Function and application of JAVL in regulation and control of cotton gland development and phytoalexin biosynthesis

Abstract

The invention provides a function and application of JAVL in regulation and control of cotton gland development and phytoalexin biosynthesis. The invention discloses a pigment gland specific gene JAVL (Jasmonate-associated VQ motif-like gene) containing a protein for coding a VQ structural domain, and the pigment gland specific gene JAVL can be used for regulating the size of the pigment gland and the biosynthesis of jasmonates and other plant defense compounds. The invention provides a new action target for improving the disease resistance of plants.

Description

Technical Field

[0001] This invention belongs to the fields of botany and molecular biology. More specifically, this invention relates to the function and application of JAVL in regulating cotton gland development and phytoalexin biosynthesis. Background Technology

[0002] Cotton (Gossypium) is a widely cultivated economic crop worldwide, serving as a crucial source of plant oils and proteins, and one of the world's most important fiber raw materials. During its secondary metabolism, cotton accumulates large amounts of gossypol, hemegossypolone, and related sesquiterpenoids. These compounds give the plant its unique odor and play a vital role as phytoprotective agents in combating pests and diseases. However, these compounds are toxic to humans and animals, and ingestion can potentially cause serious damage to the heart, liver, kidneys, and reproductive system. To avoid toxicity, cotton stores these compounds in pigment glands. These pigment glands are widely distributed in cotton stems, leaves, and seeds, and their presence is almost essential for the accumulation of sesquiterpenoids in cotton. Therefore, further elucidating the formation mechanism of cotton pigment glands is of great significance for breeding new cotton seed-specific glandless varieties, improving the comprehensive utilization value of cotton, and maintaining cotton's natural resistance to insects and pathogens.

[0003] Pigmented glands, distributed as dark, opaque dots in most tissues and organs, are thought to originate from a cluster of glandular primordium cells beneath the epidermis. The inner cells then degrade to form a glandular cavity storing secondary metabolites. The developmental mechanism still requires further analysis. Genetic studies indicate that the formation of pigmented glands in cotton is complex and involves many regulatory factors. The dominant adenoid gene GoPGF (Gossypium Pigment Gland Formation) or Gl2... eOriginating from a mutant of *Gossypium barbadense*, silencing or knocking out this gene resulted in a glandless phenotype in cotton (Ma et al. 2016). Comparative transcriptomic analysis (RNA-seq) of near-isogenic lines of glandless cotton identified three cotton CGFs (Cotton Gland Formation genes): CGF1, CGF2, and CGF3. CGF3, also known as GoPGF, was overexpressed, leading to a significant increase in terpenoid compounds in cultured cells. CGF2 had a slight effect on gland density, while silencing CGF1 and CGF3 resulted in a significant reduction in gland number (Janga et al. 2019). The cotton stem pigment gland formation gene GoSPGF (*Gossypium Stem Pigment Gland Forming Gene*) has been reported to regulate gland formation on cotton stems (Zang et al. 2021). In addition, a MYB transcription factor named CGP1 (Cotton Gland Pigmentation 1) is a regulator of glandular pigment deposition. It controls gossypol synthesis by interacting with GoPGF to form a heterodimer in the cell nucleus (Gao et al. 2020). The gene JUB1 (JUNGBRUNNEN 1) can regulate pigment gland development and gossypol accumulation and may be downstream of GoPGF (Long et al. 2023).

[0004] Although several genes associated with pigment gland development have been identified, the precise molecular mechanisms regulating pigment gland size and morphology remain a mystery. There are currently no successful reports of significantly increasing gossypol phytoalexin content by improving gland density, increasing gland volume, or increasing gland size. Transgenic cotton overexpressing GoPGF is highly lethal; therefore, further research is needed to elucidate these mechanisms and develop strategies to increase the yield of cotton defensive compounds, thereby enhancing its resistance to phytophagous pests and pathogens. Summary of the Invention

[0005] The purpose of this invention is to provide the function and application of JAVL in regulating cotton gland development and phytoalexin biosynthesis.

[0006] In a first aspect of the invention, a method is provided for regulating (increasing / enhancing / restoring in low-level plants) pigment glands, phytoalexin levels, jasmonic acid levels, or disease and pest resistance in cotton plants, comprising: downregulating JAVL in cotton plants, thereby increasing pigment glands, increasing phytoalexin and jasmonic acid levels (or contents), and enhancing disease and pest resistance.

[0007] In one or more embodiments, the expression or activity of JAVL in Gossypium plants is downregulated, thereby: increasing the expression of gossypol biosynthesis genes and increasing phytoalexin levels; the phytoalexins include: sesquiterpene aldehydes, volatile monoterpenes, sesquiterpenes, preferably including: gossypol, hemigossypolone, noctuidin, α-pinene, β-pinene, β-myrcene, D-limonene, trans-β-ocimene, β-caryophyllene, α-humulene, Guaia-1(10), 11-diene, β-bisabolene, β-caryophyllene; the gossypol biosynthesis genes include: CDN, CYP706B1, DH1, GhDIR5, GhDIR6, TPS (including TPS-a, TPS-b, TPS-f subfamily genes).

[0008] In one or more embodiments, the expression of jasmonic acid biosynthesis genes is increased, thereby increasing jasmonic acid levels; the jasmonic acid biosynthesis genes include: lipoxygenase (LOX3), propene oxide synthase (AOS), propene oxide cyclase (AOC4), and jasmonic acid isoleucine synthase (JAR1).

[0009] In one or more embodiments, the disease and pest resistance includes resistance to insects and resistance to fungi.

[0010] In one or more embodiments, the jasmonic acid includes jasmonic acid or a derivative thereof.

[0011] In one or more embodiments, the jasmonic acid comprises jasmonic acid (JA) and jasmonic acid isoleucine (JA-Ile).

[0012] In one or more embodiments, the JAVL directly binds to the AOS promoter, inhibiting its transcription, and interacts with GoPGF, inhibiting GoPGF's activation of AOS; the downregulation of JAVL prevents the binding or interaction; or, JAVL interacts with GoPGF to form a negative feedback loop, where GoPGF activates the transcription of JAVL and JAVL inhibits the transcription of GoPGF.

[0013] In one or more embodiments, the method includes: increasing the expression ratio (G / J) of GoPGF to JAVL in plants, thereby increasing pigment glands, increasing phytoalexin and jasmonic acid levels, and improving disease and pest resistance.

[0014] In one or more embodiments, downregulating JAVL includes: downregulating the expression or activity of JAVL; preferably, it includes (but is not limited to): performing gene silencing or gene knockout on the JAVL.

[0015] In one or more embodiments, gene silencing is performed by interfering with JAVL, including: performing gene silencing with VIGS molecules, dsRNA, antisense nucleic acids, small interfering RNA, microRNA, or constructs that can express or form the VIGS molecules, dsRNA, antisense nucleic acids, small interfering RNA, or microRNA as the target of inhibition or silencing; preferably, the construct that forms the VIGS molecules includes: the nucleotide sequence shown in positions 138-571 of SEQ ID NO:1 or positions 84-517 of SEQ ID NO:3.

[0016] In one or more embodiments, the gene knockout is performed using gene editing methods (such as gene editing based on the CRISPR system) or homologous recombination methods.

[0017] In one or more embodiments, the cotton plant is a cotton plant with glands.

[0018] In one or more embodiments, the gossy plant is a gossy plant that expresses JAVL or its homologs.

[0019] In one or more embodiments, the *Gossypium* species includes upland cotton (*Gossypium hirsutum*).

[0020] In one or more embodiments, the enhancement of GoPGF expression includes administering an upregulator of GoPGF to enhance its expression or activity; preferably, the upregulator includes: a polynucleotide or expression construct encoding GoPGF, an upregulator that promotes the promoter-driven ability of the GoPGF gene, an upregulator that interacts with the GoPGF protein to enhance its expression or activity, a downregulator of GoPGF gene-specific microRNA, a chemical upregulator of GoPGF, or a combination thereof.

[0021] In one or more embodiments, the enhanced disease and pest resistance includes (but is not limited to): increased gland size in the plant, increased content of defensive compounds, reduced lesion area, and reduced pathogen biomass.

[0022] In one or more embodiments, the insect is a herbivorous insect.

[0023] In one or more embodiments, the herbivorous insect is a lepidopteran insect.

[0024] In one or more embodiments, the lepidopteran insects include: noctuid moths such as bollworm, pyralid moths such as Asian corn borer (Cephalopoda spp.), wheat moths such as pink bollworm, pyralid moths such as navel orange borer, diamondback moths such as diamondback moth, and swallowtail butterflies such as Common swallowtail.

[0025] In one or more embodiments, a high level of phytoalexin is equivalent to phytoalexin synthesis being promoted.

[0026] In one or more implementations, the interaction between JAVL and GoPGF includes: GoPGF directly binding to the JAVL promoter region G-box.

[0027] In one or more implementations, the interaction between JAVL and GoPGF includes JAVL directly binding to the GoPGF promoter region G-box.

[0028] In one or more embodiments, the JAVL includes its homologs, which are proteins or encoding genes from different species (species other than upland cotton) that have sequence homology with SEQ ID NO:2 or 4 or the polynucleotide encoding them derived from upland cotton.

[0029] In one or more embodiments, the expression construct (expression vector) includes: a gossypium plant expression vector.

[0030] In one or more embodiments, the expression construct (expression vector) includes: a non-viral vector and a viral vector.

[0031] In one or more embodiments, the downsizing indicates a significant downsizing, such as a downsizing of 20%, 40%, 60%, 80%, 90%, or more.

