Fangcheng tea high-dihydroxy catechin related molecular marker based on liquid phase chip and application thereof

Abstract

The application discloses Fangcheng tea high-dihydroxyl catechin related molecular markers based on a liquid phase chip and application thereof, and belongs to the technical field of biology. The application identifies 17 SNP mutation sites distributed on flavonoid 3'5' hydroxylase, flavonoid 3' hydroxylase, leucoanthocyanidin reductase and dihydroxy flavonol reductase coding genes of Fangcheng tea by using a liquid phase chip and a large amount of transcriptome data developed in an early stage. The mutation sites can significantly affect the expression of related genes, thereby regulating the distribution ratio of dihydroxyl catechin and trihydroxyl catechin of Fangcheng tea. According to the genotypic characteristics, high-dihydroxyl catechin Fangcheng tea germplasm resources can be quickly screened and identified. The application fills the technical blank of accurately, efficiently and low-costly identifying high-dihydroxyl Fangcheng tea resources, and also provides a theoretical basis for researching high-dihydroxyl catechin molecular mechanisms.

Description

TECHNICAL FIELD

[0001] The present application relates to the field of biotechnology, in particular to Fangcheng tea high dihydroxy catechin related molecular markers based on liquid chip and application thereof. BACKGROUND

[0002] Catechin is the main active ingredient in tea, which has the effects of antioxidant, anti-inflammatory, antibacterial, blood pressure lowering, blood sugar lowering, etc. There are seven types of catechins in tea, including epicatechin (EC), catechin (C), epicatechin gallate (ECG), epigallocatechin (EGC), gallocatechin (GC), epigallocatechin gallate (EGCG) and gallocatechin gallate (GCG). Among them, catechins can be divided into dihydroxy catechins (EC, C, ECG) and trihydroxy catechins (EGC, GC, EGCG, GCG) according to the number of B-ring hydroxylation of catechin compounds. Most tea tree resources have EGCG as the dominant catechin, showing a distribution characteristic of high trihydroxy catechin-low dihydroxy catechin, and only a few resources have high dihydroxy catechin content.

[0003] Fangcheng tea (Camellia fangchengensis Liang et Zhong) belongs to Camellia tea group plants of Theaceae, which was discovered and named by Liang Shengye and Zhong Yecun of Guangxi Forestry Science Institute in 1981. Because of its unique characteristics in tea group plants, Fangcheng tea is included in the tea group plant classification system of Min Tianlu as a new species. Because of its narrow distribution range and similar morphological characteristics to Bai Maocha in tea group plants, it is merged into Bai Maocha variety in the classification system of tea group plants by Chen Liang. The present inventors' research group found that the catechin composition of Fangcheng tea was significantly different from that of conventional tea tree resources through biochemical component detection of a large number of single plants in Fangcheng tea community, with C and ECG as the dominant catechin, and the content of EGCG was extremely low, showing a distribution characteristic of high dihydroxy catechin-low trihydroxy catechin. However, whether identifying Fangcheng tea according to morphological characteristics or biochemical component detection has the following problems: (1) the traditional identification method based on phenotypic traits often requires observers to have rich background in plant taxonomy research, and the method is subjective; (2) the detection of biochemical components has high cost investment.

[0004] Liquid chip based on targeted sequencing genotyping technology is a commonly used technical method for crop and horticultural plant variety breeding and resource identification. The technology can directly reflect the SNP genetic marker of DNA difference by genotyping the target marker site on the genome. Compared with traditional SSR markers, it has the advantages of high detection throughput, automation, speed, extremely low cost, and integrated analysis and comparison of detection data from different batches and different laboratories. So far, no functional marker related to Fangcheng tea catechin content has been reported. SUMMARY

[0005] The purpose of the present application is to provide a high-dihydroxyl catechin related molecular marker of Fangcheng tea based on liquid chip and its application, to solve the problems existing in the prior art. The molecular marker obtained by screening can distinguish Fangcheng tea and other tea varieties. The molecular marker is used to detect and analyze different tea resources, from which high-dihydroxyl catechin Fangcheng tea resources can be identified. The molecular marker fills the technical gap of accurate, efficient and low-cost identification of high-dihydroxyl Fangcheng tea resources, and provides a theoretical basis for studying the molecular mechanism of high-dihydroxyl catechin.

[0006] To achieve the above purpose, the present application provides the following scheme:

[0007] The present application provides a high-dihydroxyl catechin related molecular marker of Fangcheng tea, which is located in the coding region of flavonoid 3'5' hydroxylase (CfF3'5'H), flavonoid 3' hydroxylase (CfF3'H), leucoanthocyanidin reductase (CfDFR), and dihydroxy flavonol reductase (CfDFR) genes, respectively. The molecular marker comprises at least one of the following 16 molecular markers, and the 16 molecular markers comprise 17 SNP sites as shown below:

[0008] Molecular marker 1, the nucleotide sequence of which is shown in SEQ ID NO. 1, wherein G / C mutation exists at position 95 of the sequence;

[0009] Molecular marker 2, the nucleotide sequence of which is shown in SEQ ID NO. 6, wherein T / C mutation exists at position 19 of the sequence;

[0010] Molecular marker 3, the nucleotide sequence of which is shown in SEQ ID NO. 11, wherein C / A mutation exists at position 100 of the sequence;

[0011] Molecular marker 4, the nucleotide sequence of which is shown in SEQ ID NO. 16, wherein A / G mutation exists at position 31 of the sequence;

