Application of ACA49 overexpression reagent and / or SOX9 expression inhibitor in preparation of liver cancer treatment medicine

Abstract

The invention belongs to the technical field of biomedical treatment, and particularly relates to application of an ACA49 overexpression reagent and / or an SOX9 expression inhibitor in preparation of a medicine for treating liver cancer. Experimental verification shows that when the ACA49 overexpression reagent and / or the SOX9 expression inhibitor is injected into a liver cancer cell tumor mouse, the quantity of liver cancer tumor cells of the mouse and the growth of the tumor can be remarkably inhibited, and the ACA49 overexpression reagent and / or the SOX9 expression inhibitor have no obvious influence on visceral organs of the mouse and are high in safety.

Description

Technical Field

[0001] This invention belongs to the field of biomedical technology, specifically relating to the application of ACA49 overexpression reagents and / or SOX9 expression inhibitors in the preparation of drugs for treating liver cancer. Background Technology

[0002] Liver cancer is one of the most common malignant tumors worldwide. Based on its origin, it can be divided into two main categories: primary liver cancer and secondary liver cancer. Primary liver cancer accounts for over 90% of all cases and mainly includes three pathological types: hepatocellular carcinoma (HCC), intrahepatic cholangiocarcinoma (ICC), and mixed-type liver cancer. Among all liver cancer cases, hepatocellular carcinoma (HCC) is the most prevalent subtype, accounting for approximately 70%–90% of primary liver cancers. Its pathogenesis is closely related to chronic liver damage, regeneration and repair, and malignant transformation of cells.

[0003] According to global cancer statistics, there are more than 900,000 new cases of liver cancer every year, with about 830,000 deaths. It ranks sixth in incidence among all malignant tumors and third in mortality. Moreover, the incidence rate has been rising at an average annual rate of 2.3% over the past decade, seriously threatening public health and safety.

[0004] Therefore, it is necessary to develop a drug that can treat liver cancer. Summary of the Invention

[0005] Based on this, the present invention has discovered and verified that overexpressing ACA49 or inhibiting SOX9 expression can achieve the purpose of treating liver cancer. Therefore, ACA49 overexpression reagents and / or SOX9 expression inhibitors can be used in the preparation of drugs for treating liver cancer.

[0006] To achieve the above objectives, the present invention can adopt the following technical solutions: In one aspect, this invention provides the application of an ACA49 overexpression reagent and / or a SOX9 expression inhibitor in the preparation of drugs for treating liver cancer.

[0007] Preferably, in the above applications, the ACA49 overexpression reagent is a lentiviral particle carrying ACA49 and / or an adeno-associated virus particle carrying ACA49 and / or a lipid nanoparticle loaded with ACA49; or the SOX9 expression inhibitor is a lentiviral particle carrying SOX9ASO and / or an adeno-associated virus particle carrying SOX9 ASO and / or a lipid nanoparticle loaded with SOX9 ASO.

[0008] More preferably, in the above applications, the lipid nanoparticles loaded with ACA49 or SOX9 ASO include SM-102, cholesterol, 1,2-distearate-sn-glycerol-3-phosphocholine and PEG2000-DMG.

[0009] More preferably, in the above applications, the molar ratio of SM-102, cholesterol, 1,2-distearate-sn-glycerol-3-phosphocholine and PEG2000-DMG is 50:10:38.5:1.5.

[0010] Preferably, in the above applications, lentiviral particles carrying ACA49 or carrying SOX9 ASO are obtained by cloning ACA49 or SOX9 ASO into the pLVX-IRES-Puro plasmid and then co-transfecting it into tool cells with packaging plasmids pMD2.G and psPAX2; or adeno-associated virus particles carrying ACA49 or carrying SOX9 ASO are obtained by cloning ACA49 or SOX9 ASO into the AAV-TBG plasmid and then co-transfecting it into tool cells with pHelper and pAnc plasmids.

[0011] Preferably, in the above applications, the nucleotide sequence of SOX9 ASO is as follows: TTCTTGTGCTGCTCGCGCAG or UUCUUGUGCUGCUCGCGCAG.

[0012] More preferably, in the above applications, the nucleotide sequence of SOX9 ASO is: mUmUmCmUmU*G*U*G*C*U*G*C*U*C*GmCmGmCmAmG.

[0013] Another aspect of the present invention provides a hepatocellular carcinoma treatment pharmaceutical composition comprising an ACA49 overexpression reagent and a SOX9 expression inhibitor.

[0014] Preferably, in the above-mentioned hepatocellular carcinoma therapeutic drug composition, the ACA49 overexpression agent is a lentiviral particle carrying ACA49 and / or an adeno-associated virus particle carrying ACA49 and / or a lipid nanoparticle loaded with ACA49; or the SOX9 expression inhibitor is a lentiviral particle carrying SOX9 ASO and / or an adeno-associated virus particle carrying SOX9 ASO and / or a lipid nanoparticle loaded with SOX9 ASO.

[0015] In another aspect, the present invention provides a liver cancer treatment drug, which includes the liver cancer treatment drug composition of the present invention and a pharmaceutically acceptable carrier.

