Promoter derived from bacillus subtilis, modification of promoter and application of promoter in efficient expression of carboxypeptidase

Abstract

The invention discloses a promoter derived from bacillus subtilis, modification of the promoter and application of the promoter in efficient expression of carboxypeptidase. Three different constitutive strong promoters Pcarp-525, Pcarp-551 and Pcarp-1293, which are not reported yet, are separated from a bacillus subtilis 13932 genome for the first time, carboxypeptidase is expressed in bacillus subtilis 168, and the strong promoters are subjected to rational transformation, so that the strong promoters are obtained. The strong promoter subjected to rational modification is used for expression of carboxypeptidase, efficient expression of carboxypeptidase is successfully realized, and the enzyme activity finally reaches 239.21 Uml by combining layer-by-layer optimization of carbon source addition amount, fermentation temperature and inoculum size, and the overall amplification reaches 194.02% compared with the initial level before promoter modification. The promoter efficiently expresses carboxypeptidase in a bacillus subtilis system, and provides a core element for industrial production.

Description

TECHNICAL FIELD

[0001] The present application relates to a Bacillus subtilis promoter and its modification and application in high-level expression of carboxypeptidase, belonging to the field of biological fermentation engineering. BACKGROUND

[0002] As a generally recognized safe (GRAS) industrial host, Bacillus subtilis is widely used in the production of various industrial proteases. However, the expression system has been limited by the low activity of the promoter tool for a long time. The commonly used P 43 , P grac and other constitutive promoters are easily inhibited by metabolic load, while the inducible promoters require corresponding inducers, which increases the production cost and may interfere with the purity of the product.

[0003] Carboxypeptidase is an important proteolytic enzyme that selectively hydrolyzes the peptide bond at the C-terminus of the peptide chain, releasing the C-terminal amino acid. According to the substrate specificity, carboxypeptidase can be divided into various types. Among them, certain carboxypeptidases have broad application prospects in the fields of proinsulin processing, targeted preparation of bioactive polypeptides, enzymatic synthesis of high-value peptide substances, and food protein modification due to their unique substrate specificity. However, the industrial production of carboxypeptidase still faces challenges, mainly manifested as: (1) low yield from natural sources, and complex extraction and purification; (2) due to their special enzymatic properties, some carboxypeptidases require fine expression regulation to ensure their activity and stability. Utilizing an efficient expression system, especially by screening and utilizing new strong promoters to drive high-level expression of carboxypeptidase genes in Bacillus subtilis, is expected to significantly solve the above technical problems and reduce production costs, thereby promoting its widespread application in related industries.

[0004] Non-coding regulatory elements refer to DNA sequences in the genome that do not directly encode proteins but have important regulatory functions. These elements include promoters, enhancers, silencers, and introns, which play a key role in gene expression regulation. Although the functions of the coding genes of Bacillus subtilis 168 have been fully analyzed, the functions of most non-coding regulatory regions in the genome of its close relative Bacillus subtilis 13932 are unknown. SUMMARY

[0005] One object of the present application is to screen and obtain a series of new and efficient constitutive promoters from Bacillus subtilis 13932 for the first time, and successfully identify a strong promoter with excellent transcription activity.

[0006] Another object of the present application is to effectively increase the expression amount of carboxypeptidase by modifying and constructing an efficient strong promoter Bacillus subtilis expression system.

[0007] To achieve the above object, the technical scheme of the present application is as follows:

[0008] The present application provides a method for modifying a promoter derived from Bacillus subtilis and efficiently expressing carboxypeptidase, wherein the recombinant Bacillus subtilis is driven by a promoter P trunc-525 The original promoter P 43 The carboxypeptidase gene is overexpressed in Bacillus subtilis as a host bacterium.

[0009] A strong promoter derived from Bacillus subtilis, three new and unmodified constitutive promoters are screened and obtained from the genome of Bacillus subtilis 13932 for the first time, and the nucleotide sequences are shown as SEQ ID NO: 1-3.