[0012] Molecular marker 5, the nucleotide sequence of which is shown in SEQ ID NO. 21, wherein C / G mutation exists at position 25 of the sequence;

[0013] molecular marker 6, whose nucleotide sequence is shown as SEQ ID NO. 26, which has G / T mutation and G / A mutation at positions 55 and 63, respectively;

[0014] molecular marker 7, whose nucleotide sequence is shown as SEQ ID NO. 31, which has T / C mutation at position 71;

[0015] molecular marker 8, whose nucleotide sequence is shown as SEQ ID NO. 36, which has T / A mutation at position 17;

[0016] molecular marker 9, whose nucleotide sequence is shown as SEQ ID NO. 41, which has T / C mutation at position 24;

[0017] molecular marker 10, whose nucleotide sequence is shown as SEQ ID NO. 46, which has C / A mutation at position 85;

[0018] molecular marker 11, whose nucleotide sequence is shown as SEQ ID NO. 51, which has G / A mutation at position 28;

[0019] molecular marker 12, whose nucleotide sequence is shown as SEQ ID NO. 56, which has G / A mutation at position 65;

[0020] molecular marker 13, whose nucleotide sequence is shown as SEQ ID NO. 61, which has C / G mutation at position 33;

[0021] molecular marker 14, whose nucleotide sequence is shown as SEQ ID NO. 66, which has C / T mutation at position 54;

[0022] molecular marker 15, whose nucleotide sequence is shown as SEQ ID NO. 71, which has A / G mutation at position 100;

[0023] molecular marker 16, whose nucleotide sequence is shown as SEQ ID NO. 76, which has A / G mutation at position 27.

[0024] Preferably, the coding region sequences of the CfF3’5’H, CfF3’H, CfDFR, CfDFR genes are shown as SEQ ID NO. 81-84, respectively.

[0025] The application also provides a probe combination for detecting the molecular markers, and the nucleotide sequence of the probe combination is shown as SEQ ID NO. 2, SEQ ID NO. 7, SEQ ID NO. 12, SEQ ID NO. 17, SEQ ID NO. 22, SEQ ID NO. 27, SEQ ID NO. 32, SEQ ID NO. 37, SEQ ID NO. 42, SEQ ID NO. 47, SEQ ID NO. 52, SEQ ID NO. 57, SEQ ID NO. 62, SEQ ID NO. 67, SEQ ID NO. 72 and SEQ ID NO. 77.

[0026] The application also provides a primer pair for amplifying the molecular markers, and the primer pairs for amplifying the molecular markers 1-16 are shown as SEQ ID NO. 3-5, SEQ ID NO. 8-10, SEQ ID NO. 13-15, SEQ ID NO. 18-20, SEQ ID NO. 23-25, SEQ ID NO. 28-30, SEQ ID NO. 33-35, SEQ ID NO. 38-40, SEQ ID NO. 43-45, SEQ ID NO. 48-50, SEQ ID NO. 53-55, SEQ ID NO. 58-60, SEQ ID NO. 63-65, SEQ ID NO. 68-70, SEQ ID NO. 73-75 and SEQ ID NO. 78-80.

[0027] The application also provides a product for identifying high-dihydroxyl catechin Fangcheng tea, which comprises the probe combination or the primer pair.

[0028] The application also provides the application of the molecular markers, the probe combination, the primer pair or the product in any of the following aspects:

[0029] (1) the application in distinguishing Fangcheng tea and other tea varieties;

[0030] (2) the application in identifying high-dihydroxyl catechin Fangcheng tea.

[0031] The application also provides a method for identifying high-dihydroxyl catechin Fangcheng tea, which comprises any of the following (1) or (2):

[0032] (1) using the genomic DNA of a tea tree sample to be detected as a template, using the probe combination to build a library and sequence the template, genotyping according to the sequencing results, and determining whether it is high-dihydroxyl catechin Fangcheng tea according to the genotyping results;

[0033] (2) using the genomic DNA of the tea sample to be tested as a template, amplifying the template by using the primer pair, performing genotyping according to the amplification result, and determining whether the tea sample to be tested is a high-dihydroxyl catechin Fangcheng tea according to the genotyping result.

[0034] Preferably, the method for determining is that when the genotypes corresponding to the mutation sites contained in the molecular marker 1-molecular marker 16 are CC, CC, AA, GG, GG, TT, AA, CC, AA, CC, AA, AA, AA, GG, TT, GG and GG respectively, the tea sample to be tested is a high-dihydroxyl catechin Fangcheng tea.

[0035] The application further provides a method for distinguishing Fangcheng tea from other tea varieties, which comprises any one of the following (1) or (2):

[0036] (1) using the genomic DNA of the tea sample to be tested as a template, performing library construction and sequencing on the template by using the probe combination, performing genotyping according to the sequencing result, and determining whether the tea sample to be tested is Fangcheng tea according to the genotyping result.

[0037] (2) using the genomic DNA of the tea sample to be tested as a template, amplifying the template by using the primer pair, performing genotyping according to the amplification result, and determining whether the tea sample to be tested is Fangcheng tea according to the genotyping result.

[0038] Preferably, the method for determining is that when the genotypes corresponding to the mutation sites contained in the molecular marker 1-molecular marker 16 are CC, CC, AA, GG, GG, TT, AA, CC, AA, CC, AA, AA, AA, GG, TT, GG and GG respectively, the tea sample to be tested is Fangcheng tea.