[0032] In another aspect of the invention, an application of JAVL or a downregulator thereof is provided for: increasing pigment glands, improving phytoalexin and jasmonic acid levels, and enhancing disease and pest resistance; preparing preparations that increase pigment glands, improve phytoalexin and jasmonic acid levels, and enhance disease and pest resistance; or, as a molecular marker for identifying pigment gland development, phytoalexin levels, jasmonic acid levels, or insect resistance in cotton plants.

[0033] In one or more embodiments, the downregulator includes (but is not limited to): a downregulator that knocks out or silences the JAVL gene or inhibits the activity of the JAVL protein; preferably, it includes: an interfering molecule that specifically interferes with the expression of the JAVL gene, a gene editing reagent for knocking out the JAVL gene (such as a gene editing reagent based on a CRISPR system), or a reagent for knocking out the JAVL gene based on homologous recombination.

[0034] In one or more embodiments, the interfering molecule is a VIGS molecule, dsRNA, antisense nucleic acid, small interfering RNA, or microRNA that targets the encoding gene of JAVL or its transcript for suppression or silencing, or a construct that can express or form the VIGS molecule, dsRNA, antisense nucleic acid, small interfering RNA, or microRNA; preferably, the construct that forms the VIGS molecule includes the nucleotide sequence shown in positions 138-571 of SEQ ID NO:1 or positions 84-517 of SEQ ID NO:3.

[0035] In one or more embodiments, the JAVL includes JAVL_A and JAVL_D, selected from the group consisting of:

[0036] (a) A polypeptide with an amino acid sequence as shown in SEQ ID NO:2 or SEQ ID NO:4;

[0037] (b) A JAVL derivative having the polypeptide function of (a) formed by substituting, deleting or adding one or more (e.g., 1 to 20, 1 to 10, 1 to 5, 1 to 3 or 1 to 2) amino acid residues of the amino acid sequence shown in (a);

[0038] (c) A JAVL derivative or its active fragment that has ≥80% homology (such as ≥82%, ≥85%, ≥90%, ≥92%, ≥94%, ≥96%, ≥98%, or ≥99% homology) to the amino acid sequence shown in SEQ ID NO:2 or SEQ ID NO:4, and possesses the polypeptide function of (a); or

[0039] (d) A polypeptide formed by adding a tag sequence or restriction enzyme site sequence to the N or C terminus of the amino acid sequence shown in SEQ ID NO:2 or SEQ ID NO:4, or by adding a signal peptide sequence to its N terminus.

[0040] In another aspect of the invention, a Gossypium cell, tissue, or organ is provided, wherein the Gossypium is a Gossypium expressing JAVL, and contains an exogenous JAVL downregulator, the downregulator comprising: a downregulator that knocks out or silences the JAVL gene or inhibits the activity of the JAVL protein; preferably, comprising: an interfering molecule that specifically interferes with the expression of the JAVL gene, a gene editing reagent for knocking out the JAVL gene (such as a gene editing reagent based on a CRISPR system), or a reagent for knocking out the JAVL gene based on homologous recombination; preferably, the interfering molecule is a VIGS molecule, dsRNA, antisense nucleic acid, small interfering RNA, microRNA, or a construct that can express or form the VIGS molecule, dsRNA, antisense nucleic acid, small interfering RNA, or microRNA, targeting the encoding gene of JAVL or its transcript for inhibition or silencing; preferably, the construct forming the VIGS molecule comprises: the nucleotide sequence shown in positions 138-571 of SEQ ID NO:1 or positions 84-517 of SEQ ID NO:3.

[0041] In one or more embodiments, the Gossypium plant cells, tissues or organs do not directly generate living Gossypium plants, or are not used as propagation material for Gossypium plants.

[0042] In another aspect of the invention, a method is provided for identifying pigment gland development, phytoalexin levels, jasmonic acid levels, or insect resistance in a *Gossypium* species. The method includes: identifying the expression or activity of JAVL in a *Gossypium* species; if the expression or activity of JAVL in the tested *Gossypium* species is low (e.g., below the average for that species), then its pigment glands are large, its phytoalexin levels are high, its jasmonic acid levels are high, or it exhibits insect resistance; preferably, the method further includes analyzing the expression ratio (G / J) of GoPGF to JAVL in the plant; if this ratio is higher than the average expression ratio (threshold) for that species of *Gossypium* (e.g., wild-type plants), then its pigment glands are large, its phytoalexin levels are high, its jasmonic acid levels are high, or it exhibits insect resistance.

[0043] In another aspect of the present invention, a method is provided for screening potential substances that increase pigment gland size, improve phytoalexin and jasmonic acid levels (or content), and enhance disease and pest resistance, comprising:

[0044] (1) Treat an expression system expressing JAVL with candidate substances; and

[0045] (2) Detect the expression or activity of JAVL in the system; if the candidate substance statistically reduces (e.g., by more than 5%, 10%, 15%, 20%, 30%, 50%, or 80%) the expression or activity of JAVL, it indicates that the candidate substance is a potential substance for increasing pigment glands, increasing the level (or content) of phytoalexin and jasmine, and improving disease and pest resistance.

[0046] In one or more embodiments, the system also expresses GoPGF, and the method further includes: analyzing the expression ratio (G / J) of GoPGF to JAVL. If the candidate substance can significantly increase the ratio (e.g., make it higher than the average expression ratio (threshold) of the Gossypium species (e.g., wild-type plants), it indicates that the candidate substance is a potential substance for increasing pigment glands, increasing phytoalexin and jasmonic acid levels (or contents), and improving disease and pest resistance.

[0047] In one or more embodiments, the system also expresses GoPGF, and the method further includes: analyzing the interaction between GoPGF and JAVL. If the candidate substance prevents JAVL from binding to the G-box of the GoPGF promoter (preventing GoPGF expression inhibition caused by JAVL binding to the GoPGF promoter) or prevents GoPGF from binding to the G-box of the JAVL promoter (preventing JAVL expression activation caused by GoPGF binding to the JAVL promoter), then the candidate substance is a potential substance for increasing pigment glands, increasing the level (or content) of phytoalexins and jasmonic acid, and improving disease and pest resistance.

[0048] In one or more embodiments, the screening method further includes setting up a control group to clearly distinguish the expression or activity of JAVL or GoPGF, or to clarify the interaction between JAVL and GoPGF.

[0049] In one or more embodiments, the system is selected from: cell system (cell culture system), subcellular system, solution system, plant tissue system, and plant organ system.

[0050] In another preferred embodiment, the method further includes conducting further cell experiments and / or transgenic experiments on the obtained potential substances to further identify substances from the candidate substances that are highly effective in improving plant regeneration capacity.

[0051] In one or more embodiments, the candidate substances include (but are not limited to): regulatory molecules targeting the JAVL protein or its encoding gene, or upstream or downstream proteins or genes thereof (such as regulators, interfering molecules (e.g., those that can interfere with upstream genes that "inhibit JAVL expression"), nucleic acid inhibitors, binding molecules (such as antibodies or ligands)), CRISPR constructs, small molecule compounds, etc.

[0052] Other aspects of the invention will be apparent to those skilled in the art from the disclosure herein. Attached Figure Description

[0053] Figure 1JAVL and GoPGF antagonize each other, thereby regulating the size of cotton pigment glands. (a) UMAP of JAVL in cotton leaves. Colors in the UMAP represent the proportion of JAVL expression levels in individual cells. MC, mesophyll cells; EC, epidermal cells; VC, vascular cells; GC, guard cells; PC, proliferating cells; SGC, secretory gland cells. (b) Expression heatmaps of GoPGF, JAVL_A, and JAVL_D in different tissues and ovules at different days after cotton flowering. Relative expression levels were calculated based on FPKM values. (c) Phenotypes of cotton stems, second true leaves, and individual pigment glands 14 days after JAVL VIGS. TRV:00 is the control group injected with empty TRV2 vector; TRV:JAVL, JAVL-VIGS cotton plants. Phenotype images of stems and second true leaves, scale bar 1 mm. Phenotype images of individual pigment glands, scale bar 50 μm. (d) Relative diameter of pigment glands (PGs) in the second true leaf of cotton seedlings after JAVL VIGS treatment. (mean±sd, n=10, ****P<0.0001, Student's t-test). (e) Transient co-expression of JAVL-YFP and GoPGF-mCherry in leaf epidermal cells of Nicotiana benthamiana under confocal microscopy. Scale bar, 50 μm. (f) Phenotypes in cotton stems, first true leaves, and individual pigment glands 10 days after GoPGF VIGS treatment. TRV: GoPGF, cotton plants with GoPGF silence. Scale bar for stem and first true leaf phenotypic maps: 1 mm. Scale bar for individual pigment gland phenotypic maps: 50 μm. (g) Relative diameter of pigment glands (PGs) in the first true leaf of cotton seedlings after GoPGF silencing. (mean±sd, n=10, ****P<0.0001, Student's t-test). (h) Luciferase complementation assay showed that JAVL interacts with GoPGF in vivo. The blue-red gradient represents the strength of the interaction. (i) Co-IP analysis of the interaction between JAVL and GoPGF. (j) Y2H verification of the interaction between JAVL and GoPGF. In Figures (d) and (g), the diameter of pigment glands in the leaves of TRV:00 plants is taken as 1.