[0010] A promoter P carp-525 , and the nucleotide sequence is shown as SEQ ID NO: 1;

[0011] A promoter P carp-551 , and the nucleotide sequence is shown as SEQ ID NO: 2;

[0012] A promoter P carp-1293 , and the nucleotide sequence is shown as SEQ ID NO: 3;

[0013] The above-mentioned promoters P carp-525 , P carp-551 , and P carp-1293 are derived from Bacillus subtilis 13932, and the strain preservation number is CGMCC No. 13932.

[0014] Preferably, the promoter from Bacillus subtilis 13932, which comprises a modification to its sequence, the modification enables the modified promoter to have enhanced transcriptional activity.

[0015] Preferably, the modification comprises, but is not limited to, deletion, insertion, deletion, substitution of one or more nucleotides, or a combination thereof.

[0016] Preferably, the modified sequence is as shown in SEQ ID NO: 4-6.

[0017] A promoter P trunc-525 , the nucleotide sequence of which is as shown in SEQ ID NO: 4;

[0018] A promoter P trunc-551 , the nucleotide sequence of which is as shown in SEQ ID NO: 5;

[0019] A promoter P trunc-1293 , the nucleotide sequence of which is as shown in SEQ ID NO: 6;

[0020] The above-mentioned promoters P carp-525 , P carp-551 , P carp-1293 , and the modified promoters P trunc-525 , P trunc-551 , P trunc-1293 are used in the high-efficiency expression of carboxypeptidases.

[0021] The sequence of the carboxypeptidase is as shown in SEQ ID NO 7.

[0022] A recombinant vector for regulating the expression of a target gene, the recombinant vector comprising at least one of the above-mentioned promoters P carp-525 , P carp-551 , P carp-1293 , and the modified promoters P trunc-525 , P trunc-551 , P trunc-1293 , and a target gene operably linked to the promoter.

[0023] A host cell comprising the above-mentioned recombinant vector.

[0024] A method for increasing the expression level of a target gene, comprising operably linking the above-mentioned novel promoter to a target gene and introducing it into a host cell.

[0025] Specifically, as shown in one embodiment of the present application, a strong promoter from Bacillus subtilis is connected with a reporter gene GFP to form an expression cassette, a recombinant strain is constructed, and a recombinant Bacillus subtilis B. subtilis 168 / pBE2R-P carp-525 -GFP, B. subtilis 168 / pBE2R-P carp-551 -GFP, B. subtilis 168 / pBE2R-P carp-1293 -GFP.

[0026] The recombinant Bacillus subtilis is first cultured in a seed culture medium at 25-42°C and 200±40 rpm / min for 12-18 h to obtain a seed liquid, then the obtained seed liquid is inoculated into a fermentation culture medium at an inoculation amount of 3-15%, and is fermented at 25-42°C and 200±40 rpm / min for 24-72 h. The fermentation liquid is centrifuged at 8000-12000 rpm / min and 4°C for 10-20 min, the bacterial slurry precipitate is resuspended after being repeatedly washed with 0.9% (w / v) NaCl solution for 5 times, and the resuspended bacterial body suspension is used for reporter gene intensity detection.

[0027] Preferably, the seed culture medium comprises the following components: 10-15 g / L proteose peptone, 5 g / L yeast extract, and 5-10 g / L NaCl, and the pH value of the seed culture medium is 6.5-7.5, and the seed culture medium is sterilized at 121°C for 15 min.

[0028] Preferably, the fermentation culture medium comprises the following components: 10-20 g / L glucose, 10-15 g / L proteose peptone, 5 g / L yeast extract, and 5-10 g / L NaCl, and the pH value of the fermentation culture medium is 6.5-7.5, and the fermentation culture medium is sterilized at 110°C for 10 min.

