Application of KNG1 inhibitor in preparation of preparation for promoting synthesis of skin collagen and elastin

By using KNG1 inhibitors, particularly shRNA, to inhibit KNG1 expression and promote the synthesis of skin collagen and elastin, the problem of the lack of effective regulation of skin collagen and elastin synthesis in existing technologies has been solved, thus improving skin elasticity.

CN120960433AActive Publication Date: 2025-11-18SOUTHERN MEDICAL UNIVERSITY
View PDF 4 Cites 0 Cited by

Patent Information

Application Number
CN202511182250.6
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-08-22
Publication Date
2025-11-18
Estimated Expiration
2045-08-22

AI Technical Summary

Technical Problem

No regulatory effects of KNG1 on skin collagen and elastin have been reported in the prior art, and there is a lack of effective methods to promote their synthesis.

Method used

KNG1 inhibitors, particularly shRNA, are delivered to the skin via lentiviral vectors to inhibit KNG1 expression and promote collagen and elastin synthesis. The specific steps include designing shRNA sequences, vector construction, viral packaging, and infection.

Benefits of technology

It significantly enhances the synthesis of collagen and elastin in the skin, improves skin elasticity, and has biomedical and cosmetic application value.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120960433A_ABST
    Figure CN120960433A_ABST
Patent Text Reader

Abstract

The invention belongs to the technical field of biomedicine and cosmetics, and discloses application of a KNG1 inhibitor in preparation of a preparation for promoting synthesis of skin collagen and elastin. It is found for the first time that inhibition of KNG1 expression promotes synthesis of skin collagen and elastin. The KNG1 inhibitor is locally applied to the skin, has the function of improving collagen and elastin of the skin, and has high application value in the fields of biomedicine and cosmetics.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the fields of biomedicine and cosmetics technology, and specifically relates to the application of KNG1 inhibitors in the preparation of formulations that promote the synthesis of skin collagen and elastin. Background Technology

[0002] The skin is the body's main protective barrier, primarily composed of the epidermis and dermis. The dermis is made up of connective tissue, mainly composed of fibroblasts and the extracellular matrix (ECM). Fibroblasts can synthesize and secrete ECM-related proteins, which are core elements in maintaining skin homeostasis and regulating aging. The ECM in the skin is highly developed, possessing both mechanical strength and flexibility, and its tissue specificity is mainly attributed to specific components. Collagen fibers are the main component of the ECM, accounting for 75% of the skin's dry weight, and provide tensile strength and elasticity (Shin JW, et al. Molecular Mechanisms of Dermal Aging and Antiaging Approaches. Int J Mol Sci. 2019 Apr 29; 20(9):2126.). Collagen fibers are assembled from the polymerization of collagen. More than 20 subtypes of collagen are known to exist in the skin. Among them, type I collagen accounts for about 70-90% of the total collagen in human skin, and type III collagen accounts for 10-21% (Smith LT, et al. Collagen types I, III, and V in human embryonic and fetal skin[J]. Developmental Dynamics, 2010, 175(4):507-521.). Elastic fibers are another important component of ECM, accounting for 2%-4% of dermal ECM. Elastic fibers enable the skin to return to its normal state after being stretched or deformed (Heinz A. Elastic fibers during aging and disease[J]. Ageing Research Reviews, 2021, 66:101-255.). The main component of elastic fibers is elastin (ELN). Elastin has a half-life of over 70 years and can stretch up to eight times its original length, making it a key factor in determining skin elasticity and resilience (Wen Q, et al. Elastin Biomaterials in Dermal Repair. Trends Biotechnol. 2020 Mar; 38(3):280-291.).