[0054] Figure 2JAVL and GoPGF form a negative feedback loop to regulate jasmonic acid biosynthesis. (a) Relative expression levels of JAVL_A and JAVL_D in GoPGF leaves (TRV:00). TRV:00 is the control group injected with the empty TRV2 vector; TRV:GoPGF is a cotton plant with GoPGF silence. Relative expression levels were calculated based on FPKM values ​​(mean±sd, n=3, ***P<0.001, Student's t-test). (b) Heatmap of expression patterns of transcription factors specifically expressed in pigment glands in TRV:00 and TRV:JAVL leaves (TRV:JAVL, JAVL-VIGS cotton plants). Relative expression levels were calculated based on FPKM values, with the color of each square representing the proportion of expression levels of the respective gene. GoPGF (Gh_A12G2172); GoHSFA4a (Gh_A05G3255); GoNAC42 (Gh_A06G1947); CGP1, Cotton Gland Pigmentation1 (Gh_A07G0703); JUB1, JUNGBRUNNEN 1 (Gh_A01G0267) were used for analysis. (c) GoPGF showed binding affinity for the G-box sequence within the JAVL promoter. (d) EMSA showed the binding affinity of JAVL for the G-box sequence within the GoPGF promoter. (e) Dual-LUC detection of the activation effect of GoPGF on the JAVL promoter (mean±sd, n=3, **P<0.01, Student's t-test). (f) Dual-LUC showed the inhibitory effect of JAVL on GoPGF transcription (mean±sd, n=3, ***P<0.001, Student's t-test). (g) TRV:JAVL and TRV:GoPGF leaf expression ratio (G / J ratio) (mean±sd, n=3). (h) TRV:JAVL and TRV:JAVL leaf extracts of jasmonic acid (JA, m / z: 209.1 / 59.1) and jasmonic acid isoleucine (JA-Ile, m / z: 322.2 / 130.1) extracts. (i) TRV:JAVL leaf relative contents of JA and JA-Ile (mean±sd, n=5, ****P<0.0001, Student's t-test).(j) Relative expression levels of AOS (Gh_D05G2484), AOC4 (Gh_A08G0314), JAR1 (Gh_A08G1120), and LOX3 (Gh_D06G2176) in TRV:JAVL leaves (mean±sd, n=3, *P<0.05, ***P<0.001, ****P<0.0001, Student's t-test). AOS, propylene oxide synthase; AOC4, propylene oxide cyclase 4; JAR1, jasmonic acid isoleucine synthase 1; LOX, lipoxygenase 3 were used for analysis. (k) EMSA showed the binding affinity of GoPGF and JAVL to the G-box sequence within the AOS promoter. (l) Dual-LUC showed that JAVL activated the GoPGF promoter and inhibited the AOS promoter (mean±sd,n=3,ns P>0.05,**P<0.01,Student's t-test).

[0055] Figure 3The expression ratio of GoPGF to JAVL enhanced disease and pest resistance. (a) Heatmap of expression patterns of gossypol and terpene biosynthetic genes in TRV:JAVL and TRV:00 leaves. TRV:00 is the control group injected with the empty TRV2 vector; TRV:JAVL, JAVL-VIGS cotton plants. Relative expression levels were calculated based on FPKM values, and the color of each square represents the proportional expression level of its respective gene. CDN, (+)-δ-juniper terpene synthase; DH1, alcohol dehydrogenase-1; CYP706B1, CYP82D113, CYP71BE79, cytochrome P450 monooxygenase; SPG, specialized glyoxalase I; GhDIR5 and GhDIR6, guide proteins. (b) HPLC analysis of cotton leaf extracts after JAVL VIGS. Peaks corresponding to different terpenes are indicated by dashed lines. HGQ, hemigossypolone; G, gossypol. H1-4, noctuidin. Statistical analysis showed the relative contents of nonvolatile terpenes, as shown in Figure (c), (mean ± sd, n = 6, Student's t-test). The compound content in the leaves of TRV:00 plants is taken as 1. (d) GC-MS analysis of cotton leaf extracts after JAVL treatment with VIGS. The extract ion chromatogram at m / z 136 corresponds to the volatile monoterpenes α-pinene, β-pinene, β-myrcene, D-limonene, and trans-β-ocimene. The extract ion chromatogram at m / z 204 shows the retention times of the volatile sesquiterpenes β-caryophyllene, α-humulene, Guaia-1(10), 11-diene, and β-bisabolene. Peaks corresponding to different volatile terpenes are indicated by dashed lines. Statistical analysis showed the relative contents of volatile terpenes, as shown in Figure (e), (mean ± sd, n = 6, Student's t-test). (f) Growth of bollworm larvae feeding on leaves of TRV:JAVL and TRV:00. Third-instar larvae were fed fresh cotton leaves for 3 days. The weight of bollworm larvae was measured (mean±sd, n=20, ****P<0.0001, Student's t-test). (g) Leaves of TRV:00 and TRV:JAVL 4 days after inoculation with gray mold. Scale bar, 1 cm. (hi) Pathogenic area (h) of cotton leaves (mean±sd, n=4, ****P<0.0001, Student's t-test) and relative biomass of gray mold (i) (mean±sd, n=6, ****P<0.0001, Student's t-test) 4 days after inoculation with gray mold. In Figure (i), the biomass of gray mold in leaves of TRV:00 is expressed as 1. Detailed Implementation

[0056] Through in-depth research, the inventors have revealed a pigment gland-specific gene, JAVL (jasmonate-associated VQ motif-like gene), which encodes a protein with a VQ domain. This gene regulates the size of pigment glands, the biosynthesis of jasmonate, and other plant defense compounds. This invention provides a new target for improving plant disease resistance.

[0057] the term

[0058] As used herein, the insects described are herbivorous insects; preferably including noctuid moths such as the cotton bollworm, pyralid moths such as the Asian corn borer of the genus *Ceratophyllum*, gracilid moths such as the red cotton bollworm, pyralid moths such as the navel orange borer, diamondback moths such as the diamondback moth, and swallowtail butterflies such as the common swallowtail butterfly.

[0059] As used herein, the fungi include fungi of the order Helotiales, and further include fungi of the genus Botrytis cinerea.

[0060] As used herein, "plant" includes plants that express JAVL or contain JAVL and the signaling pathways it participates in (such as, but not limited to, genes involved in jasmonic acid synthesis pathways such as GoPGF and AOS, genes involved in phytoalexin synthesis pathways, etc.). Based on knowledge in the art, plants expressing JAVL and the signaling pathways they participate in inherently possess the mechanisms of action claimed in this invention, and can achieve the technical effects claimed in this invention. In some preferred embodiments, the plant is an economic crop, preferably a cotton crop. More specifically, upland cotton, etc.

[0061] Regarding "control plants," selecting appropriate control plants is a routine part of experimental design and can include corresponding wild-type plants or transgenic plants without the target gene. Control plants are generally the same plant species or even varieties that are the same as or belong to the same class as the plant being evaluated. Control plants can also be individuals that have lost their transgenic components due to segregation. As used in this article, control plants refer not only to whole plants but also to plant parts, including leaves, glands, seeds, or parts thereof.

[0062] As used herein, “upregulation” includes: promotion, overexpression, enhancement, etc., which are statistically significant or marked upregulation, promotion, enhancement, or enhancement, such as upregulation, promotion, enhancement, or enhancement of 20%, 40%, 60%, 80%, 90%, or higher.

[0063] As used herein, “downregulation” includes: weakening, reducing, lowering, inhibiting; indicating significant downregulation, weakening, lowering, inhibiting, such as downregulation, weakening, lowering, inhibiting or downregulating by 20%, 40%, 60%, 80%, 90% or lower.

[0064] As used herein, “high expression or high activity” means that the expression or activity of a target gene / protein in a specific plant (e.g., a modified plant) is statistically significantly increased compared to the average expression or activity of the same type or plant species, such as by 10%, 20%, 40%, 60%, 80%, 90%, or higher.

[0065] As used herein, “low expression or low activity” means that the expression or activity of a target gene / protein in a particular plant (e.g., a modified plant) is statistically significantly reduced compared to the average expression or activity of the same type or plant species, such as by 10%, 20%, 40%, 60%, 80%, 90%, or less.

[0066] As used in this article, the terms "pathway," "signaling pathway," and "regulatory pathway" are used interchangeably.

[0067] JAVL

[0068] In this invention, unless otherwise specified, the JAVL protein includes its homologs (homologous proteins). The JAVL is a polypeptide (protein) having the amino acid sequence shown in SEQ ID NO: 2 or 4. This invention also includes sequence variants having the same function as the JAVL protein.

[0069] The variations include (but are not limited to): deletions, insertions, and / or substitutions of several amino acids (typically 1-50, preferably 1-30, more preferably 1-20, most preferably 1-10, and even more preferably 1-8 or 1-5); and additions or deletions of one or more amino acids (typically up to 20, preferably up to 10, and more preferably up to 5) at the C-terminus and / or N-terminus. Any protein with high homology to the JAVL protein (e.g., 70% or higher homology to the polypeptide sequence shown in SEQ ID NO: 2 or 4; preferably 80% or higher; more preferably 90% or higher, such as 95%, 98%, or 99% homology) and having the same functions as the JAVL protein is also included in this invention.

[0070] In this invention, the term "JAVL protein" also includes its homologs. It should be understood that while JAVL proteins derived from specific species are preferred for study in this invention, other polypeptides or genes derived from other species, particularly Malvaceae plants, that are highly homologous to the JAVL protein (e.g., having more than 70%, more particularly 80%, 85%, 90%, 95%, or even more than 98% sequence identity) are also within the scope of this invention.

[0071] In this invention, polypeptides derived from species other than upland cotton that have high homology with the sequence shown in SEQ ID NO:2 or 4, or that play the same or similar functions in the same or similar signaling pathways, are also included.

[0072] This invention also relates to a polynucleotide sequence encoding the JAVL protein of this invention or a sequence variant thereof. The polynucleotide may be in DNA or RNA form. DNA form includes cDNA, genomic DNA, or synthetically produced DNA. The DNA may be single-stranded or double-stranded. The DNA may be a coding strand or a non-coding strand. The coding region sequence encoding the mature polypeptide may be identical to or a degenerate variant of the coding region sequence shown in SEQ ID NO:2 or 4. As used herein, "degenerate variant" refers to a nucleic acid sequence encoding a polypeptide having the sequence of SEQ ID NO:2 or 4, but differing from the gene sequence shown in SEQ ID NO:1 or 3. This invention also relates to variants (variants) of the aforementioned polynucleotide that encode polypeptides or fragments, analogs, and derivatives of polypeptides having the same amino acid sequence as those of this invention.

