of claim 33, wherein: -The expressed nucleic acid side-extended terminal repeat (LTR) sequence; -The constitutive promoter in the expressed nucleic acid is EF1a; - The repressor RNA is an endogenous non-coding RNA coding sequence, for example, an endogenous repressor RNA coding sequence that has been modified to retarget the endogenous repressor RNA, thereby silencing or partially silencing the target gene via the GEiGS method; or the repressor RNA is a GEiGS extended silencing element, and / or The expressed nucleic acid also includes an additional fluorescent protein operatively linked to the constitutive promoter, optionally wherein the additional fluorescent protein is dsRed.

35. The expression system as described in claim 33 or 34, wherein, The report nucleic acid and the expression nucleic acid are provided in the form of two or more separate lentiviral vectors.

36. The expression system as described in claims 33-35, wherein, The expression system includes two or more expressed nucleic acids.

37. The expression system of claim 36, wherein, The two or more expressed nucleic acids are provided in the form of two or more separate lentiviral vectors.

38. A method for detecting the repressive or silencing activity of one or more repressive RNAs on a target gene, comprising: - Transfect one or more cells using the expression system as described in any one of claims 33-37; -The repressive RNA binds to the target gene within the polycistronic mRNA; - Degrade the polycistronic mRNA; as well as - A reduction in the fluorescence signal of fluorescent proteins from one or more of the cells.

39. A method for selecting one or more repressive RNAs from a pool of test repressive RNAs that exhibit silencing or repression of a target gene, the method comprising: - Transfect one or more cells using the expression system as described in any one of claims 33-37; - Select one or more repressive RNAs to be transfected into one or more cells that exhibit a reduction in fluorescent signals from fluorescent proteins.

40. The method of claim 38 or 39, further comprising: - Incubate one or more cells under conditions suitable for expressing the reporter nucleic acid and the expressed nucleic acid; and / or - To detect a decrease in fluorescence signal, flow cytometry can be used in Tai'an County.

41. The method as described in claims 38-40, wherein, The cells are macrophages, iPSCs, or T cells, and optionally primary T cells or T cell lines.

Images