[0003] Kininogen-1 (KNG1) protein is encoded by the Kng1 gene. The Kng1 gene is located on human chromosome 3, with a full-length sequence of 27 kb, consisting of 11 exons and 10 introns (Cui Jiabo, You Chongge. Research progress on KNG1 structure and its role in diseases. Chinese Journal of Cell Biology, 2023, 45(3):533-542). Human KNG1 is a glycoprotein composed of 626 amino acids with a molecular weight of 70-120 kDa. Studies have shown that KNG1 plays a pro-inflammatory and pro-oxidative role in inflammatory diseases such as pulmonary sepsis, colitis, and arthritis (Xu J, et al. Overexpression of the Kininogen-1 inhibits proliferation and induces apoptosis of glioma cells. J Exp Clin Cancer Res. 2018 Aug 2; 37(1):180.). However, the regulatory effects of KNG1 on skin collagen and elastin have not yet been reported. Summary of the Invention

[0004] The purpose of this invention is to overcome the shortcomings and deficiencies of the prior art and to provide the application of KNG1 inhibitors in the preparation of formulations that promote the synthesis of collagen and elastin in the skin.

[0005] The objective of this invention is achieved through the following technical solution: the application of KNG1 inhibitors in the preparation of agents that promote the synthesis of skin collagen and elastin is the technical solution obtained by this invention after discovering that inhibiting KNG1 expression can promote the synthesis of skin collagen and elastin.

[0006] The KNG1 inhibitor is a substance that inhibits KNG1 expression or KNG1 activity, preferably siRNA, shRNA or KNG1 antibody; more preferably shRNA.

[0007] The preferred sequence of the double-stranded DNA of the shRNA is as follows:

[0008] Chain of Justice 1: 5′-ccggCAAGCATTAGATATGACTGAACTCGAGTTCAGTCATATCTAATGCTTGTTTTTT-3′;

[0009] Antonym chain 1: 5′-gaattcaaaaaaCAAGCATTAGATATGACTGAACTCGAGTTCAGTCATATCTAATGCTTG-3′.

[0010] The preferred preparation for promoting the synthesis of skin collagen and elastin is a recombinant expression vector containing double-stranded DNA of the aforementioned shRNA.

[0011] The backbone of the recombinant expression vector is preferably a lentiviral vector.

[0012] The preferred lentiviral vector is pCLenti-U6-shRNA-CMV-EGFP-WPRE.

[0013] The recombinant expression vector is preferably pCLenti-U6-shRNA(Kng1)-CMV-EGFP-WPRE; it is obtained by cloning the double-stranded DNA of the above shRNA into pCLenti-U6-shRNA-CMV-EGFP-WPRE through AgeⅠ and EcoRI sites.

[0014] The present invention has the following advantages and effects compared with the prior art:

[0015] This invention is the first to discover that inhibiting KNG1 expression promotes the synthesis of collagen and elastin in the skin. Topical application of KNG1 inhibitors to the skin enhances the production of collagen and elastin, thereby improving skin elasticity, and has significant application value in the biomedical and cosmetic fields. Attached Figure Description

[0016] Figure 1 This is a schematic diagram of the structure of the pCLenti-U6-shRNA(Kng1)-CMV-EGFP-WPRE lentiviral vector.

[0017] Figure 2 Western blotting results showing the reduction of KNG1 expression levels in mouse skin by interfering with the KNG1 vector.

[0018] Figure 3 The results of increasing collagen fiber density in mouse skin after interfering with KNG1 lentiviral vector infection are shown in the figure; where A is a stained photograph and B is the analysis result; ** indicates P < 0.01.

[0019] Figure 4 Figure 1 shows the results of increasing the density of elastic fibers in mouse skin after infection with the KNG1 lentiviral vector; where A is a stained photograph and B is the analysis result; *** indicates P < 0.001.

[0020] Figure 5 Figure 1 shows the results of increasing elastin in mouse skin after infection with the KNG1 lentiviral vector; where A is a stained photograph and B is the analysis result; *** indicates P < 0.001. Detailed Implementation

[0021] The present invention will be further described in detail below with reference to the embodiments and accompanying drawings, but the embodiments of the present invention are not limited thereto.

