Strong anion chromatography medium as well as preparation method and application thereof
By using a strong anionic chromatography medium in the purification process of small nucleic acid drugs, and combining carbon-carbon double bond active groups and mixed functional ligands, the problem of poor purification effect in existing technologies has been solved, and efficient and economical multi-pipeline production of small nucleic acid drugs has been achieved.
Patent Information
- Application Number
- CN202511224372.7
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-08-29
- Publication Date
- 2025-12-05
AI Technical Summary
Existing small nucleic acid drug purification technologies struggle to accommodate the differences in chain length, modified groups, charge distribution, and spatial structure among different types of small nucleic acid drugs, resulting in poor purification effects, increased process development costs, and limitations on multi-pipeline production.
Using a strong anionic chromatography medium, a mixed functional ligand is constructed on the matrix surface, including a mixed functional ligand formed by copolymerization of charged and neutral monomers. This ligand, combined with carbon-carbon double bond active groups, provides strong anionic, hydrophobic, and hydrogen bonding forces for the purification of small nucleic acid drugs.
It achieves high-resolution purification of different small nucleic acid drugs, and is particularly suitable for the separation of nucleic acid samples with many impurities and low purity, improving purification efficiency and recovery rate, and reducing process development costs.
Smart Images

Figure CN121064409A_ABST
Abstract
Description
Technical Field
[0001] This invention relates to a chromatography medium, specifically to a strong anion chromatography medium, its preparation method, and its application. Background Technology
[0002] Small nucleic acid drugs, also known as oligonucleotide drugs, are short chains of nucleic acids composed of a dozen to dozens of nucleotides linked together. They achieve therapeutic effects by interfering with the expression of target genes. In a narrow sense, small nucleic acid drugs refer to siRNA (small interfering RNA); in a broader sense, they include not only siRNA but also ASO (antisense oligonucleotide drugs), miRNA targeting (microRNAs), saRNA (small activating RNA), and aptamers (RNA aptamers). The production of small nucleic acid drugs typically employs chemical synthesis, involving steps such as target sequence screening, oligonucleotide synthesis, fragmentation and deprotection, purification, and separation. While chemical synthesis can improve drug stability, it also introduces problems such as increased impurities and greater purification difficulty, posing risks to the quality and safety of the final drug. Common product-related impurities include short-chain sequences (nx, capping failure sequences, nucleotide chain breaks due to degradation), n-1 sequences (impurity groups lacking one nucleotide, caused by incomplete detriphenylmethylation / coupling), long-chain sequences (mostly n+1, formed by coupling two phosphoramide monomers), PS oxidation of PO, trichloroacetaldehyde adducts (from starting materials), DMT-C-phosphonate impurities (incomplete oxidation / sulfurization), high molecular weight impurities (dimers, branched sequences, and lambdamers), base-deficient impurities (such as depurination during detriphenylmethylation), deamination impurities (caused by alkaline conditions in the C&D steps), incomplete removal of protecting groups (DMT, isobutyryl, TBDMS, etc.), acrylonitrile adducts (byproducts of dephosphodiester backbone protecting groups, reacting with nucleoside bases), and impurities introduced by the solid support.
[0003] To obtain high-purity, high-quality small nucleic acid drugs, chromatographic purification is essential to remove impurities. Anion exchange chromatography is versatile, low-cost, and offers high resolution, making it the first choice for small nucleic acid drug purification. However, as nucleotide chain length increases, the difficulty of removing related impurities increases. When anion exchange chromatography is insufficient, end-group-retaining DMT (dimethylaminomethyltransferase) purification using reversed-phase chromatography can be chosen. While crude products from different small nucleic acid drugs may contain seemingly similar impurity groups, this does not mean that existing universal purification methods can meet all purification requirements. Different small nucleic acid drugs (such as ASO, siRNA, and aptamers) differ significantly in chain length, modified groups, charge distribution, and spatial structure, making it difficult for a single packing material to meet all types of purification needs. For example, while anion exchange (AEX) packing materials can efficiently capture negatively charged nucleic acids, their resolution for phosphate thioester-modified ASOs is insufficient; while reversed-phase (RP) packing materials can separate hydrophobically modified ASOs, they easily disrupt the double-stranded structure of siRNA or cause long-chain mRNA aggregation; and while size exclusion (SEC) packing materials can gently handle large molecules, their low loading capacity and limited resolution make them difficult to scale up. This adaptability bottleneck not only increases process development costs but also limits the synergistic production of multi-pipeline small nucleic acid drugs. Summary of the Invention
[0004] Purpose of the invention: The purpose of this invention is to provide a strong anionic chromatography medium that meets the purification needs of small nucleic acid drugs of different types and properties; another purpose of this invention is to provide a method for preparing and applying this chromatography medium.
