Application of reagent for targeted inhibition of JunB gene in preparation of medicine for treating non-alcoholic fatty liver disease

Abstract

The invention belongs to the technical field of biomedicine, and particularly relates to application of a reagent for targeted inhibition of a JunB gene in preparation of a medicine for treating non-alcoholic fatty liver. Experiments prove that in an ApoE- / -mouse model induced by homocysteine Hcy, the expression of JunB in mouse liver tissue is up-regulated, and the expressions of alpha-smooth muscle actin, type 1 collagen and type 3 collagen are remarkably increased, which indicates that the Hcy can promote the occurrence of non-alcoholic fatty liver fibrosis in the ApoE- / -mouse. After the JunB is interfered by siRNA, the indexes are obviously reduced. When the JunB is over-expressed, the indexes are increased. The invention provides application of a reagent for targeted inhibition of JunB in preparation of drugs for treating non-alcoholic fatty liver, and provides a new intervention target for clinical treatment of non-alcoholic fatty liver.

Description

TECHNICAL FIELD

[0001] The application belongs to the technical field of biotechnology, and particularly relates to application of a reagent for targeted inhibition of a JunB gene in preparation of a medicine for treating non-alcoholic fatty liver. BACKGROUND

[0002] About 10%-20% of patients with chronic liver disease worldwide progress to non-alcoholic fatty liver, and patients in the late stage mainly rely on liver transplantation, and the treatment effect is poor, which has brought a heavy medical burden to the society. As the terminal stage of non-alcoholic liver cirrhosis, the core pathological mechanism originates from the abnormal activation of hepatic stellate cells (HSCs) - under the stimulation of long-term metabolic disorders (such as hyperhomocysteinemia) or fatty liver injury, HSCs transform into myofibroblasts, and uncontrollably secrete a large amount of type I and type III collagen. These abnormally deposited extracellular matrix (ECM) forms dense fibrous septa, gradually destroys the normal lobular structure of the liver, and finally leads to liver tissue hardening or even canceration.

[0003] It is worth noting that non-alcoholic liver cirrhosis has the characteristics of strong concealment and short intervention window. Early fibrosis can be delayed through lifestyle adjustment, metabolic intervention or antiviral therapy, but once it enters the late ECM extensive deposition stage, existing means such as anti-inflammatory drugs (pirfenidone) or antioxidants (vitamin E) can only limit the activity of HSCs, and are accompanied by side effects such as photosensitive dermatitis. The activator of MMPs aimed at degrading fibrous tissue is still in the experimental stage, and it is difficult to achieve precise targeted therapy. This "preventable and refractory" characteristic makes non-alcoholic liver cirrhosis a silent killer threatening modern human health.

[0004] Therefore, it is urgent to find a new strategy for treating non-alcoholic liver cirrhosis. SUMMARY

[0005] To solve the above problems, the application provides application of a reagent for targeted inhibition of a JunB gene in preparation of a medicine for treating non-alcoholic fatty liver.

[0006] The application is realized through the following technical scheme: Application of a reagent for targeted inhibition of a JunB gene in preparation of a medicine for treating non-alcoholic fatty liver.

[0007] Preferably, the reagent comprises an interference vector for targeted inhibition of the JunB gene.

[0008] Preferably, the interference vector is an siRNA interference vector of the JunB gene; the forward sequence of the siRNA is as shown in SEQ ID NO. 1, and the reverse sequence is as shown in SEQ ID NO. 2.

[0009] Preferably, the reagent for targeted inhibition of the JunB gene further comprises a transfection aid.

[0010] Preferably, the transfection aid is Lipofectamine 2000.

[0011] Preferably, the drug has a reagent that targets and inhibits the JunB gene as its sole active ingredient.

[0012] Preferably, the drug further includes pharmaceutically acceptable excipients.

[0013] Preferably, the pharmaceutically acceptable excipient is one or more of the following: diluent, disintegrant, precipitation inhibitor, flow aid, binder, dispersant, suspending agent, isotonic agent, thickener, emulsifier, preservative, and stabilizer.

[0014] Preferably, the diluent is any one or more of lactose, microcrystalline cellulose, and mannitol; Preferably, the disintegrant is any one or more of croscarmellose sodium, croscarmellose, and sodium carboxymethyl starch.

[0015] Preferably, the acceptable dosage forms of the drug include tablets, capsules, granules, injections, pills, powders, or ointments.

[0016] Compared with the prior art, the present invention has the following beneficial effects: This invention constructs homocysteine ​​(Hcy) ApoE - / - A mouse model of non-alcoholic fatty liver disease (NAFLD) was established, revealing for the first time the crucial role of JunB in NAFLD development in mouse models. At the animal level, HE staining showed that, compared to the NC group, the HMD group exhibited fibrosis in the portal area of ​​the liver tissue, radial extension of collagen bundles, formation of pseudolobules, accompanied by inflammatory infiltration and hepatocyte degeneration. Immunohistochemical results indicated that, compared to the NC group, the HMD group showed significantly increased expression of α-SMA, Collagen I, and Collagen III. This suggests that Hcy can promote… ApoE - / - In mice, liver cirrhosis develops. This invention demonstrates that at the cellular level, Hcy intervention in hepatocytes increases JunB expression. Interference with JunB via siRNA significantly reduces these indicators and improves fibrosis; conversely, overexpression of JunB increases these indicators. These results indicate that JunB can, and inhibiting JunB can improve non-alcoholic fatty liver disease. This invention provides the application of reagents targeting and inhibiting JunB in the preparation of drugs for treating non-alcoholic fatty liver disease, offering a new intervention target for the clinical treatment of non-alcoholic fatty liver disease. Attached Figure Description

[0017] In order to more clearly illustrate the technical solutions in the embodiments of the present application or the prior art, the accompanying drawings required by the embodiments or prior art description will be briefly introduced below. Obviously, the accompanying drawings in the following description only constitute some embodiments of the present application, and for those skilled in the art, other drawings can also be obtained from these drawings without creative labor.

