Composite gene for isolated expression of secreting type nerve growth factor gene and marker type green fluorescent protein gene as well as construction and application of composite gene
By constructing a NGF and NG complex gene under the same promoter regulation, it is ensured that NGF is secreted outside the cell to exert its biological activity, while NG maintains its fluorescence intensity inside the cell. This solves the problem of fluorescence attenuation caused by the secretion of NGF-green fluorescent protein fusion protein in existing technologies, and realizes real gene expression assessment and nerve injury treatment effects.
Patent Information
- Application Number
- CN202511526940.9
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-10-24
- Publication Date
- 2025-11-28
AI Technical Summary
In the existing technology, the secreted NGF-green fluorescent protein fusion protein is secreted outside the cell, resulting in weakened intracellular fluorescence, which cannot truly reflect the NGF expression level and affects the observation and tracking effect.
A composite gene consisting of a Kozak sequence, a secreted NGF gene (β-Ngf), a unique 63-nucleotide linker fragment, and a marker NG gene (Ng) was constructed under the regulation of the same promoter. This ensures that NGF is secreted outside the cell to exert its biological activity, while NG remains inside the cell as a fluorescent marker. The two independent proteins were expressed by transfecting cells with a plasmid vector.
This technology enables NGF to exert its biological activity outside the cell and NG to maintain its fluorescence intensity inside the cell, thus accurately reflecting the gene expression level and enabling its use in the treatment and detection of nerve injuries.
Smart Images

Figure CN121022892A_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of genetic engineering technology, specifically relating to a composite gene for the isolated expression of a secretory nerve growth factor gene and a marker-type green fluorescent protein gene, as well as its construction and application. Background Technology
[0002] Nerve growth factor (NGF) is one of the earliest discovered and most extensively studied members of the neurotrophic factor family. It is a protein crucial for the development of the nervous system. It not only promotes the development and survival of nerve cells, maintains their function, and promotes the growth of nerve cell axons (nerve fibers), but also regulates neural plasticity and participates in the formation and regulation of learning, memory, and higher cognitive functions. Numerous in vitro and in vivo scientific studies have shown that after nerve injury, administration of exogenous NGF can promote nerve cell survival, axonal regeneration, and the recovery of nerve function.
[0003] To evaluate the therapeutic effects of exogenous NGF on neurological diseases, including traumatic brain injury, cerebral ischemia, and neurodegenerative diseases, it is usually necessary to detect the presence and distribution of NGF. However, existing conventional detection methods, including immunological methods based on antigen-antibody reactions and artificially labeled NGF proteins, have many drawbacks, such as difficulty in dosimetric control of labeling methods, poor repeatability, and low efficiency. To address this, the inventors previously invented and constructed a gene for a biologically active green fluorescently labeled NGF fusion protein to facilitate the observation and tracking of NGF. This gene was then used in animals for the treatment of traumatic brain injury, achieving effective therapeutic results (Patent No. ZL 202411711315.7).
[0004] However, ZL202411711315.7 also has some shortcomings. The NGF-green fluorescent protein (NG) fusion gene it constructed expresses a secreted fusion protein. After being generated intracellularly, this fusion protein is continuously secreted extracellularly. Although this is a necessary pathway for NGF to exert its biological activity, and intracellular fluorescence is still present, the continuous secretion of this fluorescently labeled fusion protein extracellularly leads to a decrease in intracellular fluorescence. Therefore, the fluorescence intensity cannot accurately reflect the expression levels of NGF and NG genes, thus affecting the observation and tracking of NGF.