[0016] The beneficial effects of this invention include: (1) Through the experimental verification of this invention, it can be found that injecting ACA49 overexpression reagents (such as lentivirus particles carrying ACA49 and / or adeno-associated virus particles carrying ACA49 and / or lipid nanoparticles loaded with ACA49) into mice with liver cancer cells can significantly inhibit the number of liver cancer cells and the growth of tumors in mice, and has no significant effect on the organs of mice, and is highly safe. (2) Through experimental verification, this invention shows that injecting SOX9 expression inhibitors (such as lentiviral particles carrying SOX9 ASO and / or adeno-associated virus particles carrying SOX9 ASO and / or lipid nanoparticles loaded with SOX9 ASO) into mice with liver cancer cells can significantly inhibit the number of liver cancer cells and the growth of tumors in mice, and has no significant effect on the organs of mice, with high safety. (3) Through the experimental verification of this invention, it can be found that the simultaneous application of ACA49 overexpression reagent and SOX9 expression inhibitor to liver cancer cells in mice can achieve a synergistic therapeutic effect on liver cancer, and its inhibitory effect on tumor growth is better than that of a single ACA49 overexpression reagent or a single SOX9 expression inhibitor. Attached Figure Description

[0017] Figure 1 Microscopic images showing the inhibition of hepatocellular carcinoma globulin formation by overexpression of ACA49; Figure 2 Statistical data on the inhibition of hepatocellular carcinoma globulin formation by overexpression of ACA49; Figure 3 Overexpression of ACA49 inhibits the in vitro proliferation of liver cancer cells; Figure 4 Limit dilution experiments revealed that overexpression of ACA49 reduced the proportion of liver cancer stem cells; Figure 5 The overexpression of ACA49 inhibits the growth of subcutaneous tumors in mice; Figure 6 Overexpression of ACA49 inhibits the growth of in situ liver tumors in mice; Figure 7 This is a schematic diagram illustrating the use of adeno-associated virus to specifically overexpress ACA49 in mouse liver. Figure 8 Photograph of the liver of a mouse overexpressing ACA49; Figure 9 HE pathological sections of mice overexpressing ACA49; Figure 10 Statistics on the number of tumors in mice overexpressing ACA49; Figure 11The statistical results of liver weight ratio in ACA49-overexpressing mice; Figure 12 This is a schematic diagram of adeno-associated virus-mediated overexpression of ACA49 and knockdown of SOX9 in mouse liver. Figure 13 Image of mouse liver after adeno-associated virus-mediated overexpression of ACA49 and knockdown of SOX9; Figure 14 The statistics show the number of tumors in mice after adeno-associated virus-mediated overexpression of ACA49 and knockdown of SOX9 in the liver. Figure 15 This study examines the ability of mouse liver tumors to form subcutaneous tumors after isolation following adeno-associated virus-mediated overexpression of ACA49 and knockdown of SOX9. Figure 16 The expression levels of LNP-wrapped ACA49 RNA and SOX9 ASO; Figure 17 Representative images (left) and statistical results (right) of Huh7 cell microspheres formed by LNP treatment; Figure 18 To assess the delivery efficiency and silencing effect of LNP administration in the HTVI model; Figure 19 Delivery and targeting efficiency of LNP administration in the PDC model; Figure 20 A schematic diagram of the experimental procedure for treating mouse liver cancer with LNP-wrapped ACA49 RNA and SOX9 ASO. Figure 21 Representative images of the livers of mice in different groups treated with LNP-encapsulated ACA49 RNA and SOX9 ASO in mouse hepatocellular carcinoma. Figure 22 HE staining of liver pathological sections from mice in different groups treated with hepatocellular carcinoma, using LNP-encapsulated ACA49 RNA and SOX9 ASO. Figure 23 The statistical analysis of the number of liver tumors in mice in each group during the treatment of liver cancer by LNP-encapsulated ACA49 RNA and SOX9 ASO. Figure 24 Survival rates of mice in different groups treated with LNP-encapsulated ACA49 RNA and SOX9 ASO in the treatment of liver cancer. Figure 25 A schematic diagram illustrating the effect of targeting human ACA49 and SOX9 in immunodeficient mice using a patient-derived liver cancer (PDC) model. Figure 26The synergistic effect of LNP-encapsulated human ACA49 RNA and SOX9 ASO in the treatment of hepatocellular carcinoma in a PDC model; Figure 27 The morphology of the liver, kidney, and spleen in LNP-treated and control mice; Figure 28 The morphology (D) of the liver, kidney, and spleen, as well as body weight, organ weight, and liver IFN-γ and IL-2 expression levels of mice in the LNP-treated group and control group were measured. Detailed Implementation

[0018] The embodiments described are provided to better illustrate the present invention, but are not intended to limit the scope of the invention to the embodiments described. Therefore, non-essential improvements and adjustments made to the embodiments by those skilled in the art based on the above description are still within the scope of protection of the present invention.

[0019] The terminology used herein is for the purpose of describing particular embodiments only and is not intended to limit this disclosure. Singular expressions include plural expressions unless they have a distinctly different meaning in the context. As used herein, it should be understood that terms such as “comprising,” “having,” “including,” are intended to indicate the presence of features, numbers, operations, components, parts, elements, materials, or combinations thereof. The terminology of the invention is disclosed in the specification and is not intended to exclude the possibility that one or more other features, numbers, operations, components, parts, elements, materials, or combinations thereof may be present or added. As used herein, “ / ” may be interpreted as “and” or “or,” depending on the context.

[0020] In a first aspect, embodiments of the present invention provide the application of an ACA49 overexpression reagent and / or a SOX9 expression inhibitor in the preparation of a drug for treating liver cancer.

[0021] It should be noted that this invention was verified in vitro and in vivo. Overexpression of ACA49 or inhibition of SOX9 expression can inhibit the proliferation of liver cancer cells in vitro and inhibit the growth of liver cancer tumors in vivo. Therefore, ACA49 overexpression reagents and / or SOX9 expression inhibitors can be used in the preparation of liver cancer therapeutic drugs.