[0005] Technical solution: The strong anion chromatography medium of the present invention includes a matrix and a mixed functional ligand bonded to the surface of the matrix by carbon-carbon double bond active groups; the mixed functional ligand is formed by copolymerization of charged monomers and neutral monomers, wherein the charged monomers contain strong anion exchange groups and the neutral monomers are uncharged.
[0006] Preferably, the strong anion exchange group is -N. + (CH3)3.
[0007] Preferably, the charged monomer includes at least one of (3-acrylamidopropyl)trimethylammonium chloride (CAS: 45021-77-0), methacryloylpropyltrimethylammonium chloride (CAS: 51410-72-1), [2-(methacryloyloxy)ethyl]trimethylammonium chloride (CAS: 5039-78-1), acryloyloxyethyltrimethylammonium chloride (CAS: 44992-01-0), acryloyloxyethyltrimethylbenzylammonium chloride (CAS: 46830-22-2), and benzylvinyltrimethylammonium chloride (CAS: 26616-35-3).
[0008] Preferably, the neutral monomer includes at least one of N-(3-hydroxypropyl)acrylamide (CAS: 44817-99-4), N-(3-methoxypropyl)acrylamide (CAS: 107374-86-7), N-(2,3-dihydroxypropyl)acrylamide (CAS: 42521-68-6), N-vinylpyrrolidone (CAS: 88-12-0), vinyl acetate (CAS: 108-05-4), N-vinylcaprolactam (CAS: 2235-00-9), and 4-acryloylmorpholine (CAS: 5117-12-4).
[0009] Preferably, one of the charged monomers and the neutral monomers contains a cyclic structure, which provides superior separation performance for small nucleic acid drugs with hydrophobic modifications (such as methoxy, straight-chain alkyl, etc.) and wider applicability.
[0010] More preferably, both the charged monomer and the neutral monomer contain a ring structure, resulting in stronger separation performance.
[0011] Preferably, the molar ratio of the charged monomer to the neutral monomer is 10:1 to 1:1.
[0012] More preferably, the molar ratio of the charged monomer to the neutral monomer is 5:1.
[0013] Preferably, the matrix is an organic polymer matrix or an inorganic material matrix; the organic polymer matrix includes at least one of polysaccharides, polyacrylamide, polymethacrylamide, poly(hydroxyalkyl vinyl ether), poly(hydroxyalkyl acrylate), polymethacrylate, polyvinyl alcohol, and polymers based on styrene and divinylbenzene; the inorganic material matrix includes at least one of silica and zirconium oxide.
[0014] More preferably, the polysaccharide includes at least one of agarose, dextran, and cellulose.
[0015] This invention does not impose any particular limitations on the particle size or morphology of the microspheres.
[0016] Preferably, the matrix is microspheres with a monodisperse or polydisperse particle size; the microspheres are non-porous or include one or more pores. Monodisperse porous microspheres are preferred.
[0017] More preferably, the matrix is polymethacrylate microspheres or polystyrene-divinylbenzene microspheres; the particle size of the microspheres is 8–90 μm; the pore size of the microspheres is…
[0018] More preferably, the microspheres have a particle size of at least one selected from 8μm, 15μm, 30μm, 45μm, 50μm, 60μm, and 90μm; the microspheres have a pore size of... At least one of them.