[0005] To further improve the invention, this invention further constructs a composite gene composed of the secretory NGF gene β-Ngf, a 63-nucleotide linker fragment, and the marker NG gene Ng, all under the regulation of the same promoter. The 63-nucleotide linker fragment is crucial in its design. It ensures that, under the same promoter, the NGF and NG genes, after sequential expression, produce two independent proteins, each retaining its respective biological function. This composite gene can express two independent proteins: NGF and NG. The NGF protein is secreted extracellularly to exert its biological activity, while NG remains intracellular, serving as an indicator for monitoring and tracing the true level of gene expression. Summary of the Invention
[0006] To address the shortcomings of existing technologies and practical needs, this invention constructs a composite gene consisting of a Kozak sequence (Kz), a secreted NGF gene (β-Ngf), a unique 63-nucleotide linker (63bp), and an NG gene (Ng) under the regulation of the same promoter. The 63-nucleotide linker is crucial to the design. It ensures that, under the same promoter, β-Ngf and Ng, after sequential expression, produce two independent proteins, each retaining its respective biological function. After direct transfection into cells (various cell types, including 293T cells, PC12 neurons, and mouse hippocampal neurons) using a plasmid vector, this composite gene can express two independent proteins: NGF and NG. Specifically, the secreted NGF gene β-Ngf is expressed intracellularly as NGF, which is secreted extracellularly and exerts biological activities promoting axonal growth in neurons, including therapeutic applications against oxidative damage to neurons. Meanwhile, the NG gene expressed by the NG gene Ng remains intracellular. Since the complex gene is expressed under the regulation of the same promoter and the content of NG in the cell is not disturbed, the fluorescence intensity of NG can reflect the true level of complex gene expression, thus serving as an indicator for assessing the true level of NGF gene Ngf expression.
[0007] This invention provides a composite gene for the isolated expression of a secretory nerve growth factor gene and a marker green fluorescent protein gene, which consists of a Kozak sequence, a secretory β-Ngf, a unique 63-nucleotide linker fragment, and Ng. The nucleotide sequence of the composite gene is shown in SED ID No. 1.
[0008] Secretory β-Ngf is expressed intracellularly as NGF, which is secreted extracellularly to exert biological activities that promote the growth of nerve cell axons and is used in the treatment of oxidative damage to nerve cells. Meanwhile, NG expressed by Ng remains intracellular and serves as a marker for visual detection or tracking. A 63-nucleotide linker is crucial to the design, ensuring that under the regulation of the same promoter, the genes β-Ngf and Ng, expressed sequentially, produce two independent proteins that retain their respective biological functions.
[0009] The 63 nucleotide sequences are shown in SED ID No. 5.
[0010] The present invention also provides an expression plasmid carrying a complex gene with a nucleotide sequence as shown in SED ID No. 1.
[0011] The present invention also provides a method for expressing the above-mentioned plasmid, comprising the following steps:
[0012] Step 1: Total RNA was extracted from mouse brain tissue using an RNA extraction kit and detected by agarose gel electrophoresis to determine the presence and purity of the RNA.
[0013] Step 2: Reverse transcribe the mRNA from the RNA into cDNA using RT-PCR, and synthesize the modified β-Ngf gene from the cDNA using the following primers:
[0014] The sequences of the forward primers are shown in SED ID No. 2;
[0015] The sequence of the reverse primer is shown in SED ID No. 6;
[0016] Step 3: The β-Ngf complex gene fragment was recovered using a gel extraction kit, and the β-Ngf gene was ligated into the expression plasmid P0-Ng to construct a recombinant P4-Kz-β-Ngf-63bp-Ng containing the Kz-β-Ngf-63bp-Ng complex gene. This recombinant is the expression plasmid carrying the above complex gene.
[0017] Furthermore, step one involves agarose gel electrophoresis with a mass percentage concentration of 1%.
[0018] Furthermore, in step three, the gene β-Ngf is ligated to the expression plasmid P0-Ng at a molar ratio of 2:1.
[0019] The present invention also discloses the application of the above-mentioned composite gene or expression plasmid in the preparation of drugs for the repair and regeneration of nerve damage or for the prevention of oxidative damage.
[0020] Furthermore, the aforementioned nerve damage includes damage to central nervous system cells and / or damage to the peripheral nervous system.
[0021] The present invention also discloses the use of the above-mentioned composite gene or expression plasmid in the preparation of drugs for detecting the presence of nerve growth factor or tracing nerve growth factor.
[0022] Furthermore, in the above applications, the therapeutic effect can be assessed by detecting the presence and content of nerve growth factor protein and / or green fluorescent protein.