[0018] Figure 1 The contrast results of the normal control group (NC group) and the high fibrosis model group (HMD group) of the present application in histology and protein expression level are shown in the following figures. Figure 1 In the figures, A is the result of Masson staining for detecting the collagen content in the NC group and the HMD group, respectively; B is the corresponding statistical chart of Masson staining for detecting the collagen content; C is the result of immunohistochemistry for detecting JunB in the NC group and the HMD group, respectively; D is the chart of the positive area ratio of JunB detected by immunohistochemistry; E is the result of detecting Collagen I, Collagen III and α-SMA in the NC group and the HMD group, respectively; F is the chart of the positive area ratio of Collagen I detected by immunohistochemistry; G is the chart of the positive area ratio of Collagen III detected by immunohistochemistry; and H is the chart of the positive area ratio of α-SMA detected by immunohistochemistry.

[0019] Figure 2 The result of verifying the expression difference of fibrosis key proteins by Western blot technology of the present application is shown in the following figure. Figure 2 In the figures, A is the result of Western blotting for detecting the content expression of Collagen I protein in the Con group and the Hcy treatment group, respectively; B is the corresponding statistical chart of A; C is the result of Western blotting for detecting the content expression of Collagen III protein in the Con group and the Hcy treatment group, respectively; D is the corresponding statistical chart of C; E is the result of Western blotting for detecting the content expression of α-SMA protein in the Con group and the Hcy treatment group, respectively; and F is the corresponding statistical chart of E.

[0020] Figure 3 The result of the influence of high homocysteine (Hcy) treatment on JunB mRNA expression and the expression difference of fibrosis key proteins after transfection of small interfering RNA of the present application is shown in the following figure. Figure 3Figure 1 is a result diagram of the influence of high homocysteine (Hcy) treatment on JunB mRNA expression, wherein A is a result diagram of qPCR detection of the influence of high homocysteine (Hcy) treatment on JunB mRNA expression; B is a result diagram of qPCR detection of JunB expression content in con, si-JunB1, si-JunB2 and si-JunB3; C is a result diagram of Western blotting experiment detection of Collagen I protein content expression after JunB interference; D is a result diagram of Western blotting experiment detection of Collagen III protein content expression after JunB interference; E is a result diagram of Western blotting experiment detection of α-SMA protein content expression after JunB interference; F is a statistical diagram corresponding to C; G is a statistical diagram corresponding to D; and H is a statistical diagram corresponding to E.

[0021] Figure 4 Figure 2 is a result diagram of the influence of JunB mRNA expression after JunB overexpression and the expression difference of fibrosis key proteins; Figure 4 Figure 2 is a result diagram of the influence of JunB mRNA expression after JunB overexpression and the expression difference of fibrosis key proteins;

[0022] Figure 5 Figure 3 is a diagram of the rescue effect of fibrosis key protein transfection small interfering RNA on fibrosis caused by Hcy treatment; Figure 5 Figure 3 is a diagram of the rescue effect of fibrosis key protein transfection small interfering RNA on fibrosis caused by Hcy treatment;

[0023] Figure 6 Figure 4 is a diagram of JunB overexpression vector construction. DETAILED DESCRIPTION

[0024] In order to facilitate the understanding of the present application, the present application will be described more fully below, and preferred embodiments of the present application will be given. However, the present application can be realized in many different forms, and is not limited to the embodiments described in the present application. On the contrary, the purpose of providing these embodiments is to make the disclosure of the present application more thorough and comprehensive.

[0025] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this application belongs. The terminology used in the description of the application herein is for the purpose of describing particular embodiments only and is not intended to be limiting of the application.

[0026] The advantages of the present application are illustrated below by specific examples.

[0027] The present application uses ApoE / - Mice were purchased from Beijing Weishanglideshi Biological Technology Co., Ltd. (Animal License No.: SCXK (Jing) 2021-0010), and the animal experiments were approved by the Ethics Committee of Ningxia Medical University (No. 2021-G076 of Ningxia Medical University Ethics Committee). The mice were bred in the Experimental Animal Center of Ningxia Medical University in a SPF environment. ApoE - / - Mice: high methionine diet group (HMD group): 6 ApoE - / - Mice were given a high-fat diet containing 1.7% methionine by mass fraction and were fed for 22 weeks to induce a NAFL non-alcoholic fatty liver model. Normal control group (NC group): 6 ApoE - / - Mice were given standard rodent feed and were fed for the same period as the HMD group.

[0028] Specimen collection: Liver tissue sampling was completed within 10 minutes after the mice were sacrificed. Under sterile conditions, the left lobe of the liver was taken from the middle region, avoiding blood vessels and necrotic tissue, and cut into tissue blocks of about 5mm x 5mm x 2mm. Physiological saline was used to rinse 3 times to remove blood residues, and filter paper was used to absorb the surface moisture. Part of the tissue was immediately placed in 4% paraformaldehyde for fixation (for paraffin sectioning and pathological staining). The remaining tissue was divided into cryogenic tubes, frozen in liquid nitrogen, and then transferred to a -80℃ ultra-low temperature refrigerator for storage (for molecular biology detection).

[0029] Mouse hepatocyte cell lines were purchased from Shanghai Mingke Biological NCTC1469 cell line, and the cells were stored in liquid nitrogen for standby. The cryopreservation solution was prepared according to a ratio of DMSO and special grade horse serum of 1:9.