[0073] Regulatory role of the JAVL gene

[0074] Based on extensive research screening and systematic analysis, the inventors identified the JAVL gene, which can regulate pigment glands, phytoalexin levels, jasmonic acid levels, or disease and pest resistance in cotton plants.

[0075] JAVL exhibits a dual inhibitory effect on the key jasmonic acid biosynthesis gene AOS. It directly binds to the AOS promoter to inhibit its transcription and interacts with the MYC2-like transcription factor GoPGF, inhibiting GoPGF's activation of AOS. GoPGF can directly activate JAVL transcription, thus antagonizing JAVL in regulating gland size. JAVL expression was significantly decreased in GoPGF-VIGS plants, while GoPGF expression was significantly increased in JAVL-VIGS plants, indicating that JAVL inhibits GoPGF, establishing a negative feedback loop. Furthermore, JAVL maintains homeostatic regulation of jasmonic acid levels by inhibiting the expression of the jasmonic acid biosynthesis gene and weakening its activation through interaction with GoPGF, thereby negatively regulating jasmonic acid levels. Inhibition of JAVL expression, i.e., an increase in the proportion of GoPGF to JAVL expression, leads to enlargement of cotton pigment glands, an increase in jasmonic acid and defensive compounds, and enhanced cotton's resistance to pests and pathogens.

[0076] These findings reveal a new mechanism for regulating gland size and secondary metabolite biosynthesis, providing innovative strategies for strengthening plant defenses.

[0077] GoPGF is a reported major transcription factor controlling cotton gland development and belongs to the bHLH protein family.

[0078] Based on the above-mentioned new discovery of the inventors, a use is provided for JAVL protein or its regulatory molecule for: increasing pigment glands, improving phytoalexin and jasmonic acid levels, and enhancing disease and pest resistance; preparing preparations that increase pigment glands, improve phytoalexin and jasmonic acid levels, and enhance disease and pest resistance; or, as a molecular marker for identifying pigment gland development, phytoalexin levels, jasmonic acid levels, or insect resistance in cotton plants.

[0079] Once the function of the JAVL is known, various methods known to those skilled in the art, as used herein, can be applied. The downregulators of the JAVL or its encoding gene include inhibitors, antagonists, blockers, and other terms that are used interchangeably.

[0080] The downregulator of JAVL or its encoding gene refers to any substance that can reduce the activity of JAVL, reduce the stability of JAVL or its encoding gene, downregulate JAVL expression, reduce the effective duration of JAVL, or inhibit the transcription and translation of the JAVL gene. These substances can all be used in this invention as substances useful for downregulating JAVL, thereby inhibiting colorectal cancer or its metastasis. For example, the downregulator is: an interfering RNA molecule or antisense nucleotide that specifically interferes with JAVL gene expression; an antibody or ligand that specifically binds to the protein encoded by the JAVL gene; etc.

[0081] As one aspect of the present invention, the downregulator can be a JAVL-specific interfering RNA molecule. Those skilled in the art will understand that such interfering RNA molecules can be prepared using the JAVL sequence information provided in this invention. There are no particular limitations on the preparation method of the interfering RNA molecule, including but not limited to: chemical synthesis, in vitro transcription, etc. The interfering RNA can be delivered into cells using appropriate transfection reagents, or it can be delivered into cells using various techniques known in the art.

[0082] In some embodiments, RNAi is used to suppress JAVL. RNAi is an evolutionarily conserved cellular defense mechanism used to control the expression of exogenous genes in most eukaryotes, including humans. RNAi is typically triggered by double-stranded RNA (dsRNA) and induces sequence-specific mRNA degradation of the single-stranded target RNA. The mediators of mRNA degradation are small interfering RNA duplexes (siRNAs), which are typically produced by the enzymatic cleavage of long dsRNA within the cell. siRNAs are typically about 21 nucleotides long (e.g., 21–23 nucleotides). After the small RNA or RNAi is introduced into the cell, the sequence is believed to be delivered to an enzyme complex called the RISC (RNA-induced silencing complex). The RISC recognizes the target and cleaves it with a nuclease. Notably, if a larger RNA sequence is delivered to the cell, the RNase III enzyme (Dicer) converts the longer dsRNA into a 21–23 nt ds-siRNA fragment.

[0083] As a particularly preferred embodiment of the present invention, the downregulator can be the VIGS (virus-induced gene silencing) method, which inhibits JAVL, thereby exerting a regulatory effect. The VIGS method is a genetic technique that uses a recombinant virus containing a target gene fragment to suppress the expression of endogenous genes in plants.

[0084] In one embodiment of the present invention, shRNA technology is used for interference. shRNA is an RNA sequence that can rotate a tight hairpin, which can be used to silence gene expression through RNA interference. shRNA is introduced into cells using a vector and utilizes a promoter (such as U6) to ensure that shRNA is always expressed. This vector is typically delivered to daughter cells, allowing gene silencing to be inherited. The shRNA hairpin structure is cleaved into siRNA by cellular mechanisms and then binds to the RNA-induced silencing complex (RISC). This complex binds to and cleaves mRNAs that match the bound siRNA. shRNA is transcribed by RNA polymerase III.

[0085] In one embodiment of the invention, antisense compounds that specifically hybridize with one or more nucleic acids encoding JAVL are used to regulate JAVL expression. The specific hybridization of oligomers with their target nucleic acids interferes with the normal function of the nucleic acids. This regulation of target nucleic acid function by compounds that specifically hybridize with the target nucleic acid is commonly referred to as "antisense".

[0086] In one embodiment of the present invention, a CRISPR / Cas (e.g., Cas9) system can be used for targeted gene editing to knock out the JAVL gene in a region of the targeted disease. Common methods for knocking out the JAVL gene include co-transferring sgRNA or a nucleic acid capable of forming said sgRNA, Cas9 mRNA or a nucleic acid capable of forming said Cas9 mRNA, to the target region or target cells. After identifying the target site, known methods can be used to introduce sgRNA and Cas9 into the cells. The nucleic acid capable of forming said sgRNA is a nucleic acid construct or expression vector, or the nucleic acid capable of forming said Cas9 mRNA is a nucleic acid construct or expression vector. These expression vectors are introduced into the cells, thereby forming active sgRNA and Cas9 mRNA within the cells.

[0087] As an optional approach of this invention, homologous recombination can be used to specifically target JAVL, causing expression defects or deletions. Alternatively, Cre and Loxp methods can be applied to selectively knock out, reduce, or inactivate related genes in the genome of animals or cells.

[0088] In one embodiment of the present invention, the downregulator is a small molecule compound targeting JAVL. Those skilled in the art can employ methods suitable for screening small molecule compounds to screen such compounds. The screening can rely on various existing or future compound libraries in the art, or can involve establishing new compound libraries independently.

[0089] The above are some representative methods for downregulating JAVL. It should be understood that the present invention provides a novel target. After those skilled in the art understand the overall scheme of the present invention, they can also adopt other methods known in the art or methods under development to regulate JAVL. These methods are also included in the present invention.

[0090] The present invention also includes plants obtained using any of the foregoing methods, said plants comprising: transgenic plants into which the coding nucleic acid of the polypeptide has been transferred.

[0091] Plant breeding screening or targeted screening of regulatory molecules

[0092] Based on the inventors' new findings, this invention provides a molecular marker, namely the JAVL gene, applicable to methods for determining pigment gland development, phytoalexin levels, jasmonic acid levels, or insect resistance in Gossypium species. This invention also relates to specific molecular markers designed for the JAVL gene, and identification strategies. This allows for early determination of pigment gland development, phytoalexin levels, jasmonic acid levels, or insect resistance in plants.

[0093] Therefore, the present invention provides a method for specifically identifying pigment gland development, phytoalexin levels, jasmonic acid levels, or insect resistance in *Gossypium* species, comprising: identifying the expression or activity of JAVL in a test *Gossypium* species; if the expression or activity of JAVL in the test *Gossypium* species is low (e.g., below the average value of wild-type *Gossypium* species), then its pigment glands are large, its phytoalexin levels are high, its jasmonic acid levels are high, or it has insect resistance; preferably, it further comprises analyzing the expression ratio (G / J) of GoPGF to JAVL in the plant, and if the ratio is higher than the average expression ratio (threshold) of the *Gossypium* species, then its pigment glands are large, its phytoalexin levels are high, its jasmonic acid levels are high, or it has insect resistance.

[0094] Based on the novel findings of this invention, those skilled in the art can employ any of the various techniques known in the art or under development to analyze nucleic acid sequences, and these techniques are all included in this invention. The methods described include, but are not limited to: sequencing, PCR amplification, probe methods, hybridization, restriction enzyme digestion analysis, allele polymorphism analysis (such as melting curve analysis) for nucleic acid sequence identification, etc.

[0095] The identification method of this invention only requires PCR reaction and / or agarose gel electrophoresis, and by judging the length of the corresponding PCR product, the phenotype of the sample can be accurately and quickly determined. It is low-cost, suitable for large-scale identification, and requires very little sample. If needed, those skilled in the art can design primers for identifying the molecular markers.

[0096] Methods for obtaining DNA from the sample to be tested are well-known to those skilled in the art, such as the traditional phenol / chloroform / isoamyl alcohol method, or commercially available DNA extraction kits. Polymerase chain reaction (PCR) is also well-known to those skilled in the art; its basic principle is the in vitro enzymatic synthesis of specific DNA fragments. The method of this invention can be performed using conventional PCR techniques.