[0022] Example 1

[0023] shRNA targets were designed based on the mouse KNG1 gene transcript, and primers were synthesized. Single-stranded primers were annealed to double-stranded oligo sequences and ligated into a double-digested linearized RNA interference vector, replacing the original ccdB toxic gene. Transformants were screened by colony PCR, and positive clones were sequenced for verification. After sequencing verification, high-purity plasmids were extracted. The vector construction experiment consisted of the following main steps:

[0024] 1. Interference target design and primer synthesis:

[0025] The Mouse KNG1 gene sequence (NM_001102411.1) was retrieved from GenBank. Based on the gene sequence (as shown below), an effective target was designed, with the target sequence being CAAGCATTAGATATGACTGAA.

[0026] Mouse KNG1 gene:

[0027] ATAATTTGACTGTAACACAAAGATATTAGTACAAAATACGTGACGTAGAAAGTAATAA

[0028] TTTCTTGGGTAGTTTGCAGTTTTAAAATTATGTTTTAAAATGGACTATCATATGCTTACC

[0029] GTAACTTGAAAGTATTTCGATTTCTTGGCTTTATATATCTTGTGGAAAGGACGAAACAC

[0030] CGGCAAGCATTAGATATGACTGAACTCGAGTTCAGTCATATCTAATGCTTGTTTTTTGA

[0031] ATTCGGATCATTAGGCGGCCGCGTGGATAACCGTATTACCGCCATGCATTAGTTATTA

[0032] ATAGTAATCAATTACGGGGTCATTAGTTCATAGCCCATATATGGAGTTCCGCGTTACAT

[0033] AACTTACGGTAAATGGCCCGCCTGGCTGACCGCCCAACGACCCCCGCCCATTGACGTC

[0034] AATAATGACGTATGTTCCCATAGTAACGCCAATAGGGACTTTCCATTGACGTCAATGG

[0035] GTGGAGTATTTACGGTAAACTGCCCACTTGGCAGTACATCAAGTGTATCATATGCCAA

[0036] GTACGCCCCCTATTGACGTCAATGACGGTAAATGGCCCGCCTGGCATTATGCCCAGTAC

[0037] ATGACCTTATGGGACTTTCCTACTTGGCAGTACATCTACGTATTAGTCATCGCTATTAC

[0038] CATGGTGATGCGGTTTTGGCAGTACATCAATGGGCGTGGATAGCGGTTTGACTCACGG

[0039] GGATTTCCAAGTCTCCACCCCATTGACGTCAATGGGAGTTTGTTTTGGCACCAAAATC

[0040] ACGGGACTTTCCAAAATGTCGTAACAACTCCGCCCCATTGACGCAAATGGGCGGTAGG

[0041] CGTGTACGGTGGGAGGTCTATATAAGCAGAGCTGGTTTAGTGAACCGTCAGATCCGCT

[0042] AGCGCTACCGGACGCCACCATGGTGAGCAAGGGCGAGGAGCTGTTCACCGGGTGTGCCCATCCTGTCGAGCTG。

[0043] Subsequently, a specific short hairpin RNA (shRNA) was designed and synthesized, consisting of a sense strand and an antisense strand. The uppercase letters (e.g., A, T, C, G) in the sequence represent the core functional sequence of the shRNA targeting the target gene. This portion is a specific sequence complementary to the target gene mRNA and is a key functional region for achieving RNA interference (RNAi). The lowercase letters (e.g., c, g, a, t) represent the helper sequences required for vector ligation, primarily used to provide restriction endonuclease recognition sites to achieve efficient cloning and ligation of the shRNA sequence with the vector, while also helping to maintain the stability of the shRNA stem-loop structure. The DNA form of this shRNA is shown below:

[0044] Chain of Justice 1: 5′-ccggCAAGCATTAGATATGACTGAACTCGAGTTCAGTCATATCTAATGCTTGTTTTTT-3′;

[0045] Antonym chain 1: 5′-gaattcaaaaaaCAAGCATTAGATATGACTGAACTCGAGTTCAGTCATATCTAATGCTTG-3′.