[0039] The application discloses the following technical effects:

[0040] The Fangcheng tea resource identified in the application belongs to a high-dihydroxy- low trihydroxy catechin resource. The Fangcheng tea and other tea tree resources are detected by using the technology disclosed in the application, and the biochemical characteristics of other tea tree resources are low dihydroxy-high trihydroxy catechin. Sixteen kinds of molecular markers containing 17 SNP sites are obtained by screening, and the SNP molecular markers are located on the flavonoid 3'5' hydroxylase (CfF3'5'H), flavonoid 3' hydroxylase (CfF3'H), leucoanthocyanidin reductase (CfLAR) and dihydroxy flavonol reductase (CfDFR) coding genes. The mutation sites are located at 115905323, 115905668, 115906001 and 115906865 sites of chromosome 11, 95385599, 95380649, 95380657 and 95380805 sites of chromosome 15, 27541184, 27541447, 27541701, 27542031, 27542922 and 27542986 sites of chromosome 6, and 41782591, 41785726 and 41785778 sites of chromosome 2 of the tea tree 'Shuchazao' reference genome (http: / / tpia.teaplants.cn / web / Download / Genomic_data / shuchazao_V2.genome.fas.gz), only C / A, T / C, G / C, A / G; G / T, G / A, T / C, C / G; C / A, T / C, T / A, G / A, G / A, C / G; C / T, A / G, A / G exist in Fangcheng tea. Therefore, the above-mentioned molecular markers of the application can be used for identification of Fangcheng tea. BRIEF DESCRIPTION OF DRAWINGS

[0041] In order to more clearly illustrate the technical solutions of the embodiments of the present application or the prior art, the drawings needed in the embodiments will be briefly introduced below. Obviously, the drawings in the following description are only some embodiments of the present application, and other drawings can also be obtained by those skilled in the art without creative labor.

[0042] Fig. 1 Heat map of catechin metabolic pathway and expression amount of related genes;

[0043] Fig. 2 Heat map of catechin metabolic pathway related genes and several catechins; Di. Dihydroxy catechin; Tri. Trihydroxy catechin;

[0044] Fig. 3 CfF3'5'H gene and amino acid sequence alignment analysis;

[0045] Fig. 4 CfF3'H gene and amino acid sequence alignment analysis;

[0046] Fig. 5 CfLAR gene and amino acid sequence alignment analysis;

[0047] Fig. 6 CfDFR gene and amino acid sequence alignment analysis. DETAILED DESCRIPTION

[0048] Various exemplary embodiments of the present application will now be described in detail, which should be considered to be illustrative of certain aspects, features and embodiments of the present application, and not restrictive of the present application.

[0049] As used herein, the terms "comprise", "comprising", "include", "including", "have", "having" and the like are open-ended terms, i.e., are intended to have the same broad meaning as the term "comprise".

[0050] Example 1

[0051] 1. Sampling

[0052] In spring 2024, one bud and two leaves of new shoots (NF and NS) and mature leaves (MF and MS) of Fangcheng tea (FCC and Longjing 43 (LJ43) were collected in the tea garden, and after quick freezing with liquid nitrogen, they were stored in a -80°C refrigerator. Part of them was used for RNA extraction and transcriptome sequencing in the later stage, and part of them was used for biochemical detection. In spring 2025, one bud and two leaves of new shoots of Shuchazao (SCZ), Fangcheng tea (FCC), Longjing 43 (LJ43), Tieguanyin (TGY), Danxia No. 8 (DX8H), Jinguanyin (JGY), Jinmudan (JMD), Lingtoudancong (LTDC), Qilan No. 10 (QL10H), Wuyishuixian (WYSX), Mingshanbaimo (MSBH), Baimohao (BHZ), Wuniuzao (WNZ), and Rougui (RG) were collected in the tea garden, and after quick freezing with liquid nitrogen, they were stored in a -80°C refrigerator. Part of them was used for DNA extraction and liquid chip detection in the later stage, and part of them was used for biochemical detection.

[0053] 2. Catechin component detection

[0054] The above samples were first freeze-dried, and then ground into powder with a high-throughput grinder. 0.1 g of powder was weighed into a 15 mL centrifuge tube, 10 mL of preheated 70% methanol was added, and after mixing, it was immersed in a 70°C water bath for 10 min, and shaken every 5 min. Then it was cooled to room temperature, centrifuged at 4000 rpm for 10 min, the supernatant was filtered through a 0.22 μm organic filter membrane, 1 mL was taken and placed in a liquid phase bottle for HPLC detection, the detection wavelength was 278 nm, the flow rate was 1 ml / min, the column temperature was 35°C, and the C 18Chromatographic column (particle size 5 μm, 250 mm*4.6 mm), sample size 10 μL, mobile phase: 1% formic acid and pure acetonitrile. Gradient conditions of mobile phase: 0-1 min 96% 1% formic acid; 1-42 min: 1% formic acid from 96% to 81.3%; 42-43 min: 1% formic acid back to 96%.

[0055] 3. RNA extraction and transcriptome sequencing

[0056] Total RNA of NF, NS, MF and MS tissues was extracted by EASYspin PLUS polysaccharide and polyphenol complex plant RNA rapid extraction kit (Aidley Biological Company), and the RNA quality was detected by 1% agarose gel electrophoresis, and the RNA concentration was detected by Nanodrop 2000. The qualified RNA samples were used to construct RNA sequencing library by Agilent 2100, and then RNA sequencing was performed by illumina sequencing platform. The sequencing data was aligned to the "Shuchazao" reference genome (http: / / tpia.teaplants.cn / web / Download / Genomic_data / shuchazao_V2.genome.fas.gz) by HISAT2 software, and used to analyze the expression level of genes.