[0022] It should also be noted that ACA49, also known as Snora49, is a small nucleolar RNA (snoRNA). The ACA49 used in this invention can be of human origin or other animal origin, such as mouse origin. The nucleotide sequence of human ACA49 is shown in SEQ ID NO: 1, as follows: CTTCCTCAGCCTTACTCCAGGGACTTTTTGTTGCCTGTAAAGTGCTCTGGCATTGCCTGAGGATAGATGAGAAAGCACATATCCCTCCCCAGTAAGACGCTGTTTTCTTTTGGGGCCTACAAGTTGAGCTGACAGTA; The nucleotide sequence of mouse-derived ACA49 is shown in SEQ ID NO: 2, as follows: CTTCCTCAGCCTTACTCCAGGGGCTTCTTGCCTGTAGAGTGCCCTGGCATTGCCTGAGGATAGAGGAGAAAGCACAGCTCCCTCCCTAGCAAGACTCTGCTTTCTTGTGGGGCCTACAGATTGGGCTGACAGC.

[0023] Specifically, small nucleolar RNAs (snoRNAs) are a class of non-coding RNAs ranging from 60 to 300 nucleotides in length, initially discovered in the nucleolus. They are mainly divided into two categories: H / ACA box snoRNAs (snoRAs) and C / D box snoRNAs (snoRDs). Traditionally, snoRNAs guide 2'-O-methylation or pseudouridineation of ribosomal RNA (rRNA) through complementary base pairing. Initially thought to be localized only in the nucleolus and having limited functions, snoRNAs did not attract widespread attention in cancer research. However, with the advent of whole-genome deep sequencing technology, more and more studies have discovered a variety of novel snoRNAs, widely expressed in different types of cancer, possessing new functions beyond nucleolar localization and rRNA modification; for example, snoRD50A and snoRD50B are specifically located in the cytoplasm, and their deletion leads to overactivation of the Ras-ERK signaling pathway in melanoma, ovarian cancer, and lung cancer. Furthermore, SNORD27 binds to E2F7 pre-mRNA in the cell nucleus, regulating E2F7 alternative splicing. E2F7 is a transcriptional repressor of cell cycle regulatory genes and is often dysregulated in many malignant tumors. In HCC, upregulation of SNORD17 promotes cell growth and tumorigenesis by inhibiting p53-mediated cell cycle arrest and apoptosis. Additionally, SOX9 is well-known in the field as SRY-box transcription factor 9.

[0024] In some specific examples, in the above applications, the ACA49 overexpression reagent is a lentiviral particle carrying ACA49 and / or an adeno-associated virus particle carrying ACA49 and / or lipid nanoparticles loaded with ACA49.

[0025] It should be noted that the ACA49 overexpression reagent in this invention is well known in the art, and the lentiviral particles, adeno-associated virus particles, or lipid nanoparticles listed above can be selected as expression vectors to enable ACA49 overexpression.

[0026] In some specific examples, in the above applications, lentiviral particles carrying ACA49 are obtained by cloning ACA49 or SOX9ASO into the pLVX-IRES-Puro plasmid and then co-transfecting it with the packaging plasmids pMD2.G and psPAX2 into tool cells.

[0027] It should be noted that the method of obtaining the lentiviral particles carrying ACA49 in this invention is well known in the art. The above-mentioned method is preferred. The lentiviral particles carrying ACA49 obtained above have been experimentally verified to significantly inhibit tumor growth in mice with tumors and have high safety.

[0028] In some specific examples, in the above applications, adeno-associated virus particles carrying ACA49 were obtained by cloning the sequence of ACA499 or SOX9 ASO into the AAV-TBG plasmid, and then co-transfecting it into tool cells with the pHelper and pAnc plasmids.

[0029] It should be noted that the adeno-associated virus particles carrying ACA49 in this invention are well known in the art. The above-described method of obtaining them is preferred. Experimental verification shows that the adeno-associated virus particles carrying ACA49 obtained above can significantly inhibit tumor growth in mice with tumors and have high safety.

[0030] In some specific examples, in the above applications, the lipid nanoparticles loaded with ACA49 include SM-102 (a cationic lipid), cholesterol, 1,2-distearate-sn-glycerol-3-phosphocholine (DSPC), and PEG2000-DMG.

[0031] It should be noted that the lipid nanoparticles loaded with ACA49 in this invention are known in the art, and lipid nanoparticles composed of the above-mentioned components are preferred; in addition, it should be understood that the preparation method of the lipid nanoparticles in this invention is known in the art.

[0032] In some specific examples, in the above applications, the molar ratio of SM-102, cholesterol, 1,2-distearate-sn-glycerol-3-phosphocholine and PEG2000-DMG is 50:10:38.5:1.5.

[0033] It should be noted that the components of the lipid nanoparticles in this invention can preferably be the components listed above. The lipid nanoparticles loaded with ACA49 prepared from the components listed above have been experimentally verified to significantly inhibit tumor growth in mice with tumors and have high safety.

[0034] In some specific examples, in the above applications, the SOX9 expression inhibitor is a lentiviral particle carrying SOX9 ASO and / or an adeno-associated virus particle carrying SOX9 ASO and / or a lipid nanoparticle loaded with SOX9 ASO.

[0035] It should be noted that the SOX9 expression inhibitor in this invention is well known in the art. Lentiviral particles, adeno-associated virus particles, or lipid nanoparticles listed above can be selected as expression vectors to load SOX9 ASO, thereby achieving SOX9 expression. Furthermore, it should be understood that "SOX9 ASO" is a well-known ASO sequence targeting SOX9, i.e., an antisense oligonucleotide sequence targeting SOX9.