[0019] The preparation method of the strong anion chromatography medium of the present invention includes the following steps: constructing carbon-carbon double bond active groups on the surface of a matrix; bonding mixed functional ligands on the matrix surface with carbon-carbon double bond active groups to obtain a strong anion chromatography medium with high resolution on the surface.
[0020] Preferably, carbon-carbon double bond active groups are constructed by mixing and reacting a matrix, an alkaline catalyst, and an epoxy olefin compound.
[0021] Further preferred are epoxy-based olefin compounds whose core structural features include both highly reactive epoxy groups (three-membered oxygen rings) and alkenyl groups (especially terminal olefins).
[0022] More preferably, the epoxy olefin compound is allyl glycidyl ether.
[0023] In a further preferred embodiment, 100g of the matrix is added to a reaction vessel, followed by 30-180g of allyl glycidyl ether. The mixture is thoroughly mixed, and then 5-30mL of a 0.2-2mol / L NaOH solution is added. The temperature inside the reaction vessel is set to 25-90℃, and the reaction time is 2-24 hours. After the reaction, the mixture is thoroughly cleaned with pure water and dried to obtain a matrix with carbon-carbon double bond active groups on its surface.
[0024] Preferably, the mixed functional ligand is bonded by mixing a matrix with carbon-carbon double bond active groups, a mixed functional active monomer, and an initiator in water and carrying out a polymerization reaction; the mixed functional active monomer comprises the charged monomer and the neutral monomer.
[0025] More preferably, the initiator is at least one selected from benzoyl peroxide, lauroyl peroxide, di-tert-butyl peroxide, potassium persulfate, ammonium persulfate, and azobisisobutyronitrile.
[0026] More preferably, the matrix with carbon-carbon double bond active groups, mixed functional active monomers, purified water, and initiator are mixed uniformly and polymerized at 25–90°C. The reaction intermediate is then subjected to steps such as filtration and washing with pure water to obtain a high-resolution, strong anion exchange chromatography medium with a surface.
[0027] More preferably, 100g of the matrix with carbon-carbon double bond active groups is added to a reaction vessel, followed by 10-40mL of mixed functional active monomers and 1-5g of initiator. The reaction is carried out for 2-8 hours at a temperature of 25-90℃. The reactants are then filtered and washed to obtain a high-resolution, strong anion chromatography medium with a surface finish.
[0028] The application of the strong anion chromatography medium described in this invention in the purification of small nucleic acid drugs.
[0029] More preferably, the small nucleic acid drug is siRNA or ASO.
[0030] Beneficial Effects: Compared with existing technologies, this invention has the following significant advantages: The strong anionic chromatography medium of this invention has a microscopic surface constructed with mixed functional groups. During the purification process with nucleic acid samples, it exhibits both strong anionic interactions and certain hydrophobic and hydrogen bonding forces. Under these combined forces, nucleic acid samples are separated from impurities with high resolution. The chromatography medium has superior overall performance and is particularly suitable for the separation and purification of nucleic acid samples with high impurity levels and low purity. The preparation method is simple, the raw materials are widely available, and it has broad application prospects. Attached Figure Description
[0031] Figure 1 This is a synthetic route diagram of the preparation method in Example 5 of the present invention.
[0032] Figure 2 This is a chromatogram of siRNA purified by anion exchange chromatography medium prepared in Example 1 of the present invention.
[0033] Figure 3 This is a purity test spectrum of siRNA purified by anion exchange chromatography medium prepared in Example 1 of the present invention.
[0034] Figure 4 This is a map showing the purification of siRNA using the anion exchange chromatography medium prepared in Comparative Example 2 of this invention. Detailed Implementation
[0035] The technical solution of the present invention will be further described below with reference to the accompanying drawings, embodiments, and comparative examples.
[0036] Unless otherwise specified, all raw materials used in the embodiments of this invention are commercially available.
[0037] Example 1
[0038] This embodiment provides a high-resolution strong anion chromatography media packing and its preparation method.