[0030] All sequences in the present application are in the direction of 5'-3'. All invalid U in the sequence is directly replaced by T in the sequence listing.

[0031] Example 1 The experimental methods related to the present application are performed as follows: 0, normal diet control group (NC) and 1.7% high methionine diet group (HMD) mouse liver section HE staining 1. Purpose of the experiment Hematoxylin and Eosin staining clearly shows the structure of the nucleus, cytoplasm and extracellular matrix in liver tissue, which is used to evaluate the pathological features such as non-alcoholic fatty liver, inflammatory infiltration, and fatty degeneration.

[0032] 2. Reagents and materials Fixative: 4% neutral buffered paraformaldehyde (for fixing liver sections).

[0033] Gradient ethanol: 70% ethanol → 80% ethanol → 90% ethanol → 95% ethanol → 100% ethanol.

[0034] Staining reagent: Hematoxylin staining solution (Harris formula): Hematoxylin 2.5g, anhydrous ethanol 25mL, potassium aluminum sulfate 50g, distilled water 500mL, mercuric oxide 1.25g. Dissolve potassium aluminum sulfate in 500mL distilled water and boil; dissolve hematoxylin in 25mL anhydrous ethanol and slowly add to the boiling solution; add mercuric oxide, stir quickly and cool; filter and use.

[0035] Eosin staining solution: Eosin Y 1g, distilled water 100mL, glacial acetic acid 1 drop. Dissolve Eosin Y powder in 100mL distilled water; add 1 drop of glacial acetic acid and mix well to enhance the staining effect.

[0036] Differentiation solution: 1% hydrochloric acid ethanol (1mL concentrated hydrochloric acid + 99mL 70% ethanol by volume).

[0037] Bluing solution: 0.2% ammonia water or Scott's bluing solution (sodium bicarbonate 1g + magnesium sulfate 10g + distilled water 500mL).

[0038] Clearing agent: xylene (or environmentally friendly alternatives such as limonene).

[0039] Mounting agent: neutral resin.

[0040] Others: glass slides, cover slips, staining jars, oven, optical microscope.

[0041] 3. Operation steps (1) Paraffin section preparation Dewaxing: immerse the paraffin sections in xylene I and xylene II for 10 minutes each.

[0042] Hydration: 70% ethanol → 80% ethanol → 90% ethanol → 95% ethanol → 100% ethanol for 5 minutes each, and finally distilled water for 2 minutes.

[0043] (2) Hematoxylin staining Immerse the sections in hematoxylin staining solution for 8 minutes (adjust the time according to the age of the staining solution).

[0044] Rinse the surface dye with running water for 1 minute.

[0045] (3) Differentiation and Return to Blue Differentiation: Immerse in 1% hydrochloric acid ethanol for 3 seconds (under a microscope until the cell nuclei are clear and the background is clean).

[0046] To restore blue color: Rinse with running water for 10 minutes, or immerse in the blue restoration solution for 30 seconds and then rinse with running water for 5 minutes.

[0047] (4) Eosin staining Immerse the slices in eosin stain for 2 minutes.

[0048] Rinse gently with running water for 5 seconds to remove excess dye.

[0049] (5) Dehydration and transparency Gradient dehydration: 70% ethanol → 80% ethanol → 90% ethanol → 95% ethanol → 100% ethanol, 30 seconds each.

[0050] Transparent: 5 minutes each of xylene I and xylene II.

[0051] (6) Sealing Add neutral resin dropwise, cover with a coverslip, and avoid air bubbles.

[0052] Allow to air dry at room temperature or use a 37°C oven to accelerate curing.

[0053] 4. Interpretation of staining results Cell nucleus: stained dark blue with hematoxylin.

[0054] Cytoplasm / collagen fibers: stained pink with eosin.

[0055] Example of pathological features: Non-alcoholic fatty liver disease: Collagen deposition areas appear as homogeneous pink (requires verification with Masson staining).

[0056] Inflammatory infiltration: Dense, dark blue cell nuclei (such as lymphocytes and macrophages) are visible.

[0057] Fatty degeneration: Vacuolated areas (lipid droplets are dissolved, resulting in lighter staining).

[0058] 5. Precautions Staining time control: If hematoxylin staining is too dark, it can prolong the differentiation time; if it is too light, re-staining is necessary.

[0059] Eosin staining requires rapid dehydration to prevent fading.

[0060] Prevention of film detachment: The glass slides need to be coated with poly-L-lysine or APES adhesive in advance to enhance adhesion.

[0061] Avoid high temperature drying of the section, suggest 37℃.

[0062] Reagent toxicity protection: Xylene should be operated in fume hood, wearing gloves and goggles.

[0063] Waste liquid should be disposed according to the laboratory hazardous chemicals standard.

[0064] Quality control: Positive control should be set for each batch of staining, known pathological section.

[0065] Evaluate the staining results to ensure consistency.

[0066] II. Masson staining of liver sections of normal diet control group (NC) and high methionine diet group (HMD) mice with quality score 1.7% 1. Purpose of the experiment Masson trichrome staining can specifically show collagen fibers (blue), cytoplasm and muscle (red), and cell nuclei (blue-black) in liver tissue, and is used to quantitatively evaluate the degree of non-alcoholic fatty liver (such as collagen deposition area).

[0067] 2. Reagents and materials Fixing solution: 4% neutral buffered paraformaldehyde (for fixing liver sections).

[0068] Staining reagent: Masson trichrome staining solution (classic formula): Regaud hematoxylin staining solution: hematoxylin 1g, 95% ethanol 10mL, glycerol 10mL, distilled water 80mL.

[0069] Acid magenta staining solution: acid magenta 0.7g, acid magenta 0.3g, glacial acetic acid 1mL, distilled water 100mL.