[0029] Preferably, the detection of the reporter gene related steps are as follows:

[0030] The recombinant microorganism carrying the reporter gene is cultured in a 96-well plate, the culture liquid volume in each well is 50-200 μL, the culture temperature is 28-37°C, the intensity of the reporter gene in the lysis liquid is determined, and the intensity value per unit biomass is used as the relative expression amount of the reporter gene.

[0031] Specifically, as shown in one embodiment of the present application, a strong promoter from Bacillus subtilis is connected with a reporter gene GFP to form an expression cassette, a recombinant strain is constructed, and a recombinant Bacillus subtilis B. subtilis 168 / pBE2R-P trunc- 525-CPs, B. subtilis 168 / pBE2R-P trunc - 552-CPs, B. subtilis 168 / pBE2R-P trunc - 1293-CPs.

[0032] The recombinant B. subtilis is first cultured in a seed medium at 25-42°C, 200±40 rpm / min for 12-18 h to obtain a seed solution, then the obtained seed solution is inoculated in a fermentation medium at an inoculation amount of 3-15%, and is fermented at 25-42°C, 200±40 rpm / min for 36-72 h to obtain a fermentation liquor containing carboxypeptidase. The fermentation liquor is centrifuged at 8000-12000 rpm / min, 4°C for 10-20 min, the bacterial pellet is washed with 0.9% (w / v) NaCl solution for 5 times, resuspended, broken by using an ultrasonic disrupter at a power of 35 W for 5 min, and centrifuged again to obtain the supernatant for detection of carboxypeptidase activity.

[0033] Preferably, the seed medium comprises the following components: 10-15 g / L proteose peptone, 5 g / L yeast extract, and 5-10 g / L NaCl, and the pH value of the seed medium is 6.5-7.5, and the seed medium is sterilized at 121°C for 15 min.

[0034] Preferably, the fermentation temperature is 25-42°C, and more preferably, the fermentation temperature is 38°C.

[0035] Preferably, the inoculation amount is 3-12%, and more preferably, the inoculation amount is 8%.

[0036] Preferably, the fermentation medium comprises the following components: 5-20 g / L glucose, 10-15 g / L proteose peptone, 5 g / L yeast extract, and 5-10 g / L NaCl, and the pH value is 6.5-7.5, and further preferably, the fermentation medium comprises 15 g / L glucose, 10-15 g / L proteose peptone, 5 g / L yeast extract, and 5-10 g / L NaCl, and the pH value is 6.5-7.5.

[0037] Preferably, the steps related to the detection of enzyme activity are as follows:

[0038] The enzyme solution to be detected is reacted with a hydrophobic dipeptide substrate solution (concentration range 1-5 mM) at 30-40°C for 10-60 min, a heavy metal-indophenol complex color developing agent (pH 6.0-8.0) is added, and after heating at 80-95°C for 3-8 min, the reaction is immediately terminated by cooling, the absorbance of the sample solution at a wavelength of 500-520 nm is detected, and the release amount of carboxypeptidase is calculated according to the standard curve of amino acid.

[0039] The application firstly screens 3 novel constitutive promoters (SEQ ID NO: 1-3) from the genome of Bacillus subtilis 13932, and obtains carboxypeptidase by expressing it in Bacillus subtilis and rational modification of the strong promoter. The modified strong promoter (SEQ ID NO: 4-6) is used for the expression of carboxypeptidase. After modification of the target promoter, the carboxypeptidase enzyme activity of the recombinant strain is significantly improved, with an increase of 65%; in order to further improve the enzyme activity level, on the basis of promoter modification, multi-factor optimization is carried out: first, by optimizing the amount of carbon source, the enzyme activity is increased by 30.36% compared with that after promoter modification; then adjust the fermentation temperature, the enzyme activity is increased by 24.46% on the basis of carbon source optimization; finally, optimize the inoculation amount, the enzyme activity is further increased by about 9.83% compared with that after fermentation temperature optimization. After promoter modification and three-layer optimization of carbon source addition amount, fermentation temperature and inoculation amount, the carboxypeptidase enzyme activity of the recombinant strain finally reaches 239.21 U·ml-1, which is 194.02% higher than the initial enzyme activity level before promoter modification, realizing the efficient expression of carboxypeptidase in the recombinant Bacillus subtilis with strong promoter.