[0039] The styrene-divinylbenzene microspheres used in this embodiment are model PSDVB-50OH (item number: 2200509D1, particle size: 50μm, pore size: 260nm, surface contains a large number of hydroxyl groups, color: light yellow); the manufacturer is Suzhou Saifen Technology Co., Ltd. All other raw materials are commercially available.
[0040] 100g of styrene-divinylbenzene microspheres were accurately weighed using a balance and transferred to a 500mL three-necked flask. 100mL of 0.7M NaOH solution was added, followed by 85g of allyl glycidyl ether, and the mixture was thoroughly mixed. The reaction vessel temperature was set to 60℃, and the reaction time was 8 hours. After the reaction, the microspheres were rinsed thoroughly with pure water and dried to obtain microspheres with carbon-carbon double bond active groups on their surface.
[0041] The microspheres with carbon-carbon double bond active groups obtained in the above steps were added in a 500 mL three-necked flask (50 g each), followed by 18 mL of a mixture of functional active monomers (benzylvinyltrimethylammonium chloride and N-acryloylmorpholine in a 5:1 molar ratio) and 2 g of potassium persulfate initiator. The reaction was carried out for 3 h at 70 °C. The reactants were then filtered and washed to obtain a high-resolution, strong anion exchange chromatography medium.
[0042] Example 2
[0043] The preparation method is basically the same as in Example 1, except that the functional active monomers (benzylvinyltrimethylammonium chloride and N-acryloylmorpholine in a molar ratio of 10:1) are mixed.
[0044] Example 3
[0045] The preparation method is basically the same as in Example 1, except that the functional active monomers (benzylvinyltrimethylammonium chloride and N-acryloylmorpholine in a 1:1 molar ratio) are mixed.
[0046] Example 4
[0047] The preparation method is basically the same as in Example 1, except that the functional active monomers (benzylvinyltrimethylammonium chloride and N-vinylcaprolactam in a molar ratio of 5:1) are mixed.
[0048] Example 5
[0049] The preparation method is basically the same as in Example 1, except that the functional active monomers ((3-acrylamidopropyl)trimethylammonium chloride and N-vinylpyrrolidone, in a molar ratio of 5:1) are mixed. Figure 1 This is a synthetic route diagram for the preparation method in Example 5.
[0050] Example 6
[0051] The preparation method is basically the same as in Example 1, except that the functional active monomers (benzylvinyltrimethylammonium chloride and N-(2,3-dihydroxypropyl)acrylamide in a molar ratio of 5:1) are mixed.
[0052] Example 7
[0053] The preparation method is basically the same as in Example 1, except that the styrene-divinylbenzene microspheres are replaced with polymethacrylate microspheres, model Monomix MC60-SEC (catalog number: 280160950, particle size: 60 μm, pore size: 50 nm).
[0054] Example 8
[0055] The preparation method is basically the same as in Example 1, except that the styrene-divinylbenzene microspheres are replaced with 6% cross-linked agarose microspheres with a particle size of 90 μm.
[0056] Example 9
[0057] The preparation method is basically the same as in Example 1, except that the styrene-divinylbenzene microspheres are replaced with silica gel microspheres with a particle size of 8 μm and a pore size of [missing information].
[0058] Comparative Example 1
[0059] The difference between this comparative example and Example 1 is that the functional ligand constructed on the matrix surface is a single strong anion exchange group. The specific steps are as follows:
[0060] 100g of styrene-divinylbenzene microspheres were accurately weighed using a balance and transferred to a 500mL three-necked flask. 100mL of 0.7M NaOH solution was added, followed by 85g of allyl glycidyl ether, and the mixture was thoroughly mixed. The reaction vessel temperature was set to 60℃, and the reaction time was 8 hours. After the reaction, the microspheres were rinsed thoroughly with pure water and dried to obtain microspheres with carbon-carbon double bond active groups on their surface.