[0070] Phosphomolybdic acid solution: phosphomolybdic acid 1g, distilled water 100mL.

[0071] Aniline blue staining solution: aniline blue 0.5g, glacial acetic acid 2mL, distilled water 100mL.

[0072] Differentiation solution: 1% hydrochloric acid in ethanol (1mL concentrated hydrochloric acid + 99mL 70% ethanol).

[0073] Other reagents: 70% ethanol→80% ethanol→90% ethanol→95% ethanol→100% ethanol, xylene, neutral resin mounting agent.

[0074] 3. Operation steps (1) Pre-treatment of paraffin sections Dewaxing and hydration: Xylene I, Xylene II 10 min each -> Gradient ethanol 70% ethanol -> 80% ethanol -> 90% ethanol -> 95% ethanol -> 100% ethanol 5 min each -> Distilled water rinse 2 min.

[0075] (2) Nucleus staining Immerse in Regaud hematoxylin stain for 8 min -> Rinse with running water for 5 min.

[0076] (3) Cytoplasm and collagen fiber staining Acid fuchsin staining: Immerse in stain for 5 min -> Distilled water rinse for 10 s.

[0077] Molybdophosphoric acid differentiation: Immerse in molybdophosphoric acid solution for 5 min -> Distilled water rinse for 1 min.

[0078] Aniline blue counterstaining: Immerse in aniline blue stain for 3 min -> Distilled water rinse quickly.

[0079] (4) Differentiation and dehydration Differentiation: Immerse in 1% hydrochloric acid ethanol for 2 s (control under the microscope until the background is clean).

[0080] Gradient dehydration: 70% ethanol -> 80% ethanol -> 90% ethanol -> 95% ethanol -> 100% ethanol 30 s each.

[0081] Transparency: Xylene I, Xylene II 5 min each.

[0082] (5) Mounting Add neutral resin dropwise, cover with a coverslip, avoiding air bubbles -> Air dry at room temperature or solidify in a 37°C oven.

[0083] 4. Interpretation of staining results Collagen fibers: Bright blue (aniline blue binds collagen).

[0084] Cytoplasm / muscle: Red (acid fuchsin staining).

[0085] Nucleus: Blue-black (hematoxylin staining).

[0086] Examples of pathological applications: Non-alcoholic fatty liver score: Increased area ratio of collagen deposition area (blue) (quantitative analysis software is required).

[0087] Fibro-interstitial formation: Blue fibrous cord around the portal or central vein.

[0088] III. Liver sections of mice in the normal diet control group (NC) and the high-methionine diet group (HMD) with a mass fraction of 1.7% were immunohistochemically stained Immunohistochemical experiment to detect fibrosis-related indicators α-SMA, Collagen-I, Collagen-III and JunB 1. Paraffin section deparaffinization: the paraffin section of placenta tissue was sequentially immersed in: dimethylbenzene I for 10 min, dimethylbenzene II for 10 min, anhydrous ethanol I for 5 min, anhydrous ethanol II for 5 min, 95% alcohol for 5 min, 80% alcohol for 5 min, 70% alcohol for 5 min, and then washed with up water for 3 times, 5 min each time after taking out from alcohol.

[0089] 2. Prepare PBS solution according to Table 6: Table 1 Preparation of PBS solution 3. Antigen repair: place the tissue section into the repair box, add appropriate amount of 0.01M, pH 6.0 citric acid buffer to cover the section tissue area, repair with microwave high fire, and then naturally cool to room temperature after taking out from the microwave oven, wash the section with PBS for 3 times, 5 min each time.

[0090] 4. Blocking: add endogenous peroxidase blocking agent to the section tissue area, cover all section tissue areas, incubate at room temperature for 30 min, and then wash the section with PBS for 3 times, 5 min each time.

[0091] 5. Immunolabeling: use water-absorbing paper to gently absorb water around the tissue, and use a special oil pen to draw a circle around the tissue, add 80L of BSA solution blocking liquid, and then incubate in a 37°C constant temperature oven for 30 min. After discarding the blocking liquid, incubate the pre-prepared primary antibody at 4°C overnight, and then incubate the fluorescent secondary antibody at room temperature for 2 h after PBS washing on the next day.

[0092] 6. Color development: after completion of secondary antibody incubation, wash with PBS for 3 times, add the prepared DAB color developing liquid after spinning dry, and then incubate for 10 min.

[0093] 7. Nucleus restaining: after washing with tap water, add hematoxylin restaining for 3 min, and then add ammonia water to return blue after washing.

[0094] 8. Mounting: add neutral balsam after mounting, and then observe under a microscope.

[0095] Four, Control / Hcy mouse liver cell experiment grouping and culture The study of the effect of high homocysteine on liver cell fibrosis: high homocysteine group Hcy and normal group Control; the study of the effect of silencing JunB on high homocysteine-induced liver cell fibrosis is divided into: Control group, si-JunB group, Hcy group, Hcy+si-JunB group, construct JunB small interfering virus, synthesized by Shanghai GenePharma Company, respectively: si-JunB1, si-JunB2 and si-JunB3, the forward sequence of siRNA1 is shown as SEQ ID NO. 1, and the reverse sequence is shown as SEQ ID NO. 2. The forward sequence of siRNA2 is shown as SEQ ID NO. 3, and the reverse sequence is shown as SEQ ID NO. 4. The forward sequence of siRNA3 is shown as SEQ ID NO. 5, and the reverse sequence is shown as SEQ ID NO. 6. After being transferred into liver cells, qRT-PCR was used to obtain the appropriate knockdown of JunB transcription factor si-JunB1, which is recorded as si-JunB, so as to realize the knockout of the target gene. The study of the effect of overexpression JunB on high homocysteine-induced liver cell fibrosis is divided into: Control group and ad-JunB group, construct JunB overexpression plasmid, synthesized by Xi'an Genecarer Company, recorded as ad-JunB, and transferred into liver cells, so as to realize the overexpression of the target gene.