[0040] Beneficial effects:

[0041] The application firstly excavates 3 novel constitutive promoters (SEQ ID NO: 1-3) from the genome of Bacillus subtilis 13932, and appropriately deletes the upstream sequence of the promoter, constructs an efficient expression vector in Bacillus subtilis 168, preliminarily verifies it by using a reporter gene, successfully and efficiently expresses carboxypeptidase by using the vector, and further optimizes the fermentation medium, so that the expression amount of carboxypeptidase in Bacillus subtilis 168 with the truncated promoter is increased by 194.02%. Finally, the carboxypeptidase is efficiently expressed in Bacillus subtilis 168 by using the self-modified promoter. BRIEF DESCRIPTION OF DRAWINGS

[0042] Figure 1 Reporter gene intensity before promoter modification;

[0043] Figure 2 Reporter gene intensity after promoter modification;

[0044] Figure 3 Carboxypeptidase expression amount before promoter modification;

[0045] Figure 4 Carboxypeptidase expression amount before and after promoter modification. DETAILED DESCRIPTION

[0046] The application can be better understood by the following examples, and those skilled in the art will readily understand that the specific process conditions and results described in the examples are only for illustrating the application, and should not and will not limit the application described in detail in the claims.

[0047] The strains involved in the following examples are: the starting strain Bacillus subtilis 168 model strain, the starting strain Bacillus subtilis CGMCC No. 13932, which is from the China General Microbiological Culture Collection Center, and the preservation number is CGMCC No. 13932; the strain E. coli DH5α used for constructing the expression plasmid is purchased from Tian Gen Biochemical Technology (Beijing) Co., Ltd., and the carboxypeptidase gene is synthesized by General Biosystems (Anhui) Co., Ltd. and constructed in the plasmid pBE2R-CPs (the carboxypeptidase gene has homology with Bacillus sp. PAMC26568).

[0048] The GFP reporter gene in the examples is derived from the commercial plasmid pGFP4412 and the plasmid pBE2R described in the examples, which are both purchased from Wuhan Moli Biological Technology Co., Ltd.

[0049] The PCR enzyme 2xPhanta Max Master Mix used in the examples is purchased from Novozyme, the restriction endonucleases KpnI, EcoRI, BamH I, HindIII and the one-step cloning kit ClonExpress II One Step Cloning Kit are purchased from Takara, and the primers are synthesized by General Biosystems (Anhui) Co., Ltd.

[0050] The recombinant Bacillus subtilis described in the examples is constructed in the laboratory.

[0051] Example 1 Recombinant Bacillus subtilis B. subtilis 168 / pBE2R-P carp-525 -GFP, B. subtilis 168 / pBE2R-P carp-551 -GFP, B. subtilis 168 / pBE2R-P carp-1293 Construction and screening of B. subtilis 168 / pBE2R-P

[0052] 1) Using the genome of Bacillus subtilis 13932 as a template, the carboxypeptidase gene was amplified by PCR using the primers carp-525-F and carp-525-R.

[0053] Upstream primer carp-525-F: tgtacgttccttaaggaattcAGTAAATCAGTTTCGTTT

[0054] Downstream primer carp-551-R: tctcttacctataatggtacc TTGATTTCCCCTCTCTAAA

[0055] Upstream primer carp-551-F: tgtacgttccttaaggaattc ACCAATTGTGGGCTTATTTTTT

[0056] Downstream primer carp-551-R: tctcttacctataatggtacc TTGATTTCCCCTCTCTAAA

[0057] Upstream primer carp-1293-F: tgtacgttccttaaggaattc ACGTATTTTCCCCACTAAG

[0058] Downstream primer carp-1293-R: tctcttacctataatggtacc GTATGTTTGGATGAATA

[0059] 2) PCR amplification of the promoter P carp-525 , P carp-551 , P carp-1293 fragments, the PCR amplification system is shown in Table 1. The PCR conditions are as follows: pre-denaturation at 95°C for 5 min, denaturation at 95°C for 30 s, annealing at 60°C for 30 s, extension at 72°C for 5 min, final extension at 72°C for 5 min, and storage at 4°C for 59 min; the number of cycles is 30.