[0061] The microspheres with carbon-carbon double bond active groups obtained in the above steps were added in a 500mL three-necked flask (50g), followed by 18mL of anionic active monomer (benzylvinyltrimethylammonium chloride) and 2g of potassium persulfate initiator. The reaction was carried out for 3 hours at 70℃. The reactants were then filtered and washed clean. This yielded the single-acting strong anionic filler described in Comparative Example 1.
[0062] Comparative Example 2
[0063] The preparation method is basically the same as in Example 1, except that the mixed functional active monomers ((3-acrylamidopropyl)trimethylammonium chloride and N-(3-methoxypropyl)acrylamide in a molar ratio of 5:1) are used. The monomers used in this comparative example are all linear structures and do not contain the cyclic structures of this invention.
[0064] Validation of small nucleic acid drug purification effect
[0065] The anion exchange chromatography media prepared in Examples 1-7 and Comparative Examples 1-2 were used for small nucleic acid sample purification tests. The test methods and results are as follows:
[0066] Chromatography column: The anion chromatography media prepared in Examples 1-7 and Comparative Examples 1-2 were packed into a 6.6*100mm chromatography column.
[0067] Instrument: FPLC (Generik-G50, Saifen Medical)
[0068] Equilibrium solution A: 20 mM PB, pH 7.0
[0069] Elution buffer B: 20 mM PB, 1 M NaCl, pH 7.0
[0070] Column temperature: 25℃
[0071] Sample 1: siRNA, purity 67%, double strand, sense strand GAAAGUAUGUCAACGAAUU, antisense strand AAUUCGUUGACAUACUUUCUU (prepared using conventional solid-phase phosphoramide chemical method, for details please refer to patent CN201980010095.6).
[0072] Sample 2: ASO, purity 62%, single chain, containing 20 bases (TCTGTGTTGTAGGTGACCAG) (prepared by conventional solid-phase phosphorus amide chemical method, for details please refer to patent CN200310103185.0).
[0073] Test conditions: Equilibrate the system and column with 10 column volumes of equilibration buffer A until the baseline is zero, then load the sample at a loading of 10 mg / mL; then elute linearly from 0 to 100% with elution buffer B and collect the eluent.
[0074] For the purification requirements of small nucleic acid drugs, commercially available products generally require a purity of 95% or higher. Therefore, the purity of the collected eluents was tested, samples with a purity of 95% or higher were collected, and the recovery rate of samples with a purity of 95% or higher was calculated.
[0075] The purity test method is as follows:
[0076] Column: Sepax GP-C18 (1.8μm, 2.1 x 50 mm, SN: 8F58067);
[0077] Mobile phase: Phase A: 7 mM triethylamine + 100 mM hexafluoroisopropanol + 10 mL acetonitrile;
[0078] Phase B: 70% A + 30% ACN;
[0079] Flow rate: 0.2 mL / min;
[0080] Detector: 260nm;
[0081] Column temperature: 60℃;
[0082] Injection volume: 5 μL;
[0083] Sample: The eluent obtained in the above steps;
[0084] Pressure: 135 bar;
[0085] Instrument: HPLC Agligent 1260.
[0086] The purification effects of Examples 1-7 and Comparative Examples 1-2 are shown in Table 1.
[0087] As shown in Table 1, the anion exchange chromatography media prepared in Examples 1-9 of this invention exhibit high resolution on both siRNA and ASO samples, with recoveries of over 90% for purities exceeding 95%. In contrast, Comparative Examples 1-2 showed recoveries of only around 70% for purities above 95%, and demonstrated varying purification effects for different small nucleic acid drugs. The effect on siRNA was significantly better than on ASO, indicating that conventionally prepared ion exchange media not only have poor purification effects on small nucleic acid drugs but also low compatibility, making them unsuitable for the purification and separation of various small nucleic acid drugs.
[0088] Table 1
[0089]
[0090] When charged and / or uncharged monomers contain cyclic structures, in addition to ionic interactions, they can also provide hydrophobic and hydrogen bonding interactions. Under these combined forces, nucleic acid samples can be separated from impurities with high resolution and recovery rate. Furthermore, it can be seen that when both charged and uncharged monomers contain cyclic structures, the purification effect is better than when only one monomer has a cyclic structure.