[0097] This invention has promising applications in molecular design breeding and crop variety improvement using genetic engineering technology.

[0098] After understanding the function of the JAVL gene, it can be used as a molecular marker for targeted plant screening. This new discovery can also be used to screen for substances or potential substances that can regulate pigment gland development, phytoalexin levels, jasmonic acid levels, or insect resistance by modulating this mechanism.

[0099] This invention provides a method for screening potential substances with high levels of phytoalexins, volatile monoterpenes or sesquiterpenes, or insect resistance, the method comprising: (1) treating an expression system expressing JAVL with a candidate substance; and

[0100] (2) Detect the expression or activity of JAVL in the system; if the candidate substance statistically reduces the expression or activity of JAVL, it indicates that the candidate substance is a potential substance that increases pigment glands, increases the level (or content) of phytoalexin and jasmine, and improves disease and pest resistance.

[0101] Furthermore, the proteins or genes that interact with JAVL discovered in this invention can also be used in the screening process.

[0102] Methods for screening substances that act on proteins or genes or specific regions thereof as targets are well known to those skilled in the art, and these methods can all be used in this invention. The candidate substances can be selected from: peptides, polymeric peptides, peptide-like substances, non-peptide compounds, carbohydrates, lipids, antibodies or antibody fragments, ligands, small organic molecules, small inorganic molecules, and nucleic acid sequences, etc. Depending on the type of substance to be screened, those skilled in the art understand how to select an appropriate screening method.

[0103] The detection of protein-protein interactions and their strength can be achieved using a variety of techniques well-known to those skilled in the art, such as GST-Pull Down, bimolecular fluorescence complementation assays, yeast two-hybrid systems, or immunoprecipitation techniques.

[0104] Through large-scale screening, a class of substances that specifically act on JAVL protein or its encoding gene can be obtained, which have regulatory effects on pigment gland development, phytoalexin levels, and jasmonic acid levels (and thus help regulate insect resistance).

[0105] The present invention will be further illustrated below with reference to specific embodiments. It should be understood that these embodiments are for illustrative purposes only and are not intended to limit the scope of the invention. Experimental methods in the following embodiments that do not specify specific conditions are generally performed according to conventional conditions such as those described in J. Sambrook et al., Molecular Cloning: A Laboratory Manual, 3rd Edition, Science Press, or according to the manufacturer's recommendations.

[0106] JAVL gene ID: In upland cotton (Gossypium hirsutum), there are two copies of the JAVL gene, with gene IDs of Gh_A12G0442 and Gh_D12G0445. In subsequent experimental analyses, unless otherwise specified, regulation of "JAVL" refers to the simultaneous regulation of both genes within their conserved regions.

[0107] JAVL_A(Gh_A12G0442) nucleotide sequence cDNA (SEQ ID NO:1):

[0108] ATGAACTCCTCTACAGGAACCTCCAGTGAATGGATGCAATTCTATGAACAAAGTATGGATGAAATGTCGGCATCATCATCCTTGGGATTCTCTGATGTTGATGCCACTATTGTAGCCTCTTCGGAGAGCAACCAGCT GAACCTTAG CTCAGGAAGAGATGATCAGTTGGCAAAGGGTTCTTCCCCAAAGCCAATAAGAAGGCGGGCAAGAGCTTCCAAGAAAA CACCCACCACCCTTCTCAATGCTGACGCCAGCAATTTTCGAGCCTTAGTGCAACGATTTACTGGTTGTCCTACAACA CCACCCCTTTCAACCAACAACAGAAGAGGCCCTATCAACTTGAACTTTGCTCTCGGGAGTGATCAAAATCAGAGCGG GACTGCAAGTTCCGTAATGCCAGCCGCTGCCAACGATTATTATTATCCACCAAGTCATCAACAACATCATGCGGTAT CATTCCCCAATGTTCACCCCGATGCCTACTTTAGCTCTTCTAGCAGTAGAGCTAACGCGGATCAGATCCTCCACGAT TTTGACTTGGATAATATTTCTTTGCAGGCGTTTAATAGGG ACGTCCCTTACACCAATGAAAATGCAAATGATGGCAAGTACTTCTTG

[0109] Protein sequence encoded by JAVL_A (Gh_A12G0442) (SEQ ID NO: 2):

[0110] MNSSTGTSSEWMQFYEQSMDEMSASSSLGFSDVDATIVASSESNQLNLSSGRDDQLAKGSSPKPIRRRARASKKTPTTLLNADASNFRALVQRFTGCPTTPPLSTNNRRGPINLNFALGSDQNQSGTASSVMPAAANDYYYPPSHQQHHAVSFPNVHPDAYFSSSSSRANADQILHDFDLDNISLQAFNRDVPYTNENANDGKYFL

[0111] Nucleotide sequence cDNA of JAVL_D (Gh_D12G0445) (SEQ ID NO: 3):

[0112] ATGGATGAAATGTCGGCATCATCATCCTTGGGATTCTCTGATGTTGATGCCACTATTGTAGCCTCTTCGGAGAGCAACCAGCT GAACCTTAGTCAGGAAGAGATGATCAGTTGGCAAAGGGTTCTTCCCCAAAGCCAATAAGAAG GCGGGCAAGAGCTTCCAAAAAAACACCCACCACCCTTCTCAATGCTGACGCCAGCAATTTTCGAGCCTTAGTGCAAC GATTTACTGGTTGTCCTACAACACCATCCCTTTCAACCAACAACAGAAGAGGCCCTATCAACTTGAACTTTGCTCTC GGGAGTGATCACCATCAGAGCGGGACTGCAAGTTCCGTAATGCCAGCCGCTGCCAACGATTATTATCCACCAAG TCATCAACAACATCATGCGGTATCATTCCCCAATGTTCACCCCGATGCCTACTTTAGCTCTTCTAGCAGTAGAGCTA ACGCGGATCAGATCCTCCACGATTTTGACTTGGATAATATTTCTTTGCAGGCGTTTAATAGGG ACGTCCCTTACACCAATGAAAATGCAAATGATGGCAATTACTTCTTG

[0113] Protein sequence encoded by JAVL_D (Gh_D12G0445) (SEQ ID NO: 4):

[0114] MDEMSASSSLGFSDVDATIVASSESNQLNLSSGRDDQLAKGSSPKPIRRRARASKKTPTTLLNADASNFRALVQRFTGCPTTPSLSTNNRRGPINLNFALGSDHHQSGTASSVMPAAANDYYYPPSHQQHHAVSFPNVHPDAYFSSSSSRANADQILHDFDLDNISLQAFNRDVPYTNENANDGNYFL

[0115] The primers used in this invention are shown in Table 1.

[0116] Table 1

[0117]

[0118]

[0119] Example 1: Transcriptome sequencing data analysis of cotton with glands and cotton VIGS (virus-induced gene silencing) experiments demonstrate that JAVL regulates the size of pigment glands.

[0120] a: Expression characteristics of JAVL in cotton glands

[0121] During their analysis of single-cell data from cotton true leaves, the inventors discovered that JAVL was specifically highly expressed in pigment gland cells. Figure 1 a).

[0122] Further analysis of JAVL expression characteristics in different cotton tissues revealed that JAVL has a similar expression pattern to the gland development positive regulator GoPGF, and is highly expressed in roots, stems, leaves, pistils, and ovules during the later stages of ovule development. Figure 1 b).

[0123] The above results suggest that JAVL is involved in the developmental regulation of cotton pigment glands.

[0124] b: Constructing the VIGS vector for the JAVL gene

[0125] PCR amplification of a 300-500 bp gene-specific fragment of JAVL (two sequences can be amplified, including JAVL_A sequences 138-571 and JAVL_D sequences 84-517) was performed. The forward primer JAVL-TRV2-F was used to introduce the BamHI restriction site, and the reverse primer JAVL-TRV2-R was used to introduce the XbaI restriction site. The fragments were then loaded into the pTRV2 vector. Homologous recombination was used to ligate the JAVL gene into the pTRV2 vector. The correctly sequenced vector was then transformed into Agrobacterium GV3101 and cultured upside down at 28°C for 2-3 days.

[0126] c: Transfect cotton with the JAVL gene using the VIGS vector.

[0127] The correctly sequenced plasmid was transformed into Agrobacterium GV3101 competent cells. Simultaneously, Agrobacterium containing the pTRV1 vector and Agrobacterium containing the PDS, JAVL (including JAVL_A and JAVL_D), and GoPGF genes were streaked. Single clones were picked for colony PCR verification. PCR-positive Agrobacterium clones were picked and transferred to 2 mL of selective antibiotic LB medium and incubated overnight at 28°C until the OD value reached 2.5. Simultaneously, pTRV1 and Agrobacterium SU (the Agrobacterium strain containing PDS and pTRV2) were gently shaken. The shaken Agrobacterium was then transferred at a 1:100 ratio to 50 mL of selective antibiotic LB medium and incubated overnight at 28°C with shaking. The cells were centrifuged at 8,000 g for 10 min at room temperature and resuspended in resuspending buffer (10 mM MES, 10 mM MgCl2, 150 μM Macetosyringone, pH 5.8) to check the OD value. 600 Adjust the pH to around 1.0 and incubate at room temperature for at least 3 hours to activate the bacteria. Mix Agrobacterium resuspension with different plasmids and Agrobacterium resuspension with pTRV1 vector at a 1:1 (V / V) ratio, and inject into the back of the cotton cotyledon using a 1 mL syringe for transfection. Observe whether the control turns yellow 2-3 weeks after injection. Take the second true leaf, flash-freeze in liquid nitrogen, and store at -70℃.

[0128] Microscopic observation of the second true leaf of the JAVL-inhibited plant revealed a significant increase in the diameter of the glands in both the stem and leaf. Figure 1 c and Figure 1 d).