[0060] 3) Double enzyme digestion reaction of the plasmid pBE2R-GFP using restriction enzymes Kpnl and EcoRI, which linearizes pBE2R-GFP and simultaneously removes the original promoter sequence between the enzyme digestion sites of the plasmid, the double enzyme digestion system is shown in Table 2.

[0061] 4) PCR amplification of the linearized vector pBE2R-GFP, the PCR amplification system is shown in Table 3, and a one-step cloning kit is used to fuse the promoter P carp-525 , P carp-551 , P carp-1293 fragment to the position of the original promoter P 43 of the plasmid by using a homologous recombination enzyme, to obtain the plasmids pBE2R-P carp-525 -GFP, pBE2R-P carp-551 -GFP, and pBE2R-P carp-1293 -GFP.

[0062] Table 1. PCR system of the promoter fragment

[0063] System 50 µL Template 1 µL Upstream primer 2 µL Downstream primer 2 µL 2x Phanta Max Master Mix 25 µL DD H2O Up to 50 µL

[0064] Table 2 Double enzyme digestion system

[0065] System 10 µL Buffer 1 µL KpnI 1 µL EcoRI 1 µL DNA 5 µL DD H2O Up to 10 µL

[0066] Table 3 pBE2R-GFP PCR system

[0067] System 50 µL Template 1 µL Upstream primer pBE2R-GFP-F 2 µL Downstream primer pBE2R-GFP-R 2 µL 2x Phanta Max Master Mix 25 µL DD H2O Up to 50 µL

[0068] 5) The above three recombinant plasmids pBE2R-P carp-525 -GFP, pBE2R-P carp-551 -GFP, pBE2R-P carp-1293 -GFP were transformed into E. coli DH5a. Positive recombinants were screened on 100 mg / L ampicillin-containing plates. Positive colonies were screened by colony PCR, and the positive recombinants were extracted after overnight culture for double enzyme digestion verification. After verification, they were sent to the company for sequencing;

[0069] 6) The successfully sequenced recombinant plasmids were transformed into Bacillus subtilis 168 competent cells to obtain recombinant Bacillus subtilis B. subtilis 168 / pBE2R-P carp-525 -GFP, B. subtilis 168 / pBE2R-P carp-551 -GFP-GFP, B. subtilis 168 / pBE2R-P carp-1293 -GFP.

[0070] Among them, the preparation and transformation steps of B. subtilis 68 competent cells are as follows:

[0071] (1) Pick a single colony of B. subtilis 168 and inoculate it into 5 mL GMI medium, and incubate it overnight at 37°C in a constant temperature shaker;

[0072] (2) Transfer 2 mL of the overnight culture into 5 mL of GMI medium and incubate it at 37°C in a shaker for 4 h, then start detecting the OD600 value. When the OD600 is about 1.0, transfer 10 mL of the bacterial solution into 90 mL of GMII medium and incubate it at 37°C, 200 rpm in a shaker for 1.5 h;

[0073] (3) Centrifuge at 4°C for 10 min to collect the bacterial cells, reserve 10 mL of the liquid for resuspending the bacterial cells, and divide 500 μL of the bacterial solution into 1.5 mL centrifuge tubes.

[0074] (4) Add the plasmid after sequencing verification into the tube, mix well by blowing and sucking, and then place in a 37℃, 200 rpm shaker for 2 h of culture;

[0075] (5) After the culture ends, centrifuge at 5000 rpm to collect the bacterial bodies, discard part of the supernatant, leave 100 μL of resuspended bacterial bodies to be coated on a kanamycin-resistant plate, and culture at 37℃ overnight.