[0036] In some specific examples, in the above applications, the nucleotide sequence of SOX9 ASO is as follows: TTCTTGTGCTGCTCGCGCAG (SEQ ID NO: 3) or UUCUUGUGCUGCUCGCGCAG (SEQ ID NO: 4).

[0037] It should be noted that SEQ ID NO:4 is the RNA sequence transcribed from SEQ ID NO:3.

[0038] In some specific examples, in the above applications, the nucleotide sequence of SOX9 ASO is: mUmUmCmUmU*G*U*G*C*U*G*C*U*C*GmCmGmCmAmG.

[0039] It should be noted that the nucleotide sequence of the SOX9 ASO mentioned above is the sequence modified as shown in SEQ ID NO:4, where "m" refers to 2'-O-methyl modification and "*" refers to thiophosphate bond modification.

[0040] In some specific examples, in the above applications, the lentiviral particles carrying SOX9 ASO were obtained by cloning SOX9 ASO into the pLVX-IRES-Puro plasmid and then co-transfecting it with the packaging plasmids pMD2.G and psPAX2 into tool cells.

[0041] It should be noted that the lentivirus particles carrying SOX9 ASO in this invention are well known in the art, and the above-described method of obtaining them is preferred.

[0042] In some specific examples, in the above applications, adeno-associated virus particles carrying SOX9 ASO were obtained by cloning SOX9 ASO into the AAV-TBG plasmid and then co-transfecting it into tool cells with the pHelper and pAnc plasmids.

[0043] It should be noted that the adeno-associated virus particles carrying SOX9 ASO in this invention are well known in the art. The above-described method of obtaining them is preferred. Experimental verification shows that the adeno-associated virus particles carrying SOX9 ASO obtained above can significantly inhibit tumor growth in mice with tumors and have high safety.

[0044] In some specific examples, such as the applications described above, the lipid nanoparticles loaded with SOX9 ASO include SM-102, cholesterol, 1,2-distearate-sn-glycerol-3-phosphocholine, and PEG2000-DMG.

[0045] It should be noted that the lipid nanoparticles loaded with SOX9 ASO in this invention are known in the art, and lipid nanoparticles composed of the above-mentioned components are preferred; in addition, it should be understood that the preparation method of the lipid nanoparticles in this invention is known in the art.

[0046] In some specific examples, in the above applications, the molar ratio of SM-102, cholesterol, 1,2-distearate-sn-glycerol-3-phosphocholine and PEG2000-DMG is 50:10:38.5:1.5.

[0047] It should be noted that the components of the lipid nanoparticles in this invention can preferably be the components listed above. The lipid nanoparticles loaded with SOX9 ASO prepared from the components listed above have been experimentally verified to significantly inhibit tumor growth in mice with tumors and have high safety.

[0048] Secondly, embodiments of the present invention provide a liver cancer treatment drug composition comprising an ACA49 overexpression reagent and a SOX9 expression inhibitor.

[0049] It should be noted that the ACA49 overexpression reagent and SOX9 expression inhibitor in this invention can work synergistically to treat liver cancer and improve the treatment effect. Furthermore, the "ACA49 overexpression reagent" and "SOX9 expression inhibitor" in the above-mentioned liver cancer treatment drug composition are the same as those listed in the above applications.

[0050] Thirdly, embodiments of the present invention provide a liver cancer treatment drug, which includes the liver cancer treatment drug composition of the present invention and a pharmaceutically acceptable carrier.

[0051] It should be noted that, as described above, the ACA49 overexpression reagent and SOX9 expression inhibitor in this invention can synergistically treat liver cancer. They can be combined with a pharmaceutically acceptable carrier to prepare a liver cancer treatment drug. The pharmaceutically acceptable carrier is a pharmaceutically acceptable carrier known in the art that can prepare drug compositions into different dosage forms of drugs, generally a buffer solution or other reagent for preparing injectable preparations.

[0052] To better understand the present invention, specific examples are provided below to further illustrate the content of the present invention, but the content of the present invention is not limited to the examples below.

[0053] Example 1 In this embodiment of the invention, the in vitro inhibitory effect of ACA49 on liver cancer cells was tested by constructing lentiviral particles carrying ACA49.

[0054] (1) Obtaining primary liver cancer cells (1-1) Fresh human liver cancer tumor tissue (collected from the Second Affiliated Hospital of Army Medical University, with signed informed consent) was chopped into small pieces of 1 cubic millimeter, and then digested at 37°C for 45 minutes with digestion buffer (containing 0.1% type IV collagenase, 0.01% DNase, and 0.05% protease, dissolved in serum-free DMEM medium (catalog number CM10017, Macgene, the same below)); (1-2) After digestion, the supernatant was filtered through a 70μm filter screen, and the filtrate was centrifuged at 50×g for 1 minute to further remove clumps; (1-3) After centrifugation, collect the supernatant and centrifuge at 150×g for 8 minutes; (1-4) After centrifugation, the precipitate was collected (cells were enriched in the precipitate), and primary liver cancer cells (HCC#3 cells) were obtained by lysing red blood cells.