[0057] 4. Key genes affecting high dihydroxy-low trihydroxy catechin content

[0058] Based on the annotation information of genes, genes in flavonoid metabolic pathway were screened from transcriptome data; then Pearson's method was used to calculate the correlation between catechin content and gene expression, and the results showed that CHS, 4CL, F3'H, F3'5'H, LAR, ANS, ANR, DFR, SCPL4, SCPL5 genes had significant positive correlation with dihydroxy catechin and trihydroxy catechin, indicating that the expression of these genes affected the content of dihydroxy and trihydroxy catechin. Figs. 1-2

[0059] 5. Detection of different tea resources by liquid chip

[0060] ​The tea tree resources were first ground into powder using liquid nitrogen, and DNA was extracted using a modified CTAB plant genomic DNA rapid extraction kit (Aidley Biological Company). The quality of the DNA was detected using 1% agarose gel electrophoresis, and the concentration of the DNA was detected using a Nanodrop 2000. The probe sequence was designed using the GenoBaits Probe Designer platform. Subsequently, the qualified DNA samples were used to construct a sequencing library using a tea tree functional liquid chip detection reagent (the detection reagent was provided by Shijiazhuang Boruidi Biological Technology Co., Ltd.), and sequencing was performed using an MGISEQ-2000 platform. The raw sequencing data was filtered to form clean data using fastq, and the clean data was aligned to the "Shuchazao" reference genome using BWA software. Finally, the GATK software was used to analyze the variation sites in the target region. After obtaining the typing data, the target sequence was aligned using the DNAMAN software to visually observe that the mutation sites only occurred in the Fangcheng tea resources.

[0061] 6. Identification of SNP molecular markers

[0062] Based on the above genotyping results, combined with annotation information, we screened the mutation sites on the Fangcheng tea flavonoid 3'5' hydroxylase (CfF3'5'H), flavonoid 3' hydroxylase (CfF3'H), leucoanthocyanidin reductase (CfLAR) and dihydroxy flavonol reductase (CfDFR) genes, and identified 17 SNPs, respectively located at 115905323 (Chr11_115905323), 115905668 (Chr11_115905668), 115906001 (Chr11_115906001), 115906865 (Chr11_115906865) of chromosome 11 of Camellia sinensis ‘Shuchazao’ reference genome; 95385599 (Chr15_95385599), 95380649 (Chr15_95380649), 95380657 (Chr15_95380657) and 95380805 (Chr15_95380805) of chromosome 15; 27541184 (Chr06_27541184), 27541447 (Chr06_27541447), 27541701 (Chr06_27541701), 27542031 (Chr06_27542031), 27542922 (Chr06_27542922) and 27542986 (Chr06_27542986) of chromosome 6; and 41782591 (Chr02_41782591), 41785726 (Chr02_41785726) and 41785778 (Chr02_41785778) of chromosome 2, with polymorphisms of C / A, T / C, G / C, A / G; G / T, G / A, T / C, C / G; C / A, T / C, T / A, G / A, G / A, C / G; C / T, A / G, A / G.The SNP molecular markers Chrll_115906865; Chr15_95385599, Chr15_95380649, Chr15_95380657, Chr15_95380805; Chr06_27542922, Chr06_27542031, Chr02_41782591, Chr02_41785726, Chr02_41785778 are located in the CDS coding region of CfF3'5'H; CfF3'H; CfLAR; CfDFR genes, wherein the variation of SNP molecular markers Chrll_115906865, Chr15_95380805, Chr06_27542922, Chr02_41782591 will cause the mutation of amino acids of the proteins encoded by the genes of CfF3'5'H, CfF3'H, CfLAR, CfDFR of Fangcheng tea, respectively, glutamic acid E (GAA) / glycine G (GCC), phenylalanine F (TTC) / leucine L (TTG), alanine A (GCA) / threonine T (ACA), threonine T (ACG) / methionine M (ATG). The variations of molecular markers Chr15_95385599, Chr15_95380649, Chr15_95380657, Chr06_27542031, Chr06_27542986, Chr04_41785726, Chr04_41785778 are all synonymous mutations and will not cause the change of amino acids; in addition, the variations of SNP molecular markers Chrll_115905323, Chrll_115905668, Chrll_115906001, Chr06_27541184, Chr06_27541447, Chr06_27541701 occur in the promoter region of the genes and will affect the expression of the genes, and the variations of the SNP molecular markers only occur in Fangcheng tea resources. Figs. 3-6 ).

[0063] 7. Verification of SNP molecular markers and detection of corresponding biochemical components

[0064] Primers are designed on both sides of the corresponding SNP molecular markers, and liquid chip is used to further verify that the molecular markers of the 17 SNP sites only occur mutations in Fangcheng tea resources (Table 1 and Table 2).

[0065] The molecular markers of the 17 SNP sites, probe sequences and primer sequences are as follows:

[0066] (1) Chrll_115906001 (G / C)

[0067] ①The sequence containing the marker (SEQ ID NO.1):

[0068] ataatacctaacattgttattgtataaatcatagctcccagttcccactagtgttcaccaaaacactcaaccaggtagtgctttgcttgcccta[g / c]ttcaaactat.