[0023] Compared with existing technologies, the technical effects of this invention are positive and significant. The composite gene constructed in this invention expresses two independent proteins, NGF and NG, under the regulation of the same promoter. These two proteins retain their respective biological functions. NGF can be secreted extracellularly to exert its biological activity, promoting the regeneration and growth of nerve cell axons, and can be used for the treatment of nerve injuries. NG remains intracellularly and is not secreted extracellularly, thus not causing a decrease in intracellular fluorescence. Therefore, it can reflect the true expression levels of the β-Ngf and Ng genes, and can serve as an assessment indicator for monitoring and tracing the true expression level of the β-Ngf gene. This solves the technical problem in ZL202411711315.7 where the secretion of the fusion protein extracellularly leads to a decrease in intracellular fluorescence. Attached Figure Description
[0024] Figure 1 Diagram of a composite gene design for the segregated expression of the secretory nerve growth factor gene (β-Ngf) and the marker green fluorescent protein gene (Ng). Kozak and β-Ngf share the ATG. ATG is both the sequence of Kozak and the start codon of the β-Ngf gene mRNA.
[0025] Figure 2 Sequencing diagram of the complex gene containing the segregated expression of secretory nerve growth factor gene (β-Ngf) and marker green fluorescent protein gene (Ng) [including all Kozak (Kz), all β-Ngf, all unique 63-nucleotide linker (63bp), and part of the Ng sequence].
[0026] Figure 3 The plasmid P4, containing the Kz-β-Ngf-63bp-Ng complex gene constructed in this invention, and the plasmid P1, containing the β-Ngf-45bp-Kz-Ng fusion gene constructed previously, expressed green fluorescent protein (Ng) 3 days after transfection into 293T cells. G Comparison of fluorescence intensity. Figure 3 The A in the data is related to the 293T only group and the previously constructed data. β-Ngf -45bp-Kz- Ng Compared to the original group, the newly constructed Kz- β-Ngf -63bp- Ng After transfection of 293T cells with the composite gene, the fluorescence intensity of the expressed NG was significantly stronger; Figure 3 B in the text is Figure 3 The statistical analysis results of A in the data.
[0027] Figure 4 The biological activity of nerve growth factor expressed by plasmid P4, which contains the Kz-β-Ngf-63bp-Ng complex gene constructed in this invention, and plasmid P1, which contains the β-Ngf-45bp-Kz-Ng fusion gene constructed in the previous period, was compared 3 days after transfection into PC12 neural cells. Figure 4 The A value in the figure is different from that in the control group (P0-). Ng Compared to this, the newly constructed Kz- β-Ngf -63bp- Ng After transfection of PC12 cells with the compound gene, axon elongation was also significantly promoted; Figure 4 B in the text is Figure 4 The statistical analysis results of A in the data.
[0028] Figure 5 The effect of plasmid P4, which contains the Kz-β-Ngf-63bp-Ng complex gene, constructed in this invention, on the concentration of nerve growth factor in the cell culture medium after transfection of PC12 cells.
[0029] Figure 6 The effects of plasmid P4, which contains the Kz-β-Ngf-63bp-Ng complex gene, constructed in this invention, on the cellular antioxidant damage after transfection of mouse hippocampal neurons.
[0030] Figure 7 The cytotoxicity of plasmid P4, which contains the Kz-β-Ngf-63bp-Ng complex gene constructed in this invention, was detected after transfection of mouse hippocampal neurons. Detailed Implementation
[0031] The following detailed description of the specific embodiments and technical solutions of the present invention, in conjunction with the accompanying drawings and specific examples, provides preferred embodiments. The reagents, equipment, and methods used in this invention are all conventional reagents, equipment, and methods in the art. For conventional commercially available products with specified sources and models, the test methods and specific conditions are carried out according to the test methods and conditions in the corresponding product's instruction manual. Unless otherwise specified, the raw materials (actual materials, methods, and equipment) used can all be purchased from conventional commercially available products. The reagents, equipment, and testing methods described are all conventional reagents, equipment, and methods in the art.
[0032] Example 1: Design and construction of a composite gene (Kz-β-Ngf-63bp-Ng composite gene) expressing secreted nerve growth factor gene (β-Ngf) and marker green fluorescent protein gene (Ng) separately.
[0033] This invention designs a composite gene (Kz-) that separates and expresses the secretory β-Ngf gene and the marker Ng gene. β- Ngf -63bp- Ng The complex gene consists of Kozak, secretory β-Ngf, a unique 63-nucleotide linker (63bp), and an Ng sequence, the nucleotide sequence of which is shown in SED ID No. 1.