[0096] 1、Cell culture (1) The cell culture medium is complete medium, specifically: DMEM medium containing 10% volume fraction of special horse serum and 1% volume fraction of penicillin-streptomycin.

[0097] (2) Control group (Con group) culture conditions: 7% FBS DMEM medium is placed in a cell incubator at 37°C and 5% CO2.

[0098] (3) Hcy group culture conditions: 100 moL Hcy+7% FBS DMEM medium is placed in a cell incubator at 37°C and 5% CO2.

[0099] (4) After 24 hours, the cells are collected for subsequent experiments.

[0100] 2、Cell freezing The cryopreservation solution is prepared by mixing DMSO and special grade horse serum at a ratio of 1:9. The cell culture bottle is removed from the incubator, and cells in the logarithmic growth phase are selected. The waste liquid in the culture bottle is aspirated and discarded on the clean bench. After gentle blowing and washing twice, 1 mL of trypsin is added to digest the cells. After complete digestion, the trypsin is discarded, and the adherent cells are blown and mixed with the culture medium. The cells are transferred to a 15 mL centrifuge tube and centrifuged at 1000 rpm for 5 min. The supernatant is discarded, and the cryopreservation solution is added. The cells are mixed by blowing and then divided into 1.8 mL cryopreservation tubes. The cell name, freezing time, and operator are noted. The cells are transferred to a liquid nitrogen tank according to the gradient freezing sequence of 4°C for 30 min, -20°C for 2 h, and -80°C overnight.

[0101] 3. Small interfering RNA transfection The logarithmically growing hepatocytes are trypsinized and then 8 mL of complete medium is added. The cells are gently blown and shaken to prepare a suspension. 500 μL of the suspension is inoculated into a 24-well plate and incubated overnight. The next day, the cells are removed and observed under a microscope. When the cells grow to 70%, the siRNA targeting JunB is diluted in Opti-MEM medium to a final concentration (usually 100 nM, which needs to be optimized by pre-experiment). Lipofectamine 2000 is diluted in another tube of Opti-MEM according to the proportion (recommended siRNA volume:Lipofectamine 2000 volume = 1:1, refer to the instructions). The diluted siRNA and Lipofectamine 2000 are gently mixed, and the complex is formed at room temperature for 5 minutes. The complex is added dropwise to the cell culture dish and mixed gently. After transfection for 6 hours, the complete medium containing antibiotics is replaced, and the cells are incubated for another 48 hours.

[0102] Then the transfection efficiency is detected by real-time fluorescent quantitative polymerase chain reaction. The appropriate JunB transcription factor for knocking down is obtained by qRT-PCR, and a stable JunB knockdown cell model is successfully constructed.

[0103] The forward sequence of the small interference RNA (si-RNA1) is shown in SEQ ID NO. 1, which is GGAACAGCCUUUCUAUCACCTT, and the reverse sequence is shown in SEQ ID NO. 2, which is GUGAUAGAAAGGCUGUUCCTT. The forward sequence of the small interference RNA (si-RNA2) is shown in SEQ ID NO. 3, which is AUCAGACACAGGCGCAUCUTT, and the reverse sequence is shown in SEQ ID NO. 4, which is AGAUGCGCCUGUGUCUGAUTT. The forward sequence of the small interference RNA (si-RNA3) is shown in SEQ ID NO. 5, which is ACCAUCAGCUACCUCCCACTT, and the reverse sequence is shown in SEQ ID NO. 6, which is GUGGGAGGUAGCUGAUGGUTT.

[0104] 1. Transfection of overexpression plasmid The liver cells in the logarithmic growth phase were trypsinized, 8 mL of complete culture medium was added, the cells were gently blown and shaken to prepare a suspension, and 500 μL was inoculated in a 24-well plate overnight. When the cells grew to 70%, the JunB overexpression plasmid was diluted in serum-free culture medium to the required concentration (usually 1-2 μg / well, which needs to be optimized by pre-experiment), and the Invitrogen INVI DNA RNA transfection reagent was diluted in another tube of serum-free culture medium according to the proportion (the recommended ratio of plasmid mass to INVI reagent volume is 1 μg: 2-3 μL, please refer to the instruction), the diluted plasmid and INVI reagent were gently mixed, and the transfection complex was formed after standing at room temperature for 15 minutes. The complex was added dropwise to the cell culture dish, and was mixed gently. After transfection for 24 hours, the complete culture medium containing antibiotics was replaced, and the culture was continued for 48 hours to realize JunB overexpression.

[0105] Then the transfection efficiency was detected by real-time fluorescent quantitative polymerase chain reaction. The overexpression of JunB was verified by qRT-PCR, and a stable JunB overexpression cell model was successfully constructed.

[0106] The JunB overexpression plasmid was synthesized by Xi'an Genecarer Company, and the vector construction is as shown in Figure 6 .

[0107] Five, real-time fluorescent quantitative polymerase chain reaction, abbreviated as qRT-PCR 1. Extraction of total RNA in liver cells (1) Preparation: Place the required items for extracting RNA in the ultraviolet irradiated ultraclean bench according to the instruction.

[0108] (2) Sample lysis: After the cell culture solution was transfected with plasmid, it was cultured at 37°C under 5% CO2 for 72 hours. After adding the prepared lysis solution, it was lysed at 37°C for 5 min.