[0046] 2. Primer annealing forms double-stranded fragments with sticky ends:

[0047] The synthesized sense and antisense strands 1 were dissolved separately in commercially available oligo annealing buffer to a concentration of 20 μM, and 30 μL of each were mixed. The resulting oligonucleotide mixture was then heated in a water bath at 95 °C for 5 min, and then allowed to cool naturally to room temperature with the lid off to form a double-stranded oligo fragment, which was the target interfering fragment. 1 μL was used for subsequent ligation reactions, and the remainder was stored at -20 °C.

[0048] 3. Preparation of linearized expression vectors:

[0049] The expression vector pCLenti-U6-shRNA-CMV-EGFP-WPRE (vector number GL404, purchased from Heyuan Biotechnology (Shanghai) Co., Ltd.) was digested with restriction endonucleases. The total volume of the digestion reaction system was 50 μL, containing: 2 μL of plasmid pCLenti-U6-shRNA-CMV-EGFP-WPRE, 5 μL of 10×rCutsmart reaction buffer, 1 μL each of restriction endonucleases AgeⅠ and EcoRI, with the remaining volume made up with deionized water. The above reaction system was incubated in a water bath at 37℃ for at least 2 hours to complete the digestion reaction. The digestion product was analyzed by agarose gel electrophoresis to detect the digestion effect. The target vector band was excised from the agarose gel after electrophoresis and recovered using the TaKaRa MiniBEST Agarose Gel DNA Extraction Kit Ver.3.0.

[0050] 4. Incorporation of the interference fragment into the expression vector:

[0051] In the ligation reaction system shown in Table 1, the ligation group is a reaction system centered on the linearized expression vector pCLenti-U6-shRNA-CMV-EGFP-WPRE and the target interference fragment, used to obtain a recombinant vector carrying the interference fragment. The positive control uses the linearized vector pCLenti-U6-shRNA-CMV-Puro-WPRE (vector number GL401, purchased from Heyuan Biotechnology) double-digested with AgeⅠ and EcoRI, ligated with the control fragment to verify the activity of the ligation reagent and the effectiveness of the operation. The control fragment was prepared according to step 2, and its sequence is shown below as the sense strand 2 and antisense strand 2. The self-ligation control contains only the linearized vector pCLenti-U6-shRNA-CMV-Puro-WPRE (without the interference fragment), used to detect the vector's own ligation efficiency and exclude non-specific ligation interference. All three components work together to ensure the reliability of the experimental system and the accuracy of the results. The annealed double-stranded oligo used in the positive control is a validated fragment, the same length as the annealed double-stranded oligo used in the ligation group, but unrelated to the target sequence.

[0052] Sense strand 2: 5′-ccggTTCTCCGAACGTGTCACGTTTCAAGAGAACGTGACACGTTCGGAGAATTTTTTg-3′;

[0053] Antonym chain 2: 5′-aattcaaaaaaaTTCTCCGAACGTGTCACGTTCTCTTGAAACGTGACACGTTCGGAGAA-3′.

[0054] Table 1 Connection Reaction System

[0055] reagents Positive control (μL) Self-ligation control (μL) Connecting group (μL) Annealed double-stranded oligo (10 mM) 1 - 1 Linearized interfering vector (40 ng / μL) 3 3 3 10×T4 DNAligase Buffer 2 2 2 T4 DNA ligase 1 1 1 <![CDATA[dd H2O]]> Supplement to 20 Supplement to 20 Supplement to 20

[0056] 5. Transformation of competent cells:

[0057] The ligation product was transferred into E. coli DH5α competent cells according to the method of Molecular Cloning.

[0058] 6. Colony PCR identification of positive transformants:

[0059] Transformants grown on the plate were picked and resuspended in 10 μL of ILB medium. 1 μL was used as a template for colony PCR identification. The primer sequences used for PCR identification are as follows:

[0060] Upstream primer 1: 5'-CAAGCATTAGATATGACTGAAC-3';

[0061] Downstream primer 1: 5'-GTTCAGTCATATCTAATGCTTG-3'.