[0069] ② Liquid phase chip-probe sequence (SEQ ID NO.2):

[0070] ATAGTTTGAA

C / G

[0071] ③ Primer sequence:

[0072] Primer_AlleleFAM (SEQ ID NO.3):GTTTGAACTAGGGCAAGCA;

[0073] Primer_AlleleHEX (SEQ ID NO.4):GTTTGAAGTAGGGCAAGCA;

[0074] Primer_Common (SEQ ID NO. 5): tacctaacattgttattgtataaatcatagctcccagt.

[0075] (2) Chr11_115905668(T / C)

[0076] ①The sequence containing the marker (SEQ ID NO.6):

[0077] ataccacataatatccga

t / c

[0078] ② Liquid phase chip-probe sequence (SEQ ID NO.7):

[0079] ACTTTTCTCTTCATACAATGCCATGAACAATGAAGTTGTCAAGAATTTCATTTAAGCAAATTGTTGTACATGTGATTTCAATTATAGGACCACTTATCGGATATT

A / G

[0080] ③ Primer sequence:

[0081] Primer_AlleleFAM (SEQ ID NO.8): TAGGACCACTTATCGGAT;

[0082] Primer_AlleleHEX (SEQ ID NO.9): TAGGACCACTTGTCGGAT;

[0083] Primer_Common (SEQ ID NO.10): acaacttcattgttcatggcattgtatgaaga.

[0084] (3) Chr11_115905323(C / A)

[0085] ① Sequence where the marker is located (SEQ ID NO.11):

[0086] tcatttcaaccaacatcattccaccaccaccattactacaccaccattgcgaccaccaccactacatcaccatcgccatctctccaccatcactgtcac

c / a

[0087] ② Probe sequence (SEQ ID NO.12):

[0088] ATGGTAGTAATTGTG

G / T

[0089] ③ Primer sequence:

[0090] Primer_AlleleFAM (SEQ ID NO.13): AGTAATTGTGGTGACAGT;

[0091] Primer_AlleleHEX (SEQ ID NO.14): AGTAATTGTTGTGACAGT;

[0092] Primer_Common (SEQ ID NO. 15): atcattccaccaccaccattactaca.

[0093] (4) Chr11_115906865 (A / G)

[0094] ①The sequence containing the marker (SEQ ID NO.16):

[0095] ATTTTCTTGATGTTTTCATGGCTCAGCAGG

A / G

[0096] ②Probe sequence (SEQ ID NO.17):

[0097] GAGCTAAAGAGGCATATACCAAGAGTAGTGCCTTGATGTTGGTCGTGTTGAGCTTCTCTTCACCAGGATTT [T / C] CCTGCTGAGCCATGAAAACATCAAGAAAT.

[0098] ③ Primer sequence:

[0099] Primer_AlleleFAM (SEQ ID NO.18):TCACCAGGATTTTCCTCTGAG;

[0100] Primer_AlleleHEX (SEQ ID NO.19):TCACCAGGATTTCCCTGCTGAG;

[0101] Primer_Common (SEQ ID NO. 20): TCAAGGCACTACTCTTGGTATATGCCTCTTTAGC.

[0102] (5) Chr15_95380805 (C / G)

[0103] ①The sequence containing the marker (SEQ ID NO.21):

[0104] AACTGCGACCTTGGTCCATGCCTT

C / G

[0105] ② Probe sequence (SEQ ID NO.22):

[0106] GTGGTGCGGCCCGTTGCAAGGTTAGCCCATAGGCTTCATCCATGTTGAGCTTCTCGGCCGATTGTCCATCGGCCAAGTCCCAGTC

G / C

[0107] ③ Primer sequences:

[0108] Primer_AlleleFAM (SEQ ID NO.23): GTCCCAGTCGAAGGCATGGA;

[0109] Primer_AlleleHEX (SEQ ID NO.24): GTCCCAGTCCAAGGCATGGA;

[0110] Primer_Common (SEQ ID NO.25): TCGGCCGAGAAGCTCAACATGGA.

[0111] (6) Chr15_95385599(G / T)- Chr15_95380649(G / A)

[0112] ① Sequence where the marker is located (SEQ ID NO.26):

[0113] ACAAGCGGCAGCAGTGAACCTAGGGCAACTACTGAACGTGTGCACGACAAACGC

G / T

G / A

[0114] ② Probe sequence (SEQ ID NO.27):

[0115] GCTACCGCTACCGTCACCGAACACCCTGTGACCCAACATCACC

C / T

C / A

[0116] ③ Primer sequence:

[0117] Primer_AlleleFAM (SEQ ID NO.28): ACCCGCCCTAGCGCGTTTG;

[0118] Primer_AlleleHEX (SEQ ID NO.29): ACCTGCCCTAGAGCGTTTG;

[0119] Primer_Common (SEQ ID NO.30): ACAAGCGGCAGCAGTGAACCTAGGGCAACTAC.

[0120] (7) Chr15_95380657(T / C)

[0121] ① Sequence where the marker is located (SEQ ID NO.31):

[0122] TAGTGGAGCTGATGGTCCTCGCCGGAGTATTTAACATCGGCGATTTTGTCCCGGCTCTTGAGTGGCTGGA

T / C

[0123] ② Probe sequence (SEQ ID NO.32):

[0124] AGCGTGAAGTTTTTTCATTTTGGAAGCAACACCTTGGAG

A / G

[0125] ③ Primer sequence:

[0126] Primer_AlleleFAM (SEQ ID NO.33): ACCTTGGAGATCCAGCCA;

[0127] Primer_AlleleHEX (SEQ ID NO.34): ACCTTGGAGGTCCAGCCA;

[0128] Primer_Common (SEQ ID NO. 35): AGCTGATGGTCCTCGCCGGAGTATTTAACATC.