[0109] (3) Put it into the pre-cooled centrifuge at 12000 rpm / min for 5 min, and then move it to the workbench. Transfer the supernatant to the new enzyme-free EP tube prepared in advance.

[0110] (4) Add 200 μL of chloroform to the sample. After vortexing and shaking for 30 s, stand still in the workbench for 3 min. After centrifugation at 4°C for 10 min, the sample is divided into three layers: organic layer, middle layer and aqueous phase. RNA mainly accumulates in the aqueous phase. 450 μL of colorless aqueous phase is transferred to a new EP tube.

[0111] (5) Add 225 μL of anhydrous ethanol to the EP tube and mix well by inverting. Transfer the mixed liquid to the labeled absorption column and centrifuge at 4°C at 12000 rpm / min for 30 s.

[0112] (6) Discard the liquid in the collection tube and add 500 μL of deproteinization eluent RD to the absorption column. Centrifuge at 4°C at 12000 rpm for 30 s.

[0113] (7) Discard the liquid in the collection tube and add 500 μL of rinse solution RW to the absorption column. Place it in the workbench for 2 min, then centrifuge at 4°C at 12000 rpm / min for 30 s. Repeat this step twice.

[0114] (8) After discarding the waste liquid, centrifuge at 4°C at 12000 rpm / min for 2 min. After centrifugation, suck out the residual liquid.

[0115] (9) In the clean bench, the absorption column is placed for 10 min and dried thoroughly. Finally, it is moved to the labeled RNase-free EP tube, 40 μL of RNase-free ddH2O is added, and it is placed at room temperature for 2 min. Centrifuge at 4°C at 12000 rpm / min for 30 s to collect the RNA. Use a spectrophotometer to detect the RNA concentration. Store it in a -80°C refrigerator for long-term preservation.

[0116] 2. Reverse transcription (1) After preparing the RNA, if the RNA stored at -80°C is extracted in advance, it is placed on ice, melted and the RNA concentration is measured again. The reverse transcription system for each sample is configured, as shown in Table 2.

[0117] Table 2 Reverse transcription system (2) The prepared reverse transcription system is oscillated and mixed, and bubbles are removed. Reverse transcription is performed according to the conditions in Table 3. Table 3 Reverse transcription conditions (3) After the reaction of reverse transcription of RNA into cDNA is completed, the sample is collected and stored in a refrigerator at -20°C.

[0118] 3. PCR reaction (1) The reagents required in the PCR reaction are prepared according to the following table. The eight continuous rows are placed on a pre-cooled constant temperature module to prepare the reaction solution, and the details are shown in Table 4.

[0119] Table 4. Reaction system (2) The reaction solution is added to each eight continuous row tube, and after slight oscillation and mixing without bubbles, PCR amplification is performed, and the program is shown in Table 5.

[0120] Table 5. Amplification program (3) The relative expression amount of the target gene hsa_CLNS1A_2 is calculated by 2-Ct method.

[0121] (4) The RNA is reverse transcribed into cDNA according to the reverse transcription steps described above.

[0122] (5) The expression of JunB is detected by qRT-PCR experiment.

[0123] In the present application, specific primers are used to amplify the JunB and GAPDH genes. The JunB primer sequence is as follows: the forward primer sequence is shown in SEQ ID NO. 7, which is TCACGACGACTCTTACGCAG, 20 bases in length, the melting temperature (Tm) is 61.6°C, and the position in the target sequence is 30-49. The reverse primer sequence is shown in SEQ ID NO. 8, which is CCTTGAGACCCCGATAGGGA, 20 bases in length, the melting temperature (Tm) is 62.0°C, and the position in the target sequence is 154-135. The primer pair has an ID of 326693921c1 in the PrimerBank database, and the fragment size of the amplification product is 125 base pairs.

[0124] The GAPDH primer sequence is as follows: the forward primer sequence is shown as SEQ ID NO. 9, AGGTCGGTGTGAACGGATTTG, 21 bases in length, a melting temperature (Tm) of 62.6°C, and a position in the target sequence of 8-28; the reverse primer sequence is shown as SEQ ID NO. 10, GGGGTCGTTGATGGCAACA, 19 bases in length, a melting temperature (Tm) of 62.6°C, and a position in the target sequence of 102-84. The primer pair has an ID of 126012538c1 in the PrimerBank database, and the amplified product has a fragment size of 95 base pairs.

[0125] 5. Western blot experiment detects pyroptosis related indicators α-smooth muscle actin (α-SMA), collagen type I (Collagen I), collagen type III (Collagen III) and JunB.

[0126] (1) Protein extraction: a. Mouse liver cells: after the cells are taken out from the intercellular space, they are placed on ice to prevent protein degradation, washed with PBS, and the adherent cells are scraped into PBS liquid with a cell scraper, then transferred to an EP tube with a pipette gun, centrifuged at 4°C, 5000 rpm for 5 min, and the supernatant is discarded.

[0127] (2) Preparation of protein lysis solution, as shown in Table 6.

[0128] Table 6. Preparation of protein lysis solution (3) Protein extraction: 0.5 mL of lysis solution was added to each EP tube, vortexed vigorously for 30 sec, and placed for 4 min, repeated 5 times. After the last operation, centrifuged at 4°C, 12000 rpm for 5 min, and the supernatant was transferred to a new centrifuge tube. The protein concentration was detected, loading Buffer was added, and the protein solution:loading Buffer=4:1, 99°C metal bath boiled for 5 min. After cooling to room temperature, it was transferred to a-20°C refrigerator for later use.

[0129] (4) The electrophoresis solution, electrotransfer solution, PBST, blocking solution and luminescence solution need to be prepared during the WB process. The specific preparation scheme is as follows.