[0055] (2) Construction of lentiviral particles carrying the full-length sequence of RNA ACA49 The full-length sequence of the small nucleolar RNA ACA49 (human, as shown in SEQ ID NO: 1) was cloned into the pLVX-IRES-Puro plasmid (catalog number 128652, addgene), and then transfected into HEK293T cells along with the packaging plasmids pMD2.G and psPAX2 for 48 hours. Lentiviral cells were then collected to obtain lentiviral particles (oeRA49) carrying ACA49. The specific steps are as follows: (2-1) Prepare the core plasmid: pLVX-IRES-Puro (cloned ACA49), packaging plasmids: pMD2.G and psPAX2, transfection reagent: Lipofectamine 3000 (Thermo, L3000015); evenly seed 293T cells in a six-well plate, and when the cell density is about 70%, the virus can be packaged; (2-2) Replace the medium (DMEM) in the six-well plate with fresh medium 30 minutes in advance. Then take two new 1.5 mL EP tubes and add 125 µL of serum-free DMEM medium to each tube. Add 4 µL of Lipofectamine™ 3000 transfection reagent to one tube and mix well. Add plasmid pLVX-IRES-Puro:pMD2.G:psPAX2=2 µg:1 µg:1 µg and 4 µL of LP3000™ reagent to the other tube and mix well. Mix the liquids in the two EP tubes well and incubate at room temperature for 15 minutes. Slowly add the mixed and incubated liquid to the six-well plate, gently shake to mix, and carefully place it in the cell culture incubator. (2-3) After culturing cells for 8 hours, remove the cell culture medium containing the transfection reagent and replace it with fresh DMEM medium; (2-4) Collect the virus-containing cell supernatant 48 h after transfection, filter it with a 0.45µm filter to remove cell debris and obtain lentiviral particles.

[0056] In addition, lentiviral particles that do not carry ACA49, constructed using the above method with a meaningless random sequence (as shown in SEQ ID NO: 5: GTCAAATGCTAGCCTATGACGCAGTTGACATCGGATTACGCTGACCTAGGCATTGCAAGTCACTGGATCATGCCAGTATCGGTACCGTATGCAATCGGTACTCGAAATGCCTAGACTGATCGAGTTGCAATCGGATACGAGCTTGACCGATGCATCGATGCTAGCTACGTAGCTGACGTAGCTACGATCGATGCATGCTAGCTACGATCGATGCTAGCTACGTAGCTACGATCGATGCTAGCTACGATCGATGC), served as a blank control.

[0057] (3) In vitro test The lentivirus particles (oeRA49) carrying ACA49 obtained above (1) (concentration of 1X10) 7 TU / mL) and lentiviral particles (oeScramble) without ACA49 (concentration of 1 x 10⁻⁶ TU / mL) 7TU / mL was mixed with an equal volume of DMEM medium containing 10% fetal bovine serum, and then transfected into Huh7 cells (product number: BNCC337690, BNCC) and HCC#3 cells (obtained above (1), the same below), respectively, for 24 hours, followed by puromycin screening; 2000 Huh7 cells and HCC#3 cells were counted respectively and seeded into low-absorption 6-well plates, and cultured for 2 weeks in serum-free DMEM / F12 medium (product number: C11330500BT, Gibco) containing 20 ng / mL epidermal growth factor, 20 ng / mL fibroblast growth factor-2, and 2% N2 and B27 by mass fraction, respectively. The formation of hepatocellular carcinoma globules was observed under a microscope. The results are as follows Figure 1 As shown in the figure, the results indicate that the ability of hepatocellular carcinoma cells to form globules is significantly inhibited by overexpression of ACA49.

[0058] In addition, the number of liver cancer globules was counted under a stereomicroscope, and the percentage of globulous cells was calculated using the following formula: (number of globules formed) / (number of cells seeded per well) × 100%. The globulous cells were digested with trypsin before the above procedure was performed again to statistically analyze the globulous percentages in the second and third generations. Results are as follows... Figure 2 As shown in the results, the formation rate of hepatocellular carcinoma globulins was significantly reduced in patients overexpressing ACA49.

[0059] In addition, 2000 Huh7 cells and HCC#3 cells (cells transfected with oeRA49 and oeScramble, respectively) were seeded into 6-well plates and cultured for two weeks in DMEM medium containing 10% fetal bovine serum, 100 μg / mL penicillin G, and 100 U / mL streptomycin. After washing with PBS, the cells were fixed with 4% paraformaldehyde for 10 minutes, then stained with 0.1% crystal violet for 30 minutes. The culture plates were gently rinsed with running water, air-dried, and photographed. The results are as follows: Figure 3 As shown in the figure, the results indicate that the growth ability of tumor cells overexpressing ACA49 is inhibited.

[0060] Example 2 In this embodiment of the invention, the inhibitory effect of ACA49 on tumors in a mouse model of liver cancer was tested by constructing lentiviral particles carrying ACA49.

[0061] Huh7 cells (Huh7 cells transfected with oeRA49 and oeScramble in Example 1 above) were used with PBS buffer from 1×10 5 Up to 1×10 2The mixture was diluted in a gradient and then mixed with 100 μL of matrix gel (catalog number: 356234, BDBiosciences, hereinafter the same) to obtain a mixture. The mixture was then injected subcutaneously (200 μL of the mixture per mouse, only once) into BALB / c nude mice (6-8 weeks old, hereinafter the same) (4 mice in each of the oeRA49 group and oeScramble group). The percentage of tumor-free mice was calculated after 3 months. The results are as follows: Figure 4 As shown in the figure, the results indicate that the number of tumor-free mice increased after overexpression of ACA49, indicating a decrease in the proportion of liver cancer stem cells.

[0062] Additionally, 1×10 6 One Huh7 cell line (cells transfected with oeRA49 and oeScramble) (in PBS buffer) was mixed with 100 μL of matrix gel at a volume ratio of 1:1. The mixture was injected subcutaneously into BALB / c nude mice (200 μL per mouse, once per mouse). Tumor volume was measured every 4 days starting from day 8 until day 28. Tumor volume was calculated using the formula 1 / 2 × (length) × (width) × (width). Mice were euthanized before the tumor diameter exceeded 15 mm or before skin ulceration occurred. Results are as follows: Figure 5 As shown in the figure, the results indicate that subcutaneous tumor formation in mice was inhibited after overexpression of ACA49.