[0129] (8) Chr06_27541701(T / A)

[0130] ①The sequence containing the marker (SEQ ID NO.36):

[0131] atcagtcaatgcacac

T / A

[0132] ②Probe sequence (SEQ ID NO.37):

[0133] ATGTTTTTTACATTGTTTGGTGTATCATAATCTAATTCAAGTATTTAACGTGTACCTTTGATTTTATTTTATTTTTATTTTTATTTTTTTCT [A / T] GTTGCATTGACTGAT.

[0134] ③ Primer sequence:

[0135] Primer_AlleleFAM (SEQ ID NO.38): AGTGTGCATTGACTGAT;

[0136] Primer_AlleleHEX (SEQ ID NO.39):TGTGTGCATTGACTGAT;

[0137] Primer_Common (SEQ ID NO. 40): tacacgttaaatacttgaattaga.

[0138] (9) Chr06_27541447(T / C)

[0139] ①The sequence containing the marker (SEQ ID NO.41):

[0140] taaaggaagccatatattgttct

T / C

[0141] ②Probe sequence (SEQ ID NO.42):

[0142] TGTGTAGACATAAATGCTTTTTTTGTTTTTTCCAAAAAAAAGCTTATTTTATGATATTATTTTTTTGTGTCGCTTGAATAAATCTAGGATTTTAAGAACAATATATGGCTTCCTTTA.

[0143] ③ Primer sequence:

[0144] Primer_AlleleFAM (SEQ ID NO.43): TAAGAACAATATATGGCTTCCT;

[0145] Primer_AlleleHEX (SEQ ID NO.44): TGAGAACAATATATGGCTTCCT;

[0146] Primer_Common (SEQ ID NO. 45): tgtgaaaaaaacaaaaaaagcatttatgtct.

[0147] (10) Chr06_27541184(C / A)

[0148] ①The sequence containing the marker (SEQ ID NO.46):

[0149] ataaataaataaataccagggggccacatgacccctggtcaccgtgtggctccgtcactagttgcaaccgagtactctttgaat

C / A

[0150] ②Probe sequence (SEQ ID NO.47):

[0151] AGTTAATTAATAAATATAATGGAATAT

G / T

[0152] ③ Primer sequence:

[0153] Primer_AlleleFAM (SEQ ID NO.48): ATATAATGGAATATGATTC;

[0154] Primer_AlleleHEX (SEQ ID NO.49): ATATAATGGAATATTATTC;

[0155] Primer_Common (SEQ ID NO.50): ataaataaataccagggggccacatgacccctggt.

[0156] (11) Chr06_27542031(G / A)

[0157] ① Sequence where the marker is located (SEQ ID NO.51):

[0158] ATGACTGTGTTGGAATCTGTGTCCGCA

G / A

[0159] ② Probe sequence (SEQ ID NO.52):

[0160] AAGGTACGTAGGCCGATCAGCATGGAGGCTAGCTTCGGCGATGAACTGGCCAATGAAACCGGAGGCTCCAACGATGAGGACTCCGCCCCCGG

C / T

[0161] ③ Primer sequence:

[0162] Primer_AlleleFAM (SEQ ID NO.53): TGAGGACTCCGCCCCCGGCTGCGGA;

[0163] Primer_AlleleHEX (SEQ ID NO.54): TGAGGACTCCGCCCCCGGTGCGGA;

[0164] Primer_Common (SEQ ID NO. 55): TAGCCTCCATGCTGATCGGCCTACGTA.

[0165] (12) Chr06_27542922(G / A)

[0166] ①The sequence containing the marker (SEQ ID NO.56):

[0167] TGTTTTCACAAACACACTAATTTGGATGTGATGTGATATGTAACAGGGTGTTGTCAAGGATCAA [G / A] CATTCATGGAGAAGATACTAAAAGAGCATAAGATAGATATAGTAATATCAGCTA.

[0168] ②Probe sequence (SEQ ID NO.57):

[0169] TAGCTGATATTACTATATCTATCTTATGCTCTTTTAGTATCTTCTCCATGAATG [C / T]TTGATCCTTGACAACACCCTGTTACATATCACATCACATCCAAATTAGTGTGTTTGTGAAAACA.

[0170] ③ Primer sequence:

[0171] Primer_AlleleFAM (SEQ ID NO.58):GTATCTTCTCCATGAATGCTTGAT;

[0172] Primer_AlleleHEX (SEQ ID NO.59):GTATCTTCTCCATGAATGTTTGAT;

[0173] Primer_Common (SEQ ID NO. 60): TCACAACACACTAATTTGGATGT.