[0129] Subcellular localization of JAVL was investigated by expressing JAVL-YFP in Nicotiana benthamiana. The results showed that JAVL-YFP is localized in both the cytoplasm and nucleus, while GoPGF is localized only in the nucleus. Figure 1 e). Previous studies have shown that inhibiting GoPGF leads to a glandless phenotype. The inventors further investigated the function of GoPGF using VIGS; after 10 days of VIGS treatment, glands were significantly reduced in the first true leaves. Figure 1 f), and under GoPGF expression inhibition, the gland diameter was significantly reduced (f). Figure 1 g).

[0130] Example 2: Protein-protein interactions exist between JAVL and GoPGF.

[0131] a: Bimolecular luciferase complementation experiment

[0132] Recombinant vectors JW771-JAVL-nLUC and JW772-cLUC-GoPGF were constructed and transformed into GV3101(pSoup-p19) Agrobacterium, along with the JW771 and JW772 control vectors, respectively. The cells were resuspended in buffer to OD200. 600 The concentration was approximately 1.0. Equal volumes of JW771 / JW771-JAVL-nLUC and JW772 / JW772-cLUC-GoPGF strains were mixed. Tobacco was injected, and after a transient co-expression period of 48 h, leaf tissues were infiltrated with 1 mM D-fluorescein (potassium salt) (APExBIO). Fluorescence was detected using a Tanon 5200SF (Tanon). The results showed that fluorescence signals were detected only in leaf tissues co-expressing JW771-35S-JAVL-nLUC and JW772-35S-cLUC-GoPGF, indicating a protein-protein interaction between JAVL and GoPGF. Figure 1 h).

[0133] b: Immunoprecipitation assay

[0134] JAVL and GoPGF were transiently co-expressed in cotton cotyledons via pCAMBIA1300-JAVL-YFP and pEAQ-GoPGF-FLAG, respectively. Total protein was extracted and then... Samples expressing YFP or JAVL were enriched at 4°C for 1 h. They were then washed with IP buffer. Five times. The interacting protein GoPGF-FLAG was detected by anti-FLAG immunoblotting, indicating a protein-protein interaction between JAVL and GoPGF. Figure 1 i).

[0135] c: Yeast two-hybrid experiment

[0136] CDS of JAVL and GoPGF were inserted into pGBKT7 and pGADT7 cells, respectively. JAVL-pGBKT7 and GoPGF-pGADT7 cells, along with the control, were co-transformed into AH109 chemocompetent cells (Weidi Bio). After two days of growth on SD-LT medium, single colonies co-transformed into AH109 cells were serially diluted onto SD-LTH (0, 20, 40, 60 mM 3-AT and 15 μg / mL X-α-gal) medium. After 2-3 days of incubation at 30°C, the addition of X-α-gal resulted in a blue phenotype in the positive control and experimental groups, while the negative control group did not turn blue. This further demonstrates the existence of protein-protein interactions between JAVL and GoPGF. Figure 1 j).

[0137] Example 3: JAVL and GoPGF can mutually regulate transcriptional activity.

[0138] To further investigate the mechanisms by which JAVL and GoPGF regulate pigment gland size, the inventors examined the expression level of JAVL in GoPGF-silenced cotton and found that JAVL expression was almost undetectable. Figure 2 a) This suggests that GoPGF plays a role in activating JAVL expression. Conversely, in JAVL-VIGS plants, GoPGF expression was significantly increased ( Figure 2 b), and the expression of GoHSFA4a, JAVL, CGP1, and JUB1, genes downstream of GoPGF that regulate pigment gland density, pigmentation, or the biosynthesis of defense compounds, was significantly upregulated. Figure 2 (d)(Ma et al. 2016; Long et al. 2023; Gao et al. 2020; Lin et al. 2023). These findings suggest that JAVL has an inhibitory effect on GoPGF and its downstream target genes.

[0139] a: Construct a prokaryotic expression vector by PCR amplification of JAVL and GoPGF.

[0140] Using JAVL-pET32a-F / R and GoPGF-pET32a-F / R as primers, respectively, high-fidelity enzymes were used. Full-length cDNA fragments of JAVL and GoPGF were amplified using HSDNA Polymerase. PCR conditions were as follows: 95°C for 3 minutes of denaturation; 95°C for 30 seconds of denaturation; 56°C for 30 seconds of annealing; 72°C for 1 minute and 30 seconds of extension; steps two through four were repeated for 40 cycles; 72°C for 10 minutes. The fragments were then ligated into the pre-digested pET-32a prokaryotic expression vector using homologous recombination.

[0141] b: Prokaryotic expression

[0142] The correctly sequenced JAVL and GoPGF prokaryotic expression vector plasmids were transformed into strain BL21 and plated on Amp-resistant LB medium, incubated overnight at 37°C. The next day, single clones were picked for colony PCR. PCR-positive clones were added to 2 mL of Amp-resistant liquid LB (100 μg / mL) and incubated overnight at 37°C. Transplantation was then performed at a 1:100 ratio into 500 mL of LB medium, shaken, and incubated at 37°C. [The text abruptly ends here, likely due to an incomplete sentence or missing information.] 600 Within the range of 0.6 to 0.8, add isopropyl-β-D-thiopyranogalactopyranoside (IPTG) to a final concentration of 0.5 mM / L, and transfer to a shaker at 16°C for low-temperature induction for about 20 h.

[0143] c: Prokaryotic protein expression purification

[0144] Centrifuge the cultured bacterial solution at 5,000g for 8 min, then resuspend the precipitate in 10 mL of binding buffer and disrupt it using a one-shot Cell Disruptor System at a pressure of 20–25 kpsi. Centrifuge again at 13,500g for 30 min at 4°C to remove cell debris, and collect the supernatant for protein purification. Pack a 2 mL Ni-NAT agrose column and equilibrate the Ni column with 15 mL of binding buffer. Add the supernatant from the previous step to the equilibrated 2 mL Ni-NAT agrose column. After the solution has eluted, wash the Ni-NAT agrose with 15 mL of wash buffer. Elute JAVL and GoPGF proteins from the Ni-NTA nickel column using 2 mL of elution buffer, and quantify the protein concentration using the Bradford method with bovine serum albumin (BSA) as a reference.

[0145] Buffer solution:

[0146] Binding buffer: 50mM Tris-HCl, 300mM NaCl

[0147] Wash buffer: 50mM Tris-HCl, 300mM NaCl, 20mM Imidazole

[0148] Elution buffer: 50mM Tris-HCl, 300mM NaCl, 200mM Imidazole

[0149] d: EMSA

[0150] 5×EMSA buffer: 25% glycerol, Tris 100mM, BSA 0.2mg / mL, pH=7.9. ​​After filtration through a 0.45μm filter membrane, aliquot and store at -20℃.

[0151] 5×binding buffer (160μL): 5×EMSA buffer (141.6μL), 0.5M DTT (1.6μL), 1MMgCl2 (8μL), ddH2O (8.8μL).

[0152] Non-denatured protein gel (10 μL for preparing a 1.5 mm thick non-denatured gel): 10×TBE 0.5 mL, 50% glycerol 0.5 mL, 40% acrylamide (29:1) 1.125 mL, 30% APS 23.35 μL, TEMED 3.5 μL, ddH2O 7.875 mL.

[0153] Binding system (20 μL): 4 μL 5×EMSA binding buffer, 2 μL salmon sperm DNA (1 μg / μL), DNA-cy5 (0.4 nmol, 30 bp 3' cy5-labeled probe containing the G-box of the JAVL (or GoPGF) promoter region), GoPGF (or JAVL) protein (3 ng), add water to 20 μL, mix well, and incubate at room temperature in the dark for 30 min.

[0154] After the non-denaturing gel solidifies, pre-cooled 1×TBE is added to the electrophoresis tank, and the mixture is pre-run at 180V for 60 minutes. Then, the reacted sample is added, and the mixture is run at 100V for 60 minutes. After electrophoresis, the non-denaturing gel and the gel plate are developed using an FLA-9000 instrument.

[0155] Development results showed that GoPGF can directly bind to the JAVL promoter region G-box ( Figure 2 c). Similarly, it was found that JAVL can directly combine with the GoPGF boot sector G-box ( Figure 2 d).

[0156] e: Instantaneous conversion of tobacco and cotton

[0157] The correctly sequenced JAVL (or GoPGF) expression vector plasmid pEAQ, along with its promoter sequence and luciferase (LUC) gene, were fused to generate the JAVLPro-LUC (or GoPGFPro-LUC) reporter gene vector plasmid 0800 (pGreenII0800-LUC), which was then transformed into Agrobacterium GV3101-p19. Agrobacterium was cultured overnight at 28°C. After centrifugation at 5,000g for 10 min at room temperature, the plasmid was resuspended in resuspending buffer (10 mM MES, 10 mM MgCl2, 150 μM acetosyringone, pH 5.8). OD 600 Adjust the value to around 0.6 and incubate at room temperature for 2-3 hours to activate the bacteria. Mix Agrobacterium resuspension with expression vector and Agrobacterium resuspension with promoter vector plasmid at a ratio of 3:1, and inject into tobacco true leaves or cotton cotyledons using a 1 mL syringe for transfection. Perform subsequent analysis after 2-3 days.

[0158] f: Dual-LUC analysis

[0159] Use a punch to remove the injection site from tobacco leaves or cotton cotyledons and place it in a 2 mL centrifuge tube. Grind the powder thoroughly using a grinder. Add 200 μL of lysis buffer to the powder, vortex thoroughly, and then centrifuge at 12,000 rpm for 1 min at 4 °C. Take a 1.5 mL centrifuge tube, add 40 μL of LARII, and then add 8 μL of the supernatant from the previous step. Mix well and measure LUC enzyme activity using a Promega GloMax 20 / 20 luminescence detector. Add 40 μL of Stop&Glo reagent, mix well, and measure REN enzyme activity. Calculate the ratio of LUC enzyme activity to REN enzyme activity, where the LUC value of the empty vector is defined as a unit of 1.