[0076] 7) The colonies grown on the kanamycin-resistant plate are the successfully constructed recombinant B. subtilis 168 / pBE2R-P carp-525 -GFP, B. subtilis 168 / pBE2R-P carp-551 -GFP-GFP, B. subtilis 168 / pBE2R-P carp-1293 -GFP.

[0077] 8) Plate medium: 10 g / L of proteose peptone, 5 g / L of yeast extract, 10 g / L of NaCl, 20 g / L of agar, add distilled water to 1000 ml, pH naturally, sterilize at 121℃ for 20 min.

[0078] 9) Seed medium: 10 g / L of proteose peptone, 5 g / L of yeast extract, 10 g / L of NaCl, the pH value of the seed medium is 7.0, sterilize at 121℃ for 15 min.

[0079] 10) Fermentation medium: 10 g / L of glucose, 10 g / L of proteose peptone, 5 g / L of yeast extract, 10 g / L of NaCl, the pH value of the fermentation medium is 7.5, sterilize at 10℃ for 10 min.

[0080] 11) Take the recombinant B. subtilis 168 / pBE2R-P carp-525 -GFP, B. subtilis 168 / pBE2R-P carp-551 -GFP-GFP, B. subtilis 168 / pBE2R-P carp-1293 -GFP and the recombinant B. subtilis 168 / pBE2R-P 43 -GFP are respectively coated on a fresh LB plate medium, and activated and cultured at 37℃ overnight.

[0081] 12) Respectively from the recombinant B. subtilis 168 / pBE2R-P carp-525 -GFP, B. subtilis 168 / pBE2R-P carp-551-GFP, B. subtilis 168 / pBE2R-P carp-1293 -GFP and recombinant Bacillus subtilis 168 / pBE2R-P 43 -GFP activated plate was picked up a ring inoculated in seed liquid medium, 35°C, 180 rpm alone culture 12 h, to obtain the seed liquid.

[0082] 13) The seed liquid was inoculated in 100 mL fermentation medium (500 mL flask) with 10% inoculation amount, 35°C, 200 rpm culture for 60 h, to obtain the fermentation broth containing reporter gene.

[0083] 14) The fermentation broth was centrifuged at 8000-12000 rpm / min, 4°C for 10-20 min, and the bacterial pellet was resuspended after repeated washing with 0.9% (w / v) NaCl solution for 5 times. The bacterial suspension obtained after washing and resuspension was used for reporter gene intensity detection, and the results were as follows Figure 1 .

[0084] Example 2 Promoter P carp-525 , P carp-551 , P carp-1293 engineering

[0085] 1) The upstream sequence of the promoter P carp-525 was truncated to obtain the promoter P trunc-525 , the sequence of which is shown as SEQ ID NO: 4,

[0086] 2) The upstream sequence of the promoter P carp-551 was truncated to obtain the promoter P trunc-551 , the nucleotide sequence of which is shown as SEQ ID NO: 5;

[0087] 3) The upstream sequence of the promoter P carp-1293 was truncated to obtain the promoter P trunc-1293 , the nucleotide sequence of which is shown as SEQ ID NO: 6;

[0088] Using Bacillus subtilis 13932 genome as a template, the following primers were used:

[0089] Upstream primer trunc-525-F: tgtacgttccttaaggaattcATTATCAATATTTCCATATAT

[0090] Downstream primer trunc-525-R: tctcttacctataatggtaccAATATCACCTCCTCGTT

[0091] Upstream primer trunc-551-F: tgtacgttccttaaggaattcCGTGAAAAAATTCTTTGATGAGAATAA

[0092] Downstream primer trunc-551-R: tctcttacctataatggtaccTTGATTTCCCCTCTCTAAAA

[0093] Upstream primer trunc-1293-F: tgtacgttccttaaggaattcAGTTTACCTCACCGATTCATTA

[0094] Downstream primer trunc-1293-R: tctcttacctataatggtaccGTATGTTTGGATGAATAACT

[0095] 4) Recombinant plasmids pBE2R-P trunc-525 -GFP, pBE2R-P trunc-551 -GFP and pBE2R-P trunc-1293 -GFP.