[0063] In addition, 5×10 5 One luciferase-labeled Huh7 liver cancer cell line (cells transfected with oeRA49 and oeScramble) (in PBS buffer) was mixed with 100 μL of matrix gel at a volume ratio of 1:1. The mixture was injected orally into the livers of BALB / c nude mice (50 μL per mouse, once per mouse). Two weeks post-injection, mice were intraperitoneally injected with 3 mg of D-luciferin potassium salt, followed by anesthesia with isoflurane. Luciferase signals were detected using an IVISLumina3 instrument. Results are as follows: Figure 6 As shown, the results indicate that the ability of the liver to form tumors in situ was suppressed after overexpression of ACA49.

[0064] Example 3 In this embodiment of the invention, adeno-associated virus particles carrying ACA49 were constructed to test the inhibitory effect of ACA49 on tumors in a mouse model of liver cancer.

[0065] (1) Construction of adeno-associated virus particles The U6 promoter in the adeno-associated virus-single-stranded guide RNA (AAV-sgRNA) plasmid (product number 60231, Addgene) was replaced with the liver-specific thyroid-binding globulin (TBG) promoter to obtain the AAV-TBG plasmid. The ACA49 sequence (mouse-derived, as shown in SEQ ID NO: 2) was cloned into the AAV-TBG plasmid and co-transfected with pHelper and pAnc plasmids into HEK293T cells. After culturing for 48 hours, the cells were packaged (AAV-TBG:pHelper:pAnc = 4ug:3ug:1ug). Cells were then collected, resuspended in 0.9% sodium chloride solution, and lysed using liquid nitrogen through repeated freeze-thaw cycles. Cell debris was removed by centrifugation at 1000×g for 5 minutes. The supernatant was then ultracentrifuged at 25000×g for 2 hours to obtain the viral pellet, i.e., ACA49 adeno-associated virus particles (AAV-Snora49). Additionally, meaningless random sequences (as shown in SEQ ID NO: 2) were used to precipitate the virus. NO:6 shows: AAV-Scramble, adeno-associated virus particles (AAV-Scramble) that do not carry ACA49, constructed according to the above method, served as a blank control.

[0066] (2) Animal experiment process ACA49 adeno-associated virus particles (AAV-Snora49) and adeno-associated virus particles without ACA49 (AAV-Scramble) were resuspended in 0.9% sodium chloride solution and injected intravenously into the tail vein of each 6-week-old C57BL / 6 background mouse (weighing 20g, 6 mice per group). Two weeks after injection, the overexpression of ACA49 was detected by qRT-PCR and Northern blotting. Next, C57BL / 6 background mice overexpressing ACA49 (injected with AAV-Snora49) and C57BL / 6 background mice not expressing ACA49 (injected with AAV-Scramble) were injected via high-pressure tail vein. The injected solution contained 20 μg of pBABE-c-mycT58A+HRasG12V plasmid (product number 11130, Addgene), 20 μg of pT2-shP53 plasmid (product number 124261, Addgene), and 20 μg of pT2 / C-Luc / / PGK-SB13 plasmid (product number 20207, Addgene) in a 0.9% sodium chloride solution. The volume of the injected saline solution was equivalent to 10% of the mouse's body weight, and it was rapidly injected into the tail vein within 7 seconds to induce liver cancer in mice (see details below). Figure 7 ).

[0067] (3) Results of animal experiments In the third and fourth weeks of induction, mice were euthanized by cervical dislocation, and their livers were removed for photographing. The results are as follows: Figure 8 As shown, the results indicate that the tumor formation ability of mice with liver-specific high expression of ACA49 was inhibited.

[0068] In addition, the results of HE staining of mouse liver pathological sections were photographed under a microscope, and the results are as follows: Figure 9 As shown in the figure, the results indicated that the liver tumor size was significantly reduced in mice with high ACA49 expression.

[0069] In addition, the number of liver tumors in mice was counted, and the results were as follows: Figure 10 As shown in the figure, the results indicated that the number of liver tumors was significantly reduced in mice with high ACA49 expression.

[0070] In addition, the liver weight ratio of mice was calculated as: (liver weight) / (mouse body weight) × 100%, and the results are as follows. Figure 11 As shown in the figure, the results indicate that the liver weight ratio of mice with high ACA49 expression was significantly reduced.

[0071] Example 4 In this embodiment of the invention, adeno-associated virus particles carrying ACA49 and adeno-associated virus particles carrying sgSox9 were constructed to test the synergistic inhibitory effect of ACA49 and sgSox9 on tumors in a mouse model of liver cancer.