[0130] (5) SDS-polyacrylamide gel electrophoresis, abbreviated as SDS-PAGE: prepare 10% gel in advance, mark the experimental group, set the voltage to 80V; cut the PVDF membrane and mark it for later use, soak the PVDF membrane in 100% anhydrous ethanol for 5 minutes 5 minutes before the end of electrophoresis. After electrophoresis, cut the gel and transfer the membrane, avoid bubbles between the gel and the PVDF membrane, keep the gel / membrane in a wet state, clamp it with a clamp and put it in a membrane transfer tank filled with transfer liquid, set 0.3A, 90min.

[0131] (6) Blocking: prepare the blocking solution in advance and mix well on the shaker, after the transfer is completed, put the membrane into the blocking solution and incubate on the shaker at room temperature for 2 hours.

[0132] (7) Primary antibody incubation: after blocking is completed, wash with PBST for 3 times, 10min / time, dilute the primary antibody with antibody diluent or PBST, put the membrane into the primary antibody incubation box and incubate at 4°C overnight. It should be noted that diluting the primary antibody with PBST is not suitable for phosphorylated proteins.

[0133] (8) Secondary antibody incubation: the next day, wash the membrane with PBST for 3 times, 10min / time, add the secondary antibody and incubate at room temperature for 2 hours.

[0134] (9) Exposure: soak the membrane incubated with the secondary antibody in the luminescent solution, take out the membrane and absorb the luminescent solution with absorbent paper after a short period of time, put it into the gel imager and adjust the parameters for exposure, collect the data for further analysis.

[0135] Six, statistical methods Prism 8.0 and, the measurement data is represented by mean ± standard deviation, the comparison between two groups uses independent sample t test, the comparison among multiple groups uses one-way analysis of variance, and the comparison between groups uses Student-Newman-Keuls test; the count data is represented by number or percentage, the comparison between two groups uses chi-square (χ2) test. P P<0.05 is considered statistically significant.

[0136] Seven, results 1. Analysis of NC group and HMD group section staining The immunohistochemical staining showed that the area of Collagen I positive region (brown precipitate) in the HMD group was significantly larger than that in the NC group. In the NC group, Collagen I was only sporadically distributed, and the positive area accounted for less than 15%; while in the HMD group, it showed extensive diffuse staining, and the positive signal covered a larger field of view than the NC group. Quantitative image analysis showed that the ratio of Collagen I positive area in the HMD group was higher than that in the NC group; Collagen III showed strong positive expression in the HMD group, mainly distributed in the perivascular and interstitial space. Compared with the weak staining (positive rate <10%) in the NC group, the HMD group showed large brown staining areas, and the positive signal was significantly enhanced. Quantitative statistics showed that the ratio of Collagen III positive area in the HMD group was higher than that in the NC group; α-SMA, as a marker of myofibroblasts, showed dense punctate distribution in the HMD group, and the number of positive cells was significantly increased compared with the NC group. In the NC group, only a small amount of scattered positive signal was observed (mainly in the blood vessel wall), while in the HMD group, a large number of positive cell clusters appeared in the interstitial area. Quantitative results showed that the ratio of α-SMA positive area in the HMD group was higher than that in the NC group; JunB expression was abnormally enhanced, and JunB protein showed strong positive reaction in the HMD group, with a higher proportion of positive nuclei than the NC group. The proportion of deeply stained (brown) nuclei in the HMD group increased significantly, indicating increased JunB expression in the HMD group. Quantitative analysis confirmed that the ratio of JunB positive area was higher than that in the NC group, and the column chart showed a very significant difference; HE staining showed that the liver lobule structure in the NC group was complete, and the hepatocyte cords were arranged in a radial pattern, with clear central vein structure. While in the HMD group, typical pseudolobule formation occurred, with disordered arrangement of hepatocytes, local inflammatory cell infiltration, and complete destruction of normal tissue structure. Vacuolar degeneration and karyopyknosis of hepatocytes were also observed; Masson's trichrome staining showed that collagen fibers in the NC group were only distributed around blood vessels, while in the HMD group, a large number of blue collagen bundles appeared, and the collagen area increased significantly. Quantitative analysis confirmed that the percentage of collagen fibers was significantly higher than that in the NC group, and the column chart showed a very significant difference. Figure 1

[0137] 2、Cell experiment to verify the promoting effect of Hcy on liver fibrosis ​Western blot analysis showed that after treatment with homocysteine (Hcy), the expression of fibrosis core markers was significantly enhanced: in the Collagen I detection, the gray value of the band of the Hcy treatment group was significantly deeper than that of the Con group, the loading consistency was verified by the internal reference of β-actin, and the quantitative statistics showed that the expression of the Hcy group was significantly increased; Collagen III also showed an upward trend, and its band signal intensity was significantly enhanced in the Hcy group; the expression change of α-SMA was particularly significant, the band width and staining depth of the Hcy group were significantly higher than those of the control group, and the quantitative analysis confirmed that the difference reached a very significant level, which suggested that Hcy activated the collagen synthesis and myofibroblast transformation mechanism synergistically, among which α-SMA, as a marker of myofibroblast activation, had the largest increase in amplitude, and its up-regulation was higher than that of Collagen I / III, which systematically confirmed the core driving role of Hcy in extracellular matrix remodeling and myofibroblast activation. As shown in Figure 2 .