[0034] SED ID No. 1:
[0035]
[0036] This complex gene can express two separate proteins, NGF and NG. NGF is secreted extracellularly to exert its biological activity, while NG remains inside the cell.
[0037] The sequence of the gene β-Ngf is shown in SED ID No. 3 (which is the same as the β-Ngf sequence SED ID No. 3 described in ZL202411711315.7):
[0038] SED ID No. 3:
[0039] .
[0040] The sequence of the Ng gene is shown in SED ID No.4 (the same as the sequence SED ID No.4 of the gene Ng disclosed in ZL202411711315.7):
[0041] SED ID No.4:
[0042] ATGGTGAGCAAGGGCGAGGAGGATAACATGGCCTCTCTCCCAGCGACACATGAGTTACACATCTTTGGCTCCATCAACGGTGTGGACTTTGACATGGTGGGTCAGGGCACCGGCAATCCAAATGATGGTTATGAGGAGTTAAACCTGAAGTCCACCAAGGGTGACCTCCAGTTCTCCCCCTGGATTCTGGTCCCTCATATCGGGTATGGCTTCCATCAGTACCTGCCCTACCCTGACGGGATGTCGCCTTTCCAGGCCGCCATGGTAGATGGCTCCGGATACCAAGTCCATCGCACAATGCAGTTTGAAGATGGTGCCTCCCTTACTGTTAACTACCGCTACACCTACGAGGGAAGCCACATCAAAGGAGAGGCCCAGGTGAAGGGGACTGGTTTCCCTGCTGACGGTCCTGTGATGACCAACTCGCTGACCGCTGCGGACTGGTGCAGGTCGAAGAAGACTTACCCCAACGACAAAACCATCATCAGTACCTTTAAGTGGAGTTACACCACTGGAAATGGCAAGCGCTACCGGAGCACTGCGCGGACCACCTACACCTTTGCCAAGCCAATGGCGGCTAACTATCTGAAGAACCAGCCGATGTACGTGTTCCGTAAGACGGAGCTCAAGCACTCCAAGACCGAGCTCAACTTCAAGGAGTGGCAAAAGGCCTTTACCGATGTGATGGGCATGGACGAGCTGTACAAGTGA。
[0043] The sequence of the linked fragment consisting of 63 specific nucleotides is shown in SED ID No.5:
[0044] 5’-GGCTCCGGCGAGGGCAGGGGAAGTCTTCTAACATGCGGGGACGTGGAGGAAAATCCCGGCCCA-3’。
[0045] The Kozak sequence is GCCACCATG.
[0046] The Kozak and β-Ngf sequences share an ATG, which is the Kozak sequence and also the start codon of the mRNA corresponding to the β-Ngf gene.
[0047] Step 1: Total RNA was extracted from mouse brain tissue using the RNA extraction kit (DP451) from Tiangen Biotech, following the instructions and conditions. After determining the RNA content in the sample (Thermo Fisher Scientific, Nanodrop One), the presence and purity of RNA were detected by 1% agarose gel electrophoresis. The electrophoresis results clearly showed both 28S and 18S RNA, indicating that the prepared RNA was intact; OD 260 / OD 280 A ratio between 1.8 and 2.0 indicates high RNA purity.
[0048] Step 2: Using the Takara reverse transcription kit (6215A), mRNA was reverse transcribed into cDNA according to the instructions. Then, using PCR premix (Novizan, P525), PCR was performed with cDNA as a template and the following primers to synthesize the β-Ngf gene containing the Kozak sequence and 63 nucleotides.
[0049] The primers are as follows:
[0050] Forward primer:
[0051] AACGGTACCGCCACCATGTCCATGTTGTTCTACACTCTGA (SED ID No.2)
[0052] Reverse primer:
[0053] GCCCTTGCTCACCATTGGGCCGGGATTTTCCTCCACGTCCCCGCATGTTAGAAGACTTCCCCTGCCCTCGCCGGAGCCGCCTCTTCTTGTAGCCTTCCTG (SED ID No. 6)
[0054] Step 3: The DNA fragment was recovered using a gel extraction kit (DP219) from Tiangen Biotech. The β-Ngf gene was ligated into the expression plasmid P0-Ng at a 2:1 ratio to construct recombinant P4 containing the Kz-β-Ngf-63bp-Ng complex gene. The recombinant was then sent to a bioengineering company for sequencing to ensure the accuracy of the gene sequence. Figure 1and Figure 2 ).