[0174] (13) Chr06_27542986(C / G)

[0175] ①The sequence containing the marker (SEQ ID NO.61):

[0176] GATAGATATAGTAATATCAGCTATTGGTGGTG

C / G

[0177] ② Probe sequence (SEQ ID NO.62):

[0178] AGCACGACGTAAGCGAAAATGTTTTTACCTTGATGGTTCCGACAGCTTTAATGGCATGGACTAGGGTGAGTTGGTCTAGTATATTA

G / C

[0179] ③ Primer sequences: <(0000372)><(0000373)>Primer_AlleleFAM (SEQ ID NO.63): TGAGTTGGTCTAGTATATTAG;

[0181] Primer_AlleleHEX (SEQ ID NO.64): TGAGTTGGTCTAGTATATTAC;

[0182] Primer_Common (SEQ ID NO.65): ATCAAGGTAAAAACATTTTCGCTTA。

[0183] (14) Chr02_41782591(C / T)

[0184] ① Sequence where the marker is located (SEQ ID NO.66):

[0185] TGCAGCGAATTTAAAGAAGGTGAAGCACTTGTTAGACTTGCCGAAAGCTGACA

C / T

[0186] ② Probe sequence (SEQ ID NO.67):

[0187] AGCTCCCTTCTTCATTCAAATCCGCCTTCCACAGTGTCAAGTT

G / A

[0188] ③ Primer sequences:

[0189] Primer_AlleleFAM (SEQ ID NO.68): TTCCACAGTGTCAAGTTCGTGT;

[0190] Primer_AlleleHEX (SEQ ID NO.69): TTCCACAGTGTCAAGTTCATGT;

[0191] Primer_Common (SEQ ID NO.70): AGCGAATTTAAAGAAGGTGAAGCACTTGTTA.

[0192] (15) Chr02_41785726(A / G)

[0193] ① Sequence where the marker is located (SEQ ID NO.71):

[0194] AATCAACGGTGTGTTGAGCATCATAAGGTCATGCACCAAAGCTAAGACAGTGAAGAGGCTGGTGTTCACATCCTCTGCTGGAACTGTTAATGTCCAGGA

A / G

[0195] ② Probe sequence (SEQ ID NO.72):

[0196] TGTTGGTGTTCCTGGACATTAACAGTTCCAGCAGAGGATGTGAACACCAGCCTCTTCACTGTCTTAGCTTTGGTGCATGACCTTATGATGCTCAACACACCGTTGATT.

[0197] ③ Primer sequences:

[0198] Primer_AlleleFAM (SEQ ID NO.73): TGTTGGTGTTCCTGGACATTAACA;

[0199] Primer_AlleleHEX (SEQ ID NO.74): TGTTGGTGCTCCTGGACATTAACA;

[0200] Primer_Common (SEQ ID NO.75): AGCATCATAAGGTCATGCACCAAAGCT.

[0201] (16) Chr02_41785778(A / G)

[0202] ①The sequence containing the marker (SEQ ID NO.76):

[0203] ACAATTGGAGTGACTTGGATTTCATC

A / G

[0204] ②Probe sequence (SEQ ID NO.77):

[0205] TACTAGTAAAGAAGTAGAGATGGAAAATATATAGTAAGTAATAATAACTAACCCAGCCAGTCATCTTCTTCTTAT [T / C] GATGAAATCCAAGTCACTCCAATTGT.

[0206] ③ Primer sequence:

[0207] Primer_AlleleFAM (SEQ ID NO.78):CTTCTTATTGATGAAATCCAAGT;

[0208] Primer_AlleleHEX (SEQ ID NO.79):CTTCTTTATCGATGAAATCCAAGT;

[0209] Primer_Common (SEQ ID NO. 80): ACTATATATTTTCCATCTCTACTTCTTTACT.

[0210] Example 3: Establishment of the detection method

[0211] DNA extraction: DNA was extracted from the one-bud-two-leaf shoots of the tea plant to be tested using the modified CTAB plant genomic DNA rapid extraction kit (Adley Biotechnology Co., Ltd.).

[0212] Detection of molecular markers: DNA samples that passed quality inspection were used to construct sequencing libraries using a tea tree functional liquid phase chip kit, and sequencing was performed using the MGISEQ-2000 platform. The raw sequencing data was filtered using FastQ to form clean data, which was then aligned to the 'Shuchazao' reference genome (http: / / tpia.teaplants.cn / web / Download / Genomic_data / shuchazao_V2.genome.fas.gz) using BWA software. Finally, 17 mutation sites on the genes of Fangcheng tea flavonoid 3'5' hydroxylase (CfF3'5'H), flavonoid 3' hydroxylase (CfF3'H), colorless anthocyanin reductase (CfLAR), and dihydroxyflavone alcohol reductase (CfDFR) were analyzed using GATK software, and the genotyping information of the corresponding molecular marker sites was obtained (Tables 1 and 2).

[0213] Table 1. Genotypes and catechin contents of some tea tree resources

[0214]

[0215] Table 2. Genotypes and catechin contents of some tea tree resources

[0216]

[0217] Note: The genotype order in Tables 1 and 2 is based on the numbering order of the 16 molecular markers in Example 2.

[0218] >CfF3'5'H (SEQ ID NO.81)

[0219]

[0220] >CfF3’H(SEQ ID NO.82)

[0221]

[0222] >CfDFR(SEQ ID NO.83)

[0223]

[0224] >CfLAR(SEQ ID NO.84)

[0225]

[0226] The embodiments described above are merely preferred embodiments of the present invention and are not intended to limit the scope of the present invention. Various modifications and improvements made by those skilled in the art to the technical solutions of the present invention without departing from the spirit of the present invention should fall within the protection scope defined by the claims of the present invention.