[0138] 3. qRT-PCR verifies the efficiency of knocking down JunB and verifies the effect of knocking down JunB on liver tissue fibrosis at the cell level qRT-PCR analysis showed that homocysteine (Hcy) treatment significantly up-regulated the expression level of JunB mRNA. Compared with the control group (Con), the expression of JunB mRNA in the Hcy group was significantly increased, indicating that Hcy activated JunB gene at the transcriptional level. Further detection of the regulatory effect of three inhibitors (si-JunB1, si-JunB2 and si-JunB3) on JunB expression found that: the expression of JunB in the si-JunB1 inhibitor group was significantly lower than that in the Con group, the si-JunB2 and si-JunB3 groups showed abnormal activation, and the expression of JunB was significantly higher than that in the Con group, and was significantly higher than that in the si-JunB1 group, the si-JunB1 group had a significant knockdown effect on JunB, and a JunB knockdown cell model was successfully constructed, while the si-JunB2 and si-JunB3 inhibitors may enhance the transcriptional activity of JunB through a feedback mechanism. Western blot analysis revealed the downstream mechanism: the expression of extracellular matrix Collagen I, Collagen III was significantly reduced in the si-JunB interference group compared with the si-nc control group, and the expression of myofibroblast marker α-SMA was also attenuated. The signal intensity of Collagen I, Collagen III and α-SMA in the Con group was significantly higher than that in the si-junB group, and β-Actin was used as an internal reference, which fully proved that JunB silencing could simultaneously inhibit collagen synthesis and cell transdifferentiation. As shown in Figure 3 .

[0139] 4. The effect of overexpression of JunB on liver tissue fibrosis in cell experiments Adenovirus-mediated JunB overexpression (ad-JunB) system was verified by transcription-protein double verification to significantly promote the fibrosis pathway. The qRT-PCR detection showed that the JunB mRNA expression of the ad-JunB treatment group was significantly higher than that of the empty control group, and the overexpression model was successfully constructed to lay the foundation for the downstream mechanism research. Western blot analysis showed the expression changes of key extracellular matrix components: the signal intensity of Collagen I, Collagen III and a-SMA in the ad-JunB group was significantly higher than that in the ad-nc group (ad-nc group was the JunB non-overexpression group), and β-Actin as an internal reference showed equal loading; quantitative analysis further verified that the Collagen I protein level in the ad-JunB group was significantly higher than that in the ad-nc group, a-SMA was significantly enhanced, and Collagen III also showed a significant increasing trend. The comprehensive results can prove that: JunB overexpression promotes the remodeling of extracellular matrix and the transdifferentiation of myofibroblasts by synergistically enhancing the synthesis of Collagen I / III and the expression of a-SMA. Figure 4 As shown in FIG. 5.

[0140] 5. Cell experiment verifies that knocking down JunB has an inhibitory effect on Hcy-induced liver tissue fibrosis Western blot protein spectrum analysis revealed the dynamic changes of collagen synthesis markers under four treatment conditions: group 1 (untreated control group) Collagen I, Collagen III and a-SMA showed basic expression; the intensity of each protein band in group 2 (si-JunB group) was lower than that in group 1; the target protein signal in group 3 (Hcy group) was significantly enhanced; the expression of each protein in group 4 (Hcy+si-JunB group) was significantly lower than that in group 3 (Hcy group), and the uniformity of β-Actin internal reference band confirmed the reliability of loading; further gray quantitative statistical analysis found that the expression of Collagen I in the Hcy stimulation group (simulated pathological state) was significantly higher than that in the control group; and the expression of Collagen I in the JunB interference group (si-JunB) was significantly reduced; and in the subsequent results, it can be seen that the Hcy+si-JunB group significantly reversed the Hcy induction effect; the comprehensive results show that: JunB overexpression drives the fibrosis process by positively regulating the synthesis of Collagen I / III and the activation of a-SMA, and specific silencing of JunB can significantly reverse the pathological phenotype, confirming that JunB is a key target for fibrosis treatment. As shown in FIG. 6. Figure 5 As shown in FIG. 6.

[0141] Any combination of the technical features in the above-described embodiments can be made, and for the sake of brevity, not all possible combinations are described, however, as long as the combination of the technical features does not exist in contradiction, it shall be considered within the scope of the present disclosure.

[0142] The above-described embodiments only express several implementation manners of the present application, and the description is relatively specific and detailed, but it shall not be understood as a limitation on the patent scope of the present application. For ordinary skilled persons in the art, several modifications and improvements can be made without departing from the concept of the present application, and these shall all belong to the protection scope of the present application. Therefore, the protection scope of the patent of the present application shall be subject to the appended claims.

Claims

1. Use of an agent for targeted inhibition of a JunB gene in the preparation of a medicament for treating non-alcoholic fatty liver disease.

2. Use according to claim 1, characterized in that, The agent comprises an interfering vector for targeted inhibition of a JunB gene.

3. Use according to claim 2, characterized in that, The interfering vector is an siRNA interfering vector for the JunB gene; the forward sequence of the siRNA is shown as SEQ ID NO. 1, and the reverse sequence is shown as SEQ ID NO.

2.

4. Use according to claim 1, characterized in that, The agent for targeted inhibition of a JunB gene further comprises a transfection aid.

5. Use according to claim 4, characterized in that, The transfection aid is Lipofectamine 2000.

6. Use according to claim 1, characterized in that, The medicament comprises the agent for targeted inhibition of a JunB gene as the only active ingredient.

7. The use according to claim 1, characterized in that, The medicament further comprises a pharmaceutically acceptable excipient.

8. Use according to claim 7, characterized in that, The pharmaceutically acceptable excipient is one or more of a diluent, a disintegrant, a precipitation inhibitor, a glidant, a binder, a dispersant, a suspending agent, an isotonic agent, a thickening agent, an emulsifying agent, a preservative, and a stabilizer.

9. The use according to claim 1, characterized in that, The acceptable dosage form of the medicament comprises a tablet, a capsule, a granule, an injection, a pill, a powder, or a paste.

Images