[0072] (1) Experimental procedure (1-1) The sgRNA (sgSox9) (TTCTTGTGCTGCTCGCGCAG, SEQ ID NO: 3) targeting the Sox9 coding sequence was cloned into the AAV-TBG plasmid (prepared in Example 3), and co-transfected with pHelper and pAnc plasmids into HEK293T cells and cultured for 48 hours for virus packaging. After that, the virus was collected to obtain adeno-associated virus particles (AAV-sgSox9) carrying sgSox9. (1-2) Six-week-old Alb-Cre and LSL-Cas9 heterozygous mice (which specifically express Cas9 protein in the liver) were divided into a control group (AAV-Scramble), a group that highly expresses only ACA49 (AAV-Snora49), a group that knocks out only Sox9 (AAV-sgSox9), and a group that highly expresses ACA49 and knocks out Sox9 (AAV-Snora49+AAV-sgSox9), with six mice in each group. All mice in each group were induced to develop liver cancer by high-pressure tail vein injection (refer to...). Figure 12 The process involved injecting 200 μL of adeno-associated virus (AAV) particles without ACA49 into the tail vein of control mice (AAV-Scramble mice), 200 μL of AAV particles carrying ACA49 into the tail vein of mice with high ACA49 expression only (AAV-Snora49 mice), 200 μL of AAV particles carrying ACA49 into the tail vein of mice with high ACA49 expression only (AAV-sgSox9 mice), 200 μL of AAV particles carrying sgSox9 into the tail vein of mice with high ACA49 expression only (AAV-Snora49+AAV-sgSox9 mice), and 200 μL of AAV particles carrying ACA49 and 200 μL of AAV particles carrying sgSox9 into the tail vein of mice with high ACA49 expression only (AAV-Snora49+AAV-sgSox9 mice).

[0073] (2) Experimental results In the third week of induction, mice were euthanized by cervical dislocation, and their livers were removed and photographed. The results are as follows: Figure 13 As shown in the figure, the results indicate that overexpression of ACA49 and knockout of Sox9 have a synergistic effect on inhibiting liver tumor formation in mice.

[0074] In addition, the number of liver tumors in each group of mice was counted, and the results are as follows: Figure 14 As shown in the results, the number of liver tumors in mice was lowest when ACA49 was overexpressed and Sox9 was knocked out simultaneously.

[0075] In addition, tumor cells were isolated from mouse hepatocellular carcinoma tumors induced by high-pressure tail vein injection and treated with AAV virus. These cells were then subcutaneously injected into BALB / c nude mice to form secondary tumors. The results showed that both ACA49 overexpression and Sox9 knockout inhibited the formation of secondary tumors, and the combination of the two produced a synergistic anti-tumor effect (see...). Figure 15 ).

[0076] Example 5 In this embodiment of the invention, the synergistic inhibitory effect of ACA49 and sgSox9 on tumors in a mouse model of liver cancer was tested by constructing lipid nanoparticles encapsulated with ACA49 and an ASO sequence targeting SOX9.

[0077] In the following examples, LNPs (lipid nanoparticles) were prepared based on commercially available ionizable lipid SM-102 (Moderna), whose components include SM-102, cholesterol, 1,2-distearate-sn-glycerol-3-phosphocholine (DSPC), and PEG2000-DMG in a molar ratio of 50:10:38.5:1.5; the average particle size of LNPs was approximately 100 nm as determined by dynamic light scattering (DLS).

[0078] (1) Construction of LNP-encapsulated RNA (1-1) A co-transcriptional capping reaction system was used. The standard capping reagent m7G(5')ppp(5')G (system shown in Table 1) was added to the DNA template, NTPs and T7 RNA polymerase reaction system to cap ACA49 (human and mouse) and ASO targeting SOX9 (incubated at 37℃ for 2 h). The ASO sequence targeting SOX9 was mUmUmCmUmU∗G∗U∗G∗C∗U∗G∗C∗U∗C∗GmCmGmCmAmG (where "m" refers to 2'-O-methyl modification and "*" refers to thiophosphate bond modification). The ASO sequences targeting human and mouse SOX9 were the same.

[0079] Table 1. Co-transcriptional capping reaction system

[0080] (1-2) After capping the co-transcriptional capping reaction system, the RNA was encapsulated into LNPs at a concentration of 0.35 μg / μL (1 μL LNP encapsulates 0.35 μg RNA) to obtain LNP-encapsulated RNA. Among them, the LNP-encapsulated ACA49 was named LNP-RA49 or LNP-Snora49; the LNP-encapsulated ASO targeting SOX9 was named LNP-ASO. An empty LNP vector (LNP-Vec) was used as a blank control. Huh7 cells were treated for 24 hours with 100 ng / mL of different LNP-encapsulated RNA (100 ng / mL refers to the final LNP concentration of encapsulated RNA added to the cell culture medium) and the combination of LNP-RA49 and LNP-ASO (total 100 ng / mL). The cells were then collected to evaluate the transfection efficiency and gene silencing effect.

[0081] ACA49 levels were detected by qRT-PCR, and SOX9 mRNA and protein levels were detected by qRT-PCR and Western blotting, respectively. The results are as follows: Figure 16 As shown, all LNP-encapsulated RNAs can be highly expressed.

[0082] In addition, representative images (left) and statistical results (right) of Huh7 cell sphere formation after LNP treatment are shown below. Figure 17 As shown.

[0083] Furthermore, the delivery efficiency and silencing effect of LNP administration in the HTVI model (high-pressure tail vein induction model) and the PDC model (PDC model, Patient-derived tumor cell, cultured by directly isolating cancer cells from patient tumor tissue or body fluid) are as follows: Figure 18 and Figure 19 As shown, the results indicate that the LNP-encapsulated RNA constructed in Example 5 exhibits excellent delivery efficiency and silencing effect.

[0084] (2) Animal experiment process In an in vivo LNP treatment experiment in a mouse model, tumor-bearing mice (20g) were administered 1 mg / kg RNA (equivalent to 57 μL LNP) once weekly via high-pressure tail vein injection (see reference). Figure 20 ), with 6 mice in each group.

[0085] (3) Results of animal experiments In the fourth week of induction, mice were euthanized by cervical dislocation, and their livers were removed, photographed, and sectioned for HE staining. Figure 21 and Figure 22 As shown; tumor volume at week four is as follows Figure 23 As shown above, the data indicate that LNPs containing ACA49 RNA or Sox9 ASO significantly inhibited tumor growth and improved mouse survival.