[0055] Sequencing results showed that the constructed complex gene included Figure 1 All components, including the complete Kozak sequence, the complete secretory β-Ngf sequence, the complete 63-nucleotide linked fragment sequence (63 bp), and the beginning of the Ng sequence, are present, and the gene sequence is correct (SED ID No. 1).
[0056] Example 2: Fluorescence intensity of green fluorescent protein (NG) expressed after transfection of 293T cells with recombinant P4 containing the Kz-β-Ngf-63bp-Ng complex gene.
[0057] The recombinant from Example 1 was transfected into 293T cells cultured in vitro in 24-well plates using 1 mg / mL PEI40k (Yisheng Company, product number: 40816ES) (Sangon DMEM high glucose medium + 10% fetal bovine serum, 5% CO2, 37℃) to observe whether the Kz-β-Ngf-63bp-Ng complex gene could be expressed as NG in the cells. Figure 3 ), and the previously constructed ZL202411711315.7 containing β-Ngf -45bp-Kz- Ng The expression plasmid P1 of the fusion gene was compared.
[0058] The results show that the previously constructed β-Ngf -45bp-Kz- Ng After transfection of 293T cells with a plasmid vector, the fusion gene can express a green fluorescent NGF-NG fusion protein intracellularly. This fusion protein is a secretory protein and can be secreted extracellularly. (Compared to cells without gene transfection...) β-Ngf Compared to the 293T cells (293T only group), the previously constructed β-Ngf -45bp-Kz- Ng The fluorescence intensity of the group of cells was significantly enhanced ( Figure 3 (A) The fusion gene carried by P1 expresses a secreted NGF-NG fusion protein, which is secreted extracellularly and exhibits green fluorescence. In contrast, the complex gene carried by P4 expresses dissociated NGF and NG proteins. The NGF protein is secreted extracellularly, while the NG protein remains intracellularly. Therefore, statistical analysis showed a significant difference in fluorescence intensity compared to cells transfected with the P1 plasmid. Figure 3 B in **** p <0.0001, Tukey Post-hoc test, One-Way ANOVA). However, compared with the 293T only group and the previously constructed β-Ngf -45bp-Kz- Ng Compared to the original group, the newly constructed Kz- β-Ngf -63bp- Ng After transfection of 293T cells with the composite gene, the fluorescence intensity of NG expressed was significantly stronger. Figure 3 (A) Statistical analysis results showed significant differences in fluorescence intensity. Figure 3 B in **** p <0.0001 (Tukey Post-hoc test, One-Way ANOVA). This indicates that the newly constructed Kz- β-Ngf -63bp- Ng After transfection into cells, the complex gene exhibits stronger green fluorescence within the cells. The mechanism is that, upon expression, the complex gene is expressed as two separate proteins: NGF and NG. NGF is secreted extracellularly, while NG remains intracellular, thus exhibiting stronger fluorescence. This fluorescence can be used as an assessment criterion for gene expression. β-Ngf Indicators representing true performance levels. Image scale bar = 500μm.
[0059] Example 3: Effect of recombinant P4 containing the Kz-β-Ngf-63bp-Ng complex gene on axonal growth in PC12 neural cells.
[0060] The recombinant gene was transfected into PC12 cells, a neuronal cell-like cell line cultured in 24-well plates in vitro using 1 mg / mL PEI40k (Yisheng Company, product number: 40816ES). The medium was Thermo's F12K medium + 2.5% fetal bovine serum + 15% horse serum, 5% CO2, 37℃. The expression of the Kz-β-Ngf-63bp-Ng complex gene was observed to promote axonal growth in PC12 cells. Figure 4 ).
[0061] The results show that the previously constructed ZL202411711315.7 β-Ngf -45bp-Kz- Ng After transfection of PC12 cells with the fusion gene via a vector, the nerve growth factor (NGF)-green fluorescent protein (NG) fusion protein, expressed intracellularly, is secreted extracellularly and promotes axonal growth. This contrasts with untransfected cells. Ngf The control group of the gene (P0- Ng Compared to the earlier construction, β-Ngf -45bp-Kz- Ng The axon length of the group of cells was significantly increased ( Figure 4 (A, the axon indicated by the arrow). Statistical analysis results showed a significant difference in axon length ( Figure 4B in *** p <0.001, Tukey Post-hoc test, One-Way ANOVA).