[0096] 5) Three recombinant plasmids constructed successfully by sequencing were transformed into Bacillus subtilis 168 competent cells according to the method in Example 1, obtaining recombinant Bacillus subtilis 168 / pBE2R-P trunc-525 -GFP, B. subtilis 168 / pBE2R-P trunc-551 -GFP, B. subtilis 168 / pBE2R-P trunc-1293 -GFP.

[0097] 6) Recombinant Bacillus subtilis 168 / pBE2R-P trunc-525 -GFP, B. subtilis 168 / pBE2R-P trunc-551 -GFP, B. subtilis 168 / pBE2R-P trunc-1293 -GFP reporter gene intensity data, the results are shown in Figure 2 , indicating that retaining the core region of the promoter while appropriately deleting the upstream sequence thereof can enhance the transcriptional activity thereof.

[0098] Example 3 Recombinant Bacillus subtilis 168 / pBE2R-P carp-525- CPs, B. subtilis 168 / pBE2R-P carp-551 - CPs, B. subtilis 168 / pBE2R-P carp-1293 Construction of - CPs.

[0099] 1) Promoter P carp-525 , P carp-551 , P carp-1293 The promoter fragment was amplified by PCR. The method was the same as that in Example 1.

[0100] 2) The plasmid pBE2R-CPs was treated with restriction enzymes Kpnl and EcoRI to carry out a double enzyme digestion reaction, which linearized pBE2R-CPs on one hand and removed the original promoter sequence between the enzyme digestion sites of the plasmid on the other hand. The double enzyme digestion system is shown in Table 2.

[0101] 3) The linearized vector pBE2R-CPs was amplified by PCR. The PCR amplification system is shown in Table 4. The promoter P carp-525 , P carp-551 , P carp-1293 fragment was fused into the position of the original promoter P 43 of the plasmid by using a one-step cloning kit and a homologous recombination enzyme to obtain the plasmid pBE2R-P carp-525 -CPs, pBE2R-P carp-551 -CPs, pBE2R-P carp-1293 -CPs.

[0102] Table 4 PCR system of pBE2R-CPs

[0103] System 50 µL Template 1 µL Upstream primer pBE2R-CPs-F 2 µL Downstream primer pBE2R-CPs-R 2 µL 2x Phanta Max Master Mix 25 µL DD H2O Up to 50 µL

[0104] 4) The three recombinant plasmids pBE2R-P carp-525 -CPs, pBE2R-P carp-551 -CPs, pBE2R-P carp-1293 -CPs were transformed into E. coli DH5a, and the method was the same as that in Example 2.

[0105] 5) The recombinant plasmid with successful sequencing was transformed into Bacillus subtilis 168 competent cells to obtain the recombinant Bacillus subtilis B. subtilis 168 / pBE2R-P carp-525 -CPs, B. subtilis 168 / pBE2R-P carp-551 -CPs, B. subtilis 168 / pBE2R-P carp-1293 -CPs.

[0106] 6) Plate medium: Tryptone 10 g / L, yeast extract 5 g / L, NaCl 10 g / L, agar 20 g / L, add distilled water to 1000 ml, pH natural, sterilize at 121 °C for 20 min.

[0107] 7) Seed medium: Tryptone 10 g / L, yeast extract 5 g / L, NaCl 10 g / L, the pH value of the seed medium is 7.0, sterilize at 121 °C for 15 min.

[0108] 8) Fermentation medium: Glucose 10 g / L, tryptone 10 g / L, yeast extract 5 g / L, NaCl 10 g / L, the pH value of the fermentation medium is 7.5, sterilize at 10 °C for 10 min.