Claims

1. A molecular marker associated with high dihydroxycatechin content in Fangcheng tea, characterized in that, The molecular markers are located in the coding regions of the CfF3'5'H, CfF3'H, CfDFR, and CfDFR genes, respectively. These molecular markers include the 16 types shown below, and each of the 16 molecular markers comprises one of the 17 SNP sites shown below: Molecular marker 1, whose nucleotide sequence is shown in SEQ ID NO.1, has a G / C mutation at position 95; Molecular marker 2, whose nucleotide sequence is shown in SEQ ID NO.6, has a T / C mutation at position 19; Molecular marker 3, whose nucleotide sequence is shown in SEQ ID NO.11, has a C / A mutation at position 100; Molecular marker 4, whose nucleotide sequence is shown in SEQ ID NO.16, has an A / G mutation at position 31; Molecular marker 5, whose nucleotide sequence is shown in SEQ ID NO.21, has a C / G mutation at position 25; Molecular marker 6, whose nucleotide sequence is shown in SEQ ID NO.26, has G / T and G / A mutations at positions 55 and 63, respectively; Molecular marker 7, whose nucleotide sequence is shown in SEQ ID NO.31, has a T / C mutation at position 71; Molecular marker 8, whose nucleotide sequence is shown in SEQ ID NO.36, has a T / A mutation at position 17; Molecular marker 9, whose nucleotide sequence is shown in SEQ ID NO.41, has a T / C mutation at position 24; Molecular marker 10, whose nucleotide sequence is shown in SEQ ID NO.46, has a C / A mutation at position 85; Molecular marker 11, whose nucleotide sequence is shown in SEQ ID NO.51, has a G / A mutation at position 28; Molecular marker 12, whose nucleotide sequence is shown in SEQ ID NO.56, has a G / A mutation at position 65; Molecular marker 13, whose nucleotide sequence is shown in SEQ ID NO.61, has a C / G mutation at position 33; Molecular marker 14, whose nucleotide sequence is shown in SEQ ID NO.66, has a C / T mutation at position 54; Molecular marker 15, whose nucleotide sequence is shown in SEQ ID NO.71, has an A / G mutation at position 100; Molecular marker 16, whose nucleotide sequence is shown in SEQ ID NO.76, has an A / G mutation at position 27.

2. The molecular marker as described in claim 1, characterized in that, The coding region sequences of the CfF3'5'H, CfF3'H, CfDFR, and CfDFR genes are shown in SEQ ID NO.81-84, respectively.

3. A probe assembly for detecting the molecular marker of claim 1, characterized in that, The nucleotide sequences of the probe combination are shown in SEQ ID NO.2, SEQ ID NO.7, SEQ ID NO.12, SEQ ID NO.17, SEQ ID NO.22, SEQ ID NO.27, SEQ ID NO.32, SEQ ID NO.37, SEQ ID NO.42, SEQ ID NO.47, SEQ ID NO.52, SEQ ID NO.57, SEQ ID NO.62, SEQ ID NO.67, SEQ ID NO.72 and SEQ ID NO.

77.

4. A primer pair for amplifying the molecular marker of claim 1, characterized in that, The primer pairs used to amplify molecular markers 1-16 are shown in SEQ ID NO.3-5, SEQ ID NO.8-10, SEQ ID NO.13-15, SEQ ID NO.18-20, SEQ ID NO.23-25, SEQ ID NO.28-30, SEQ ID NO.33-35, SEQ ID NO.38-40, SEQ ID NO.43-45, SEQ ID NO.48-50, SEQ ID NO.53-55, SEQ ID NO.58-60, SEQ ID NO.63-65, SEQ ID NO.68-70, SEQ ID NO.73-75 and SEQ ID NO.78-80, respectively.

5. A product for identifying high-dihydroxycatechin Fangcheng tea, characterized in that, It comprises the probe combination of claim 3 and / or the primer pair of claim 4.

6. The use of the molecular marker of claim 1, the probe combination of claim 3, the primer pair of claim 4, or the product of claim 5 in any of the following: (1) Its application in distinguishing Fangcheng tea from other tea varieties; (2) Application in identifying high dihydroxycatechin Fangcheng tea.

7. A method for identifying Fangcheng tea with high dihydroxycatechin content, characterized in that, Includes either of the methods shown in (1) or (2) below: (1) Using the genomic DNA of the tea tree sample to be tested as a template, the template is constructed and sequenced using the probe combination described in claim 3. Genotyping is performed based on the sequencing results, and then it is determined whether it is Fangcheng tea with high dihydroxycatechin based on the genotyping results. (2) Using the genomic DNA of the tea tree sample to be tested as a template, the template is amplified using the primer pair described in claim 4. Genotyping is performed based on the amplification results, and then it is determined whether it is Fangcheng tea with high dihydroxycatechin based on the genotyping results. The method for determination is as follows: when the genotypes corresponding to the mutation sites contained in molecular markers 1-16 are CC, CC, AA, GG, GG, TT, AA, CC, AA, CC, AA, AA, AA, GG, TT, GG and GG respectively, the tea sample to be tested is Fangcheng tea with high dihydroxycatechin.

8. A method for distinguishing Fangcheng tea from other tea varieties, characterized in that, Includes either of the methods shown in (1) or (2) below: (1) Using the genomic DNA of the tea tree sample to be tested as a template, the template is constructed and sequenced using the probe combination described in claim 3. Genotyping is performed based on the sequencing results, and then it is determined whether it is Fangcheng tea based on the genotyping results. (2) Using the genomic DNA of the tea tree sample to be tested as a template, the template is amplified using the primer pair described in claim 4, and the genotype is performed according to the amplification results. Then, the genotype is determined to be Fangcheng tea based on the genotype results. The method for determination is as follows: when the genotypes corresponding to the mutation sites contained in molecular markers 1-16 are CC, CC, AA, GG, GG, TT, AA, CC, AA, CC, AA, AA, AA, GG, TT, GG and GG respectively, the tea sample to be tested is Fangcheng tea.

Images