[0160] Dual-LUC experimental results showed that, compared with the control group, GoPGF activation of JAVLPro-LUC expression led to a significant increase in LUC signaling of approximately 6-fold. Figure 2 e) indicates that GoPGF can activate JAVL expression by directly binding to the G-box motif in the JAVL promoter. The results also suggest that JAVL directly binds to the GoPGF promoter, thereby inhibiting its transcriptional activity. Figure 2 f).

[0161] These results indicate that GoPGF and JAVL can mutually regulate each other, forming a negative feedback loop that regulates pigment gland development. In JAVL-VIGS treatment, the expression ratio of GoPGF to JAVL (G / J) was significantly increased, while in GoPGF-VIGS plants, the G / J was significantly decreased. Figure 2 (g) These results suggest that a decrease in G / J below a certain threshold leads to a reduction in gland size or even complete disappearance. Conversely, an increase in G / J promotes the enlargement of pigment glands, indicating that G / J plays a crucial role in the regulation of pigment gland size.

[0162] Example 4: JAVL and GoPGF form a negative feedback loop to regulate the biosynthesis of jasmonic acid.

[0163] a: LC-MS detection of jasmonic acid content in leaves of JAVL-VIGS plants

[0164] Plant leaves treated with JAVL-VIGS were ground into powder in liquid nitrogen and dispensed into tubes containing approximately 100 mg. The powder was extracted twice with 500 μL of ethyl acetate, each extraction being sonicated for 15 min. The powder was then dried using a vacuum concentrator (Eppendorf, Hamburg, Germany) and reconstituted with 30% methanol. Jasmonic acid was quantitatively analyzed using an Agilent 6475 triple quadrupole LC / MS system. The chromatographic column used was an XSelect HSS T3 (3.0 × 100 mm, 2.5 μm), with gradient elution: 90–90% A, 0–2.0 min; 90–10% A, 2.0–9.0 min; 10–1% A, 9.0–11.0 min; 1–90% A, 11.0–11.1 min; 90–90% A, 11.1–13.0 min. The flow rate was 0.3 mL / min. The solvent system consisted of solvent A (2 mM ammonium formate in 0.01% formic acid solution) and solvent B (acetonitrile). The analysis was performed in negative ion mode with electrospray ionization (ESI) and the mass spectrometer set to multiple reaction monitoring (MRM) mode. Jasmonic acid (JA) and jasmonic acid isoleucine (JA-Ile) were identified under JA (m / z, 209.1 / 59.1) and JA-Ile (m / z, 322.2 / 130.1) conditions using breaking voltage (JA, 112V; JA-Ile, 159V), collision energy (JA, 13V; JA-Ile, 25V), and battery accelerating voltage (JA, 4V; JA-Ile, 4V). The relative contents of jasmonic acid (JA) and jasmonic acid isoleucine (JA-Ile) were determined based on peak area.

[0165] Testing revealed a significant increase in the levels of jasmonic acid (JA) and jasmonic acid isoleucine (JA-Ile) in JAVL-VIGS plants. Figure 2 (hi). Note that JAVL can regulate the biosynthesis of cotton jasmonic acid.

[0166] b: qPCR detection of gene expression levels in the jasmonic acid biosynthesis pathway in the leaves of JAVL-VIGS plants

[0167] 100 mg of JAVL-VIGS cotton leaves were rapidly ground into powder in liquid nitrogen. Total RNA was extracted from the leaves using the RNAprep Pure Polysaccharide-Polyphenol Plant Total RNA Extraction Kit (TIANFEN, DP441). 1 μg of the extracted RNA was reverse transcribed into cDNA for use as a qPCR template. The qPCR reaction mixture consisted of 1 μL cDNA, 1 μL forward primer, 1 μL reverse primer, 10 μL SYBR, and 7 μL ddH2O. GhHIS3 (Gh_D03G0370) from upland cotton was used as an internal standard. Gene expression levels were measured using ΔΔC. tThe expression levels of JAVL in cotton leaves injected with the TRV2 empty vector were calculated, with 1 representing the expression level of JAVL. The expression levels of jasmonic acid biosynthesis genes, including lipoxygenase (LOX3), allylene oxide synthase (AOS), allylene oxide cyclase (AOC4), and jasmonic acid isoleucine synthase (JAR1), were significantly upregulated in JAVL-VIGS plants. Figure 2 j).

[0168] c: JAVL regulates the transcription of the jasmine biosynthesis gene (AOS).

[0169] Given the crucial role of AOS in the biosynthesis and induction of jasmonic acid in cotton, the effect of JAVL on AOS was further investigated. Following similar EMSA experiments, the results showed that JAVL can specifically bind to the G-box motif of the AOS promoter (…). Figure 2 (k). Of course, the possibility that JAVL may also bind to the promoters of other jasmonic acid biosynthesis genes cannot be ruled out. Existing literature has confirmed that MYC2 and jasmonic acid biosynthesis genes (LOX and AOS, etc.) can form a positive feedback loop (Zhu et al. 2023; Zhai et al. 2013; Du et al. 2017). The inventors' research revealed that GoPGF has a similar function. EMSA results confirmed that the MYC2-like transcription factor GoPGF can directly bind to the G-box motif within the cotton AOS promoter (k). Figure 2 Furthermore, Dual-LUC analysis showed that GoPGF significantly promoted AOSPro-LUC expression compared to the control group, while JAVL significantly inhibited AOSPro-LUC expression. Moreover, when JAVL and GoPGF were co-expressed, AOSPro-LUC expression was comparable to that of the control group. Figure 2 l).

[0170] These results indicate that JAVL can directly inhibit the expression of jasmonic acid biosynthesis genes and can negatively regulate jasmonic acid levels in cotton by interacting with GoPGF to weaken the activation effect of GoPGF on jasmonic acid biosynthesis genes.

[0171] Example 5: JAVL-regulated biosynthesis of terpenoid phytoalexins such as gossypol

[0172] a: JAVL-VIGS plants showed upregulated expression of genes involved in the biosynthesis of terpenoids such as gossypol in their leaves.

[0173] The inventors performed RNA-Seq sequencing on TRV:JAVL plants and control TTRV:00 plants. Total RNA was extracted from TRV:JAVL and TRV:00 plants using the RNAprep PurePlant Plus Kit (DP441, TIANGEN). RNA quality was assessed using NanoDrop 2000, and RNA integrity was evaluated using Agilent Bioanalyzer 2100. After mRNA purification, cDNA synthesis, library construction, and quality assessment were performed, followed by sequencing on the Illumina NovaSeq platform. Data was processed using the BMKCloud (www.biocloud.net) online platform. The genome was aligned using Hisat2, transcripts were identified using the StringTiereference Annotation Based Transcript (RABT) assembly method, and differential expression analysis was performed using DESeq2 to screen for differentially expressed genes with adjusted p-values ​​<0.01 and Fold Change ≥2. The results showed that in JAVL-VIGS plants, the expression of genes related to gossypol biosynthesis, such as CDN, CYP706B1, and DH1, as well as genes encoding the secreted guide proteins GhDIR5 and GhDIR6, and terpene synthase (TPS) expression were significantly upregulated. In particular, the expression of genes from the TPS-a (sesquiterpene synthase), TPS-b (monoterpene synthase), and TPS-f subfamily (which have dual activity in monoterpene and sesquiterpene synthesis) was significantly upregulated. These findings provide a theoretical basis for breeding new cotton varieties with high efficiency and resistance to diseases and pests. Figure 3 a).

[0174] b: HPLC detection of gossypol and sesquiterpene aldehyde content in JAVL-VIGS plant leaves

[0175] Plant materials were ground into powder in liquid nitrogen. 1 mL of extraction solution (acetonitrile:water:phosphoric acid = 80:20:0.1) was added to every 100 mg of powder. The mixture was vortexed for 2 min, sonicated for 15 min, and centrifuged at 12000 rpm for 5 min. The supernatant was filtered through a 0.22 μm PTFE filter. High-performance liquid chromatography (HPLC) was used to quantitatively analyze the gossypol isomers in the samples using an Agilent C18 column (150 × 4.6 mm, 5 μm). The mobile phase composition was ethanol:methanol:isopropanol:acetonitrile:water:ethyl acetate:DMF:phosphoric acid = 16.7:4.6:12.1:20.2:37.4:3.8:5.1:0.1, the flow rate was 1 mL / min, the column temperature was 40℃, the UV detection wavelength was 272 nm, and the detection time was 60 min. HPLC analysis revealed that in the VIGS-inhibited JAVL expression lines, the contents of major cotton phytoprotective agents such as gossypol, hemigossypolone, and noctuidin (including 1-4) were significantly increased. Figure 3 bc), which indicates that JAVL can regulate the biosynthesis of sesquiterpene aldehydes such as gossypol in cotton.

[0176] c: GC-MS was used to detect the content of volatile monoterpenes and sesquiterpenes in the leaves of JAVL-VIGS plants.