[0062] At the same time, compared with the control group (P0- Ng Compared to this, the newly constructed Kz- β-Ngf -63bp- Ng After transfection of PC12 cells with the composite gene, axonal elongation was also significantly promoted. Figure 4 (A) Statistical analysis results showed a significant difference in axon length ( Figure 4 B in **** p <0.0001 (Tukey Post-hoc test, One-Way ANOVA). This indicates that our newly constructed Kz- β-Ngf -63bp- Ng After the complex gene is transfected into cells, the NGF produced can be secreted extracellularly and has biological activity.
[0063] In addition, compared with the previously constructed β-Ngf -45bp-Kz- Ng Compared to fusion genes, the newly constructed Kz- in this invention β-Ngf -63bp- Ng The ability of the composite gene to promote axon elongation was not significantly different after transfection of PC12 cells. Figure 4 The A, the arrow, and Figure 4 (B. ns = no statistically significant difference). This indicates that the newly constructed Kz- β-Ngf -63bp- Ng NGF expressed by the compound gene still exhibits similar levels of biological activity. Image scale bar = 100 μm.
[0064] Example 4: Enzyme-linked immunosorbent assay (ELISA) to detect the content of nerve growth factor (NGF) secreted into extracellular culture medium.
[0065] Three days after transfecting PC12 cells with the newly constructed Kz-β-Ngf-63bp-Ng complex gene, the cell culture medium was collected, and the concentration of NGF was detected using an ELISA kit. Figure 5The results showed that, compared with the control group (P0-Ng) without transfection of the β-Ngf gene, the concentration of NGF in the newly constructed Kz-β-Ngf-63bp-Ng complex genome was significantly increased (****p<0.0001, two-tailed Student's t-test). This indicates that the newly constructed Kz-β-Ngf-63bp-Ng complex genome can not only express the β-Ngf gene, but also successfully secrete the generated NGF into the extracellular space.
[0066] Example 5: Effect of recombinant gene P4 containing the Kz-β-Ngf-63bp-Ng complex on cellular antioxidant damage in mouse hippocampal neurons HT-22.
[0067] The newly constructed Kz-β-Ngf-63bp-Ng complex gene was transfected into HT-22 cells cultured in 96-well plates in vitro (Sangon DMEM high-glucose medium + 10% fetal bovine serum, 5% CO2, 37℃) and cultured for 3 days. Then, the nerve cells were induced to irritate with 200 μM hydrogen peroxide (H2O2). After 4 hours of incubation for irritation, the effect of complex gene expression on cellular antioxidant damage was detected using a CCK8 assay kit (Yisheng Company, product number 40203ES) according to the manufacturer's instructions. Figure 6 Among them, HT-22 cells that were not subjected to H2O2 damage and NGF treatment served as the normal, undamaged control group (HT-22 only); cells transfected with an empty vector without the β-Ngf gene but subjected to H2O2 damage served as the untreated damage group (P0-Ng + H2O2); cells transfected with the newly constructed Kz-β-Ngf-63bp-Ng composite gene vector and subjected to H2O2 damage served as the composite gene therapy damage group (P4-Kz-β-Ngf-63bp-Ng + H2O2); and cells given NGF protein and subjected to H2O2 damage served as the NGF-treated damage group (NGF PositiveControl + H2O2).
[0068] The experimental results showed that, compared with the HT-22 only group, the number of cells in the untreated injury group (P0-Ng + H2O2) was significantly reduced (****p<0.0001, Tukey Post-hoc test, One-Way ANOVA). This indicates that H2O2 can significantly induce hippocampal neuronal death without intervention. However, the survival rate of cells in the combined gene therapy injury group (P4-Kz-β-Ngf-63bp-Ng + H2O2) was significantly increased under H2O2 damage (****p<0.0001, Tukey Post-hoc test, One-Way ANOVA). Moreover, the expression of this combined gene was able to restore the survival rate of cells oxidatively damaged by 200 uM H2O2 to near normal levels (ns=no statistical difference, Tukey Post-hoc test, One-Way ANOVA). This indicates that the expression of the Kz-β-Ngf-63bp-Ng combined gene has a significant effect on promoting the antioxidant effect of neurons. Experimental results from the NGF-treated injury group confirmed the antioxidant effect of NGF.