[0062] 7. Positive clones are sent for sequencing:

[0063] Positive clones obtained from colony identification were sent to a sequencing company for sequencing verification. The sequencing results were compared using Vector NTI software, and analysis confirmed the acquisition of the correct clone, named the pCLenti-U6-shRNA(Kng1)-CMV-EGFP-WPRE lentiviral vector. Its structural diagram is shown below. Figure 1 As shown.

[0064] 8. Plasmid mini-prep:

[0065] Positive clones that have been verified by sequencing are then subjected to plasmid extraction.

[0066] 9. Lentiviral packaging consists of the following four main steps:

[0067] (1) Cell seeding:

[0068] Before transfection, human embryonic kidney 293T cells were seeded into culture dishes with a diameter of 100 mm, and transfection was performed when the cell density reached 70%-80%.

[0069] (2) Transfection:

[0070] One hour before transfection, discard the original cell culture medium and add 10 mL of Opti-MEM medium, then return the cells to the incubator. Dissolve 8 μg of the backbone plasmid PSPAX2 (purchased from Heyuan Biotechnology), 8 μg of the packaging plasmid pMD2G (purchased from Heyuan Biotechnology), and 16 μg of the shuttle plasmid pCLenti-U6-shRNA(Kng1)-CMV-EGFP-WPRE in Opti-MEM medium to prepare a 500 μL solution. Gently mix and let stand for 5 minutes to obtain the plasmid dilution. Dissolve 32 μL of the transfection reagent Lipo 3000 in Opti-MEM medium to prepare a 500 μL solution. Gently mix and let stand for 5 minutes to obtain the transfection reagent dilution. Add the transfection reagent dilution dropwise to the plasmid dilution, gently mixing as you add, and incubate at room temperature for 20 minutes to allow the DNA and transfection reagent to fully bind and form a stable transfection complex. Add the prepared DNA-transfection reagent complex to the cells. After 6-8 hours, aspirate the culture medium, wash once with PBS, and add 10 mL of fresh complete culture medium (i.e., Opti-MEM medium containing 10% FBS) for further culture.

[0071] (3) Collecting poison:

[0072] Forty-eight hours after transfection, the supernatant was collected into a 50 mL centrifuge tube and labeled. This was the first viral supernatant received. At the same time, the cell culture medium was replaced with fresh complete medium. Seventy-two hours after transfection, the culture medium was collected again. This was the second viral supernatant received. The two viral supernatants were combined.

[0073] (4) Virus purification:

[0074] Centrifuge the collected viral supernatant at 3500 rpm for 10 minutes and discard the precipitate. Filter the supernatant through a 0.22 μm filter membrane and set aside. Aliquot the filtered supernatant into ultracentrifuge tubes and centrifuge at 30000 rpm and 4°C for 2 hours. Discard the supernatant and resuspend the white precipitate in 100–200 μL of pre-chilled DULBECCO'S phosphate-buffered saline (DPBS) at 4°C in each tube to obtain the viral suspension. Transfer the viral suspension to 1.5 mL EP tubes and incubate overnight at 4°C. Centrifuge the overnight viral suspension at 6000 rpm for 5 minutes, filter through a 0.22 μm filter membrane, transfer to new EP tubes, aliquot as needed, and store at -80°C for later use.

[0075] 10. Quantitative PCR was used to detect the copy number of lentivirus integrated into the cell genome, which can rigorously and objectively reflect the infectivity and integration capacity of lentivirus. The lentivirus titer was measured in TU / mL. The lentivirus titer determination experiment consisted of the following three main steps:

[0076] (1) Sample preparation:

[0077] The day before infection, 293 T cells were digested at a dose of 1×10⁻⁶. 5 Cells were seeded into 24-well plates. The test samples (i.e., the virus suspension obtained in the previous step) were serially diluted and used for infection. Cells were collected 72 hours after infection, and genomic DNA was extracted for quantitative PCR detection.