[0086] Furthermore, combining ACA49 RNA with Sox9 ASO further reduced tumor size and number and improved survival rates in tumor-bearing mice (see [link to study]). Figure 24 ).

[0087] In addition, to further evaluate the translational potential of this therapy in humanized mouse models, primary HCC cells labeled with luciferase were injected orally into the livers of BALB / c nude mice, followed by treatment with empty LNPs or LNPs loaded with RNA (see [reference]). Figure 25 The results showed that combined treatment with human ACA49 RNA and SOX9 ASO significantly inhibited in situ tumor growth, and was superior to either agent alone. Figure 26 ).

[0088] The above demonstrates that LNP-mediated delivery of ACA49 RNA and SOX9 ASO exhibits a strong synergistic anti-tumor effect in HCC tumors, providing solid preclinical evidence for this strategy as a potential treatment.

[0089] Example 6 The safety of the LNP-encapsulated RNA constructed in Example 5 was evaluated in this embodiment of the invention, as follows: In the biosafety evaluation, wild-type mice were treated with empty LNP vectors and different LNP-encapsulated RNAs (prepared as in Example 5), with 5 mice in each group, and the dose of LNP-encapsulated RNA used was the same as in Example 5.

[0090] 48 hours after injection, mouse body weight and the weight of major organs were recorded, and the morphology of the liver, kidneys, and spleen was assessed. The results are as follows: Figure 27 As shown in the results, the morphology of the liver, kidneys and spleen in different treatment groups did not change significantly compared with the negative control group (NC), indicating good safety.

[0091] In addition, 48 hours after injection, the body weight, liver, kidney, and spleen weights of mice in each group, as well as the expression levels of IFN-γ and IL-2 in the liver (detected by qRT-PCR), were measured. Figure 28 As shown, the results indicated that there were no significant differences in body weight, liver, kidney and spleen weight, and IFN-γ and IL-2 expression levels in the liver between the mice in different treatment groups and the negative control group (NC).

[0092] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention and not to limit it. Although the present invention has been described in detail with reference to preferred embodiments, those skilled in the art should understand that modifications or equivalent substitutions can be made to the technical solutions of the present invention without departing from the spirit and scope of the technical solutions of the present invention, and all such modifications or substitutions should be covered within the scope of the claims of the present invention.

Claims

1. Use of an ACA49 overexpression reagent and / or a SOX9 expression inhibitor in the preparation of a liver cancer treatment drug.

2. The use according to claim 1, wherein the ACA49 overexpression reagent is a lentivirus particle carrying ACA49 and / or an adeno-associated virus particle carrying ACA49 and / or a lipid nanoparticle loaded with ACA49; or the SOX9 expression inhibitor is a lentivirus particle carrying SOX9 ASO and / or an adeno-associated virus particle carrying SOX9 ASO and / or a lipid nanoparticle loaded with SOX9 ASO.

3. The use according to claim 2, wherein the lipid nanoparticle loaded with ACA49 or the lipid nanoparticle loaded with SOX9 ASO comprises SM-102, cholesterol, 1,2-distearoyl-sn-glycero-3-phosphocholine and PEG2000-DMG.

4. The use according to claim 3, wherein the molar ratio of SM-102, cholesterol, 1,2-distearoyl-sn-glycero-3-phosphocholine and PEG2000-DMG is 50:10:38.5:1.

5.

3. Use according to claim 2, characterized in that, 5. The use according to claim 2, wherein the lentivirus particle carrying ACA49 or the lentivirus particle carrying SOX9 ASO is obtained by cloning ACA49 or SOX9 ASO into a pLVX-IRES-Puro plasmid, and then co-transfecting the plasmid with a packaging plasmid pMD2.G and psPAX2 into a tool cell; or the adeno-associated virus particle carrying ACA49 or the adeno-associated virus particle carrying SOX9 ASO is obtained by cloning ACA49 or SOX9 ASO into an AAV-TBG plasmid, and then co-transfecting the plasmid with pHelper and pAnc plasmids into a tool cell.

4. Use according to claim 3, characterized in that, 6. The use according to claim 5, wherein the nucleotide sequence of the SOX9 ASO is: TTCTTGTGCTGCTCGCGCAG or UUCUUGUGCUGCUCGCGCAG.

7. The use according to claim 5, wherein the nucleotide sequence of the SOX9 ASO is: mUmUmCmUmU*G*U*G*C*U*G*C*U*C*GmCmGmCmAmG.

8. A liver cancer treatment drug composition comprising an ACA49 overexpression reagent and / or a SOX9 expression inhibitor.

9. The liver cancer treatment drug composition according to claim 8, wherein the ACA49 overexpression reagent is a lentivirus particle carrying ACA49 and / or an adeno-associated virus particle carrying ACA49 and / or a lipid nanoparticle loaded with ACA49; or the SOX9 expression inhibitor is a lentivirus particle carrying SOX9 ASO and / or an adeno-associated virus particle carrying SOX9 ASO and / or a lipid nanoparticle loaded with SOX9 ASO.

6. Use according to any one of claims 2 to 5, characterized in that, 10. A liver cancer treatment drug composition according to any one of claims 8 to 9 and a pharmaceutically acceptable carrier. ​ ​ 7. The liver cancer therapeutic pharmaceutical composition according to claim 6, characterized by, ​ 8. A pharmaceutical composition for treating liver cancer, characterized by, ​ ​ ​ ​ 10. A medicament for treating liver cancer, characterized by, ​

Images