[0177] Plant materials were ground into powder in liquid nitrogen. 1 mL of n-hexane was added to every 100 mg of powder, followed by vortexing, sonication, and centrifugation. The content of volatile monoterpenes and sesquiterpenes in the samples was detected using an Agilent gas chromatograph-mass spectrometer (GC-MS) detector 6890 / 5973. The detection method was set as follows: initial temperature 50℃ (hold for 5 minutes), increased to 180℃ at 10℃ / min, increased to 240℃ at 20℃ / min, and then increased to 280℃ at 30℃ / min (hold for 5 minutes). High-purity helium was used as the carrier gas at a flow rate of 1 mL / min. Split injection (split ratio 5:2) was used. Mass spectrometry was performed using an EI source, scanning data in the range of 30-600 m / z. The results showed that JAVL significantly reduced the content of volatile monoterpenes and sesquiterpenes (α-pinene, β-pinene, β-myrcene, D-limonene, trans-β-ocimene, β-caryophyllene, α-humulene, Guaia-1(10), 11-diene, β-bisabolene, β-caryophyllene) in the leaves of the plant. Figure 3 The results indicate that JAVL, in addition to regulating the biosynthesis of terpenoid phytoalexins such as gossypol in cotton, also affects the accumulation of volatile monoterpenes and sesquiterpenes.

[0178] Example 6: JAVL-VIGS plants showed significantly enhanced resistance to diseases and pests.

[0179] Third-instar larvae of the cotton bollworm (Helicoverpa armigera, Keyun Biology) were used as experimental material and reared at 25°C, 14 hours of light / 10 hours of darkness, and 70% relative humidity. Each group consisted of 20 larvae, fed with freshly collected leaves from JAVL-VIGS plants and control plants, respectively. Individual larvae were placed individually in containers and transferred to fresh plants daily, with excess parts removed. Weights were recorded after 3 days of rearing. Compared to the control, the growth of cotton bollworms fed with JAVL-VIGS plant leaves was inhibited. Figure 3 f), which shows that JAVL-VIGS plants have a strong resistance to bollworm.

[0180] Referring to previously reported methods (Gao, Wei et al., 2016. 'Suppression of the homeoboxgene HDTF1 enhancements resistance to Verticillium dahliae and Botrytis cinerea incotton', 58:503-13), the inventors first cultured spores of Botrytis cinerea B05.10 on potato dextrose agar (PDB) for 3 days, and then... 2 The fungal patches were transferred to new PDB medium and cultured for 5 days. Then, detached leaves from JAVL-VIGS and control plants were infected with *Botrytis cinerea*. After infection, ImageJ software was used to measure the size of the lesion area and extract DNA. The biomass of *Botrytis cinerea* in the cotton was determined by q-PCR detection of the *B. cinerea* actin gene BcActin (BCIN_16g02020) relative to the cotton ubiquitin gene GhUB7 (Gh_A11G0969). Compared with the control plants, JAVL-VIGS plants showed enhanced resistance to gray mold, reduced lesion area, and decreased pathogen biomass. Figure 3 These results indicate that JAVL can regulate cotton's resistance to diseases and pests by modulating cotton gland size and the content of defensive compounds.

[0181] The embodiments described above are merely illustrative of several implementations of the present invention, and while the descriptions are relatively specific and detailed, they should not be construed as limiting the scope of the present invention. It should be noted that those skilled in the art can make various modifications and improvements without departing from the concept of the present invention, and these all fall within the scope of protection of the present invention. Therefore, the scope of protection of this patent should be determined by the appended claims. Furthermore, all documents mentioned in this invention are incorporated herein by reference as if each document were individually incorporated by reference.

Claims

1. A method for regulating pigment gland levels, phytoalexin levels, jasmonic acid levels, or disease and pest resistance in cotton plants, comprising: Downregulating JAVL in cotton plants increases pigment gland size, improves phytoalexin and jasmine levels, and enhances disease and pest resistance.

2. The method as described in claim 1, characterized in that, Downregulating the expression or activity of JAVL in Gossypium species, thereby: Increase the expression of gossypol biosynthesis genes to improve phytoalexin levels; the phytoalexins include: sesquiterpene aldehydes, volatile monoterpenes, sesquiterpenes, preferably including: gossypol, hemigossypolone, noctuidin, α-pinene, β-pinene, β-myrcene, D-limonene, trans-β-ocimene, β-caryophyllene, α-humulene, Guaia-1(10), 11-diene, β-bisabolene, β-caryophyllene; the gossypol biosynthesis genes include: CDN, CYP706B1, DH1, GhDIR5, GhDIR6, TPS; and / or Increase the expression of jasmonic acid biosynthesis genes to increase jasmonic acid levels; said jasmonic acid biosynthesis genes include: lipoxygenase, allene oxide synthase, allene oxide cyclase, and jasmonic acid isoleucine synthase; and / or The aforementioned resistance to pests and diseases includes resistance to insects and resistance to fungi.

3. The method as described in claim 1, characterized in that, The JAVL directly binds to the AOS promoter, inhibiting its transcription, and interacts with GoPGF, inhibiting GoPGF's activation of AOS; the downregulation of JAVL prevents the binding or interaction; or, JAVL interacts with GoPGF to form a negative feedback loop, where GoPGF activates the transcription of JAVL and JAVL inhibits the transcription of GoPGF. Preferably, the method includes: increasing the expression ratio of GoPGF to JAVL in plants, thereby increasing pigment glands, increasing phytoalexin and jasmonic acid levels, and improving disease and pest resistance.

4. The method according to any one of claims 1-3, characterized in that, The downregulation of JAVL includes: downregulating the expression or activity of JAVL; preferably, it includes: performing gene silencing or gene knockout on the JAVL.

5. The method as described in claim 4, characterized in that, The gene silencing method implemented by interfering with JAVL includes: using VIGS molecules, dsRNA, antisense nucleic acids, small interfering RNA, microRNA, or constructs that can express or form said VIGS molecules, dsRNA, antisense nucleic acids, small interfering RNA, or microRNA as targets for repression or silencing of the JAVL-encoding gene or its transcripts to implement the gene silencing; preferably, the construct forming the VIGS molecule includes: the nucleotide sequence shown in positions 138-571 of SEQ ID NO:1 or positions 84-517 of SEQ ID NO:3; or The gene knockout was carried out using gene editing methods and homologous recombination methods.

6. An application of JAVL or a downregulator thereof for: increasing pigment glands, improving phytoalexin and jasmonic acid levels, and enhancing disease and pest resistance; preparing preparations for increasing pigment glands, improving phytoalexin and jasmonic acid levels, and enhancing disease and pest resistance; or, as a molecular marker for identifying pigment gland development, phytoalexin levels, jasmonic acid levels, or insect resistance in cotton plants.

7. The application as described in claim 6, characterized in that, The downregulator includes: a downregulator that knocks out or silences the JAVL gene or inhibits the activity of the JAVL protein; preferably, it includes: an interfering molecule that specifically interferes with the expression of the JAVL gene, a gene editing reagent that knocks out the JAVL gene, or a reagent that knocks out the JAVL gene based on homologous recombination. Preferably, the interfering molecule is a VIGS molecule, dsRNA, antisense nucleic acid, small interfering RNA, or microRNA that targets the encoding gene of JAVL or its transcript for suppression or silencing, or a construct that can express or form the VIGS molecule, dsRNA, antisense nucleic acid, small interfering RNA, or microRNA; preferably, the construct that forms the VIGS molecule includes the nucleotide sequence shown in positions 138-571 of SEQ ID NO:1 or positions 84-517 of SEQ ID NO:

3.

8. A Gossypium cell, tissue, or organ, wherein the Gossypium is a Gossypium expressing JAVL, and contains an exogenous JAVL downregulator, said downregulator comprising: Knockout or silencing of the JAVL gene or downregulators that inhibit JAVL protein activity; Preferably, the method includes: an interfering molecule that specifically interferes with the expression of the JAVL gene, a gene editing reagent for knocking out the JAVL gene, and a reagent for knocking out the JAVL gene based on homologous recombination; preferably, the interfering molecule is a VIGS molecule, dsRNA, antisense nucleic acid, small interfering RNA, or microRNA that targets the encoding gene of JAVL or its transcript for inhibition or silencing, or a construct that can express or form the VIGS molecule, dsRNA, antisense nucleic acid, small interfering RNA, or microRNA; preferably, the construct that forms the VIGS molecule includes: the nucleotide sequence shown in positions 138-571 of SEQ ID NO:1 or positions 84-517 of SEQ ID NO:

3.

9. A method for identifying pigment gland development, phytoalexin levels, jasmonic acid levels, or insect resistance in plants of the genus *Gossypium*, the method comprising: The assay identifies the expression or activity of JAVL in Gossypium species. If the expression or activity of JAVL in the tested Gossypium species is low, it indicates that the plant has large pigment glands, high levels of phytoalexins, high levels of jasmonic acid, or insect resistance. Preferably, the assay also includes analyzing the expression ratio of GoPGF to JAVL in the plant. If this ratio is higher than the average expression ratio of the Gossypium species, it indicates that the plant has large pigment glands, high levels of phytoalexins, high levels of jasmonic acid, or insect resistance.

10. A method for screening potential substances that increase pigment gland size, improve phytoalexin and jasmonic acid levels, and enhance disease and pest resistance, comprising: (1) Treat an expression system that expresses JAVL with candidate substances; and (2) Detect the expression or activity of JAVL in the system; if the candidate substance statistically reduces the expression or activity of JAVL, it indicates that the candidate substance is a potential substance for increasing pigment glands, increasing the levels of phytoalexin and jasmine, and improving disease and pest resistance.

11. The method as described in claim 10, characterized in that, The system also expresses GoPGF, and the method further includes: Analyzing the expression ratio of GoPGF to JAVL, if the candidate substance can significantly increase this ratio, it indicates that the candidate substance is a potential substance for increasing pigment gland size, improving phytoalexin and jasmonic acid levels, and enhancing disease and pest resistance; or Analyzing the interaction between GoPGF and JAVL, if the candidate substance prevents JAVL from binding to the G-box of the GoPGF promoter, or prevents GoPGF from binding to the G-box of the JAVL promoter, it indicates that the candidate substance is a potential substance for increasing pigment glands, improving phytoalexin and jasmonic acid levels, and enhancing disease and pest resistance.

Images