[0078] (2) Lentiviral titer determination:

[0079] Lentiviral titer determination was performed on a LightCycler 96Roche quantitative PCR instrument. Quantitative PCR primers were designed targeting specific viral vector elements (WPREs, post-transcriptional regulatory elements), and the primer sequences are as follows:

[0080] Upstream primer 2: 5'-TTACGCTATGTGGATACGC-3';

[0081] Downstream primer 2: 5'-AGAGACAGCAACCAGGAT-3'.

[0082] The reaction system was configured as follows: SYBR Premix EX Taq (TAKARA) 10.0 μL, upstream primer 2 at a concentration of 25 μM 0.5 μL, downstream primer 2 at a concentration of 25 μM 0.5 μL, genomic DNA 5.0 μL, and dd H2O 4.0 μL.

[0083] The Real-Time Quantitative PCR program was set up using a two-step method, with absorbance readings taken during the extension phase. The Real-Time Quantitative PCR program was as follows: 95℃ for 30s; 95℃ for 10s, 60℃ for 30s, for 34 cycles.

[0084] (3) Virus titer calculation:

[0085] The number of lentiviral vector copies integrated into the DNA sample was determined by labeling it with the number of genomes, thus obtaining the number of viral copies integrated per genome. The titer (Transducing Units / mL, TU / mL) was calculated using the following formula: TU / mL = (C × N × 1000) / V.

[0086] Where C represents the average number of copies of a specific viral gene sequence integrated per genome; N represents the total number of cells at infection, 2 × 10⁻⁶. 5 (units); V represents the volume of virus solution added (unit: μL); "×1000" in the formula is a volume unit conversion factor (converting μL to mL).

[0087] Example 2 Immunohistochemistry Detection of the Expression Level of KNG1 in Mouse Skin 7 Days after Injection of the KNG1-Interfering Vector

[0088] Eighteen-month-old C57BL / 6 mice (Laboratory Animal Center of Southern Medical University, SCXK(Yue) 2021-0041) were purchased and fed adaptively for one week. After the adaptation period ended, experimental treatment was carried out.

[0089] To exclude the interference of individual differences, an autologous control design was adopted in this experiment: with the midline of the mouse back as the symmetry reference, treatments were carried out on both sides of the posterior back. Among them, one side was the control group, and an empty vector lentivirus pCLenti-U6-shRNA(NC)-CMV-EGFP-WPRE with a titer of 1×10 8 TU / mL was subcutaneously injected with an insulin needle (vector number GL404NC, purchased from Heyuan Biotech), and the injection volume for each mouse was 20 μL; the other side was the KNG1 interference group pCLenti-U6-shRNA(Kng1)-CMV-EGFP-WPRE, and a KNG1-interfering vector lentivirus with a titer of 1×10 8 TU / mL was also subcutaneously injected with an insulin needle, and the injection volume for each mouse was 20 μL. Multiple mice were set as independent parallel samples in the experiment, and bilateral treatments of the control group and the KNG1 interference group were synchronously carried out on each mouse. Samples were taken on the 7th day. Carefully excise 1 cm of intact skin at the treatment site, divide the obtained skin into two parts, fix one part in 4% paraformaldehyde solution (PFA), and make 5-μm continuous paraffin sections. The other part was used to extract tissue protein, and Western blot was used to detect the content of KNG1 in the tissue protein. The results are as Figure 2 shown. The KNG1-interfering vector lentivirus (shKNG1) can significantly reduce the expression level of KNG1 in the tissue.

[0090] Example 3 Masson Staining to Observe the Morphology of Collagen Fibers in Mice 7 Days after Injection of the KNG1-Interfering Vector

[0091] Masson staining was performed on the paraffin sections. The results of Masson staining can stain collagen fibers bright blue. It can be seen that interfering with KNG1 can promote an increase in collagen synthesis in the dermis of mouse skin, and the collagen arrangement is denser and more orderly (see Figure 3 A in). Image J software was used to calculate the collagen density, and SPSS25 statistical software was used for data analysis. It was found that compared with the control group, the collagen fiber density increased in the KNG1 interference group, and the difference was statistically significant (see Figure 3 B in).