[0091] Figure 2 This is a map showing the purification of siRNA using the anion exchange chromatography medium prepared in Example 1; Figure 3 The purity test spectrum of siRNA purified by anion exchange chromatography medium prepared in Example 1 is shown. Figure 4 This is a chromatogram of siRNA purified using the anion exchange chromatography medium prepared in Comparative Example 2. From... Figure 2 It can be seen that the impurities before and after eluting the main peak are relatively separated, while in Comparative Example 2, the impurities before and after elution are not clearly separated. Figure 4 The impurities are mixed together. Therefore, the anion exchange chromatography medium prepared by this invention has significant advantages in the purification and separation of small nucleic acid drugs, especially showing excellent resolution and recovery rate for samples with many impurities. The preparation method of this chromatography medium is simple and has broad application prospects.
Claims
1. A strong anion chromatography medium, characterized in that, The chromatography medium comprises a matrix and mixed functional ligands bonded on the surface of the matrix through carbon-carbon double bond active groups; the mixed functional ligands are formed by copolymerization of charged monomers and neutral monomers, the charged monomers contain strong anion exchange groups, and the neutral monomers are not charged.
2. The strong anion chromatography medium of claim 1, wherein, The charged monomers include at least one of (3-acrylamidopropyl)trimethylammonium chloride, methacryloylpropyltrimethylammonium chloride, [2-(methacryloyloxy)ethyl]trimethylammonium chloride, acryloyloxyethyltrimethylammonium chloride, acryloyloxyethyltrimethylbenzylammonium chloride, and benzylvinyltrimethylammonium chloride.
3. The strong anion chromatography medium of claim 1, wherein, The neutral monomers include at least one of N-(3-hydroxypropyl)acrylamide, N-(3-methoxypropyl)acrylamide, N-(2,3-dihydroxypropyl)acrylamide, N-vinylpyrrolidone, vinyl acetate, N-vinylcaprolactam, and 4-acryloylmorpholine.
4. The strong anion chromatography medium of claim 1, wherein, The molar ratio of the charged monomers to the neutral monomers is 10:1 to 1:
1.
5. The strong anion chromatography medium of claim 1, wherein, The matrix is an organic polymer matrix or an inorganic material matrix; the organic polymer matrix includes at least one of polysaccharide, polyacrylamide, polymethacrylamide, poly(hydroxyalkyl vinyl ether), poly(hydroxyalkyl acrylate), polymethacrylate, polyvinyl alcohol, and a polymer based on styrene and divinylbenzene; and the inorganic material matrix includes at least one of silicon dioxide and zirconium oxide.
6. The strong anion chromatography medium of claim 1, wherein, The matrix is a microsphere, and the particle size is monodisperse or polydisperse; the microsphere is non-porous or includes one or more pores.
7. A process for the preparation of a strong anion chromatography medium according to any one of claims 1 to 6, characterized in that, The method comprises the following steps: Constructing carbon-carbon double bond active groups on the surface of the matrix; and bonding mixed functional ligands on the surface of the matrix with the carbon-carbon double bond active groups to obtain a strong anion chromatography medium.
8. The method of claim 7, wherein, The carbon-carbon double bond active groups are constructed by mixing and reacting the matrix, an alkali catalyst, and an epoxy olefin compound.
9. The method of claim 7, wherein, The mixed functional ligands are bonded by mixing the matrix with the carbon-carbon double bond active groups, mixed functional active monomers, and an initiator in water and performing a polymerization reaction; the mixed functional active monomers include the charged monomers and the neutral monomers.
10. Use of a strong anion chromatography medium according to any one of claims 1 to 6 or prepared according to the method of any one of claims 7 to 9 in purifying a nucleic acid drug.
Citation Information
Patent Citations
Sirna conjugate, preparation method therefor and use thereof
CN111655297A
Trans-oligonucleotide, medicinal composition containing it and use thereof
CN1613865A