[0069] Example 6: Detection of cytotoxicity of the newly constructed Kz-β-Ngf-63bp-Ng complex gene.
[0070] Mouse hippocampal neural cells HT-22, cultured in 96-well plates (Sangon DMEM high-glucose medium + 10% fetal bovine serum, 5% CO2, 37℃), were divided into two groups: a control group without AAV transduction (HT-22 only, n=4) and a group transfected with the newly constructed Kz-β-Ngf-63bp-Ng complex genome (n=4). On day 3 post-transfection, the effect of fusion gene expression on cell proliferation and cytotoxicity was detected using a CCK8 assay kit (Yisheng Company, catalog number 40203ES) according to the manufacturer's instructions. Figure 7 The results showed that, compared with the HT-22-only control group, the Kz-β-Ngf-63bp-Ng complex genome did not significantly affect cell survival (ns = no statistical difference, Mann-Whitney test). This indicates that the expression of the complex gene has no significant cytotoxicity.
[0071] The preferred embodiments of the present invention have been described in detail above, and are merely preferred implementations. It should be noted that those skilled in the art can make numerous modifications and variations based on the concept of the present invention without creative effort. Therefore, all technical solutions that can be obtained by those skilled in the art based on the concept of the present invention through logical analysis, reasoning, or limited experimentation on the basis of existing technology should be within the scope of protection defined by the claims.
Claims
1. A composite gene for separate expression of a gene for secreted nerve growth factor and a gene for marker-type green fluorescent protein, characterized by comprising a gene for secreted nerve growth factor and a gene for marker-type green fluorescent protein, wherein the gene for secreted nerve growth factor and the gene for marker-type green fluorescent protein are separated by a nucleotide sequence having a function of inhibiting the expression of the gene for secreted nerve growth factor. It consists of a Kozak sequence, a secreted nerve growth factor gene, a unique 63-nucleotide linker, and a green fluorescent protein gene. The nucleotide sequence of the complex gene is shown in SED ID No. 1, and the 63-nucleotide sequence is shown in SED ID No.
5.
2. An expression plasmid, characterized in that, It carries the complex gene as described in claim 1.
3. The method for constructing the expression plasmid according to claim 2, characterized in that, Includes the following steps: Step 1: Total RNA was extracted from mouse brain tissue using an RNA extraction kit and detected by agarose gel electrophoresis to determine the presence and purity of the RNA. Step 2: Reverse transcribe the mRNA from the RNA into cDNA using RT-PCR, and synthesize the modified β-Ngf gene from the cDNA using the following primers: The sequences of the forward primers are shown in SED ID No. 2; The sequence of the reverse primer is shown in SED ID No. 6; Step 3: The β-Ngf complex gene fragment is recovered using a gel extraction kit. The β-Ngf gene is ligated into the expression plasmid P0-Ng to construct a recombinant P4-Kz-β-Ngf-63bp-Ng containing the Kz-β-Ngf-63bp-Ng complex gene. This recombinant is the expression plasmid carrying the complex gene described in claim 1.
4. The method according to claim 3, characterized in that, Step one involves agarose gel electrophoresis at a mass percentage concentration of 1%. In step three, the β-Ngf gene is ligated to the expression plasmid P0-Ng at a molar ratio of 2:
1.
5. The use of the composite gene of claim 1 or the expression plasmid of claim 2 in the preparation of drugs for the repair and regeneration of nerve damage or for the prevention of oxidative damage.
6. The use of the composite gene of claim 1 or the expression plasmid of claim 2 in the preparation of a drug for detecting the presence of nerve growth factor or tracing nerve growth factor.
Citation Information
Patent Citations
Construction and application of a fusion gene encoding a green fluorescent labeled nerve growth factor fusion protein with biological activity
CN119464338B
CMV envelope protein packaging lentiviral vector and application thereof
CN114478713A
Coding gene of recombinant protein, vector, cell and preparation method
CN116970631A
IL-15 / IL-15R alpha fusion gene, carrier, engineered adipocyte and preparation method of engineered adipocyte
CN117143250A
Construction and application of fusion gene for coding green fluorescence labeled nerve growth factor fusion protein with biological activity
CN119464338A