[0092] Example 4 Gomori Staining to Observe the Morphology of Elastic Fibers in Mice 7 Days after Injection of the KNG1-Interfering Vector

[0093] Paraffin sections were stained using an elastic fiber staining kit (modified Gomori aldehyde fuchsin method). The Gomori aldehyde fuchsin method stained elastic fibers from purple to dark purple, indicating that KNG1 interference promoted the thickening and increase of elastic fibers in the dermis of mouse skin (see...). Figure 4 (A) Elastic fiber density was calculated using ImageJ software, and data analysis was performed using SPSS 25 statistical software. Compared with the control group, elastic fiber density increased in the KNG1 interference group, and the difference was statistically significant (see A). Figure 4 (B in the middle).

[0094] Example 5: Immunohistochemical detection showed an increase in elastin levels in mouse skin 7 days after injection of the KNG1 vector.

[0095] Immunohistochemical staining was performed on paraffin sections to detect elastin expression levels. ImageJ software was used to calculate optical density values ​​and analyze the relative expression levels of elastin. SPSS 25 statistical software was used for data analysis. Results are as follows: Figure 5 As shown, compared with the control group, the elastin expression level was significantly increased in the KNG1-interfered group, and the difference was statistically significant.

[0096] The above embodiments are preferred embodiments of the present invention, but the embodiments of the present invention are not limited to the above embodiments. Any changes, modifications, substitutions, combinations, or simplifications made without departing from the spirit and principle of the present invention shall be considered equivalent substitutions and shall be included within the protection scope of the present invention.

Claims

1. Application of KNG1 inhibitors in the preparation of agents that promote the synthesis of skin collagen and elastin.

2. The application of the KNG1 inhibitor according to claim 1 in the preparation of formulations that promote the synthesis of skin collagen and elastin, characterized in that: The KNG1 inhibitor is a substance that inhibits KNG1 expression or KNG1 activity.

3. The application of the KNG1 inhibitor according to claim 2 in the preparation of formulations that promote the synthesis of skin collagen and elastin, characterized in that: The KNG1 inhibitor is siRNA, shRNA, or KNG1 antibody.

4. The application of the KNG1 inhibitor according to claim 3 in the preparation of formulations that promote the synthesis of skin collagen and elastin, characterized in that: In the double-stranded DNA of the shRNA, the sequence of the sense strand 1 is shown in SEQ ID NO.1, and the sequence of the antisense strand 1 is shown in SEQ ID NO.

2.

5. The application of the KNG1 inhibitor according to claim 4 in the preparation of formulations that promote the synthesis of skin collagen and elastin, characterized in that: The preparation for promoting the synthesis of skin collagen and elastin is a recombinant expression vector containing double-stranded DNA of the shRNA described in claim 4.

6. The application of the KNG1 inhibitor according to claim 5 in the preparation of formulations that promote the synthesis of skin collagen and elastin, characterized in that: The backbone of the recombinant expression vector is a lentiviral vector.

7. The use of the KNG1 inhibitor according to claim 6 in the preparation of formulations that promote the synthesis of skin collagen and elastin, characterized in that: The lentiviral vector is pCLenti-U6-shRNA-CMV-EGFP-WPRE.

8. The application of the KNG1 inhibitor according to claim 5 in the preparation of formulations that promote the synthesis of skin collagen and elastin, characterized in that: The recombinant expression vector is pCLenti-U6-shRNA(Kng1)-CMV-EGFP-WPRE, which is obtained by cloning the double-stranded DNA of the shRNA described in claim 4 into pCLenti-U6-shRNA-CMV-EGFP-WPRE through AgeⅠ and EcoRI sites.

Citation Information

Patent Citations

  • Preparation method of biological material capable of activating and repairing functions of skin stem cells

    CN112642002A

  • Application of CASIN in preparation of preparation for promoting synthesis of collagen and elastin

    CN118453434A

  • Cadherin-11 inhibitor formulation and its uses in immunotherapy

    US20230210849A1

  • Biomarkers for inflammatory skin disease

    WO2019191679A1