[0109] 9) Recombinant B. subtilis 168 / pBE2R-P carp-525 -CPs, B. subtilis 168 / pBE2R-P carp-551 -CPs, B. subtilis 168 / pBE2R-P carp-1293 -CPs and recombinant B. subtilis 168 / pBE2R-P 43 -CPs were respectively inoculated on fresh LB plate medium, and incubated at 37 °C overnight.

[0110] 10) Recombinant B. subtilis 168 / pBE2R-P carp-525 -CPs, B. subtilis 168 / pBE2R-P carp-551 -CPs, B. subtilis 168 / pBE2R-P carp-1293 -CPs and recombinant B. subtilis 168 / pBE2R-P 43 -CPs were respectively inoculated on fresh LB plate medium, and incubated at 37 °C overnight.

[0111] 11) The seed liquid was inoculated in 100 mL fermentation medium (500 mL flask) at an inoculation amount of 10%, and incubated at 35 °C and 200 rpm for 60 h to obtain a fermentation liquid containing carboxypeptidase.

[0112] 12) centrifuging the fermentation broth at 8000-12000 rpm / min, 4℃ for 10-20 min, washing the bacterial pellet repeatedly 5 times with 0.9% (w / v) NaCl solution after resuspension, crushing it with an ultrasonic disrupter at a power of 35W for 5 min, and centrifuging again to take the supernatant for detection of carboxypeptidase enzyme activity. The results are shown in Table 1 Figure 3 , indicating that the carboxypeptidase expression system was successfully constructed in the recombinant B. subtilis 168, and the promoters P carp-525 , P carp-551 , P carp-1293 all had higher enzyme activity than the promoter P 43 .

[0113] Example 4 Evaluation of the difference in carboxypeptidase enzyme activity produced by the strain before and after modification of the promoter

[0114] 1) Using the B. subtilis 13932 genome as a template, the following primers were used:

[0115] upstream primer trunc-525-F: tgtacgttccttaaggaattcATTATCAATATTTCCATATAT

[0116] downstream primer trunc-525-R: tctcttacctataatggtaccAATATCACCTCCTCGTT

[0117] upstream primer trunc-551-F: tgtacgttccttaaggaattcCGTGAAAAAATTCTTTGATGAGAATAA

[0118] downstream primer trunc-551-R: tctcttacctataatggtaccTTGATTTCCCCTCTCTAAAA

[0119] upstream primer trunc-1293-F: tgtacgttccttaaggaattcAGTTTACCTCACCGATTCATTA

[0120] downstream primer trunc-1293-R: tctcttacctataatggtaccGTATGTTTGGATGAATAACT

[0121] PCR amplification of the promoters P trunc-525 , P trunc-551 , P trunc-1293The PCR amplification system is shown in Table 1. The PCR conditions are as follows: pre-denaturation at 95°C for 5 min, denaturation at 95°C for 30 s, annealing at 60°C for 30 s, extension at 72°C for 5 min, final extension at 72°C for 5 min, and storage at 4°C for 59 min; and the cycle number is 30. The method is the same as in Example 1.

[0122] 2) Perform PCR amplification on the linearized vector pBE2R-CPs in the method of Example 3, and use the one-step cloning kit to fuse the promoter P trunc-525 , P trunc-551 , P trunc-1293 fragments into the original promoter P 43 position of the plasmid. The constructed plasmids are pBE2R-P trunc-525 -CPs, pBE2R-P trunc-551 -CPs, and pBE2R-P trunc-1293 -CPs. The method is the same as in Example 3.

[0123] 3) Transform the above three recombinant plasmids pBE2R-P trunc-525 -CPs, pBE2R-P trunc-551 -CPs, and pBE2R-P trunc-1293 -CPs into E. coli DH5α. The method is the same as in Example 3.

[0124] 4) Transform the successfully sequenced recombinant plasmids into Bacillus subtilis 168 competent cells to obtain recombinant Bacillus subtilis 168 / pBE2R-P trunc-525 -CPs, B. subtilis 168 / pBE2R-P trunc-552 -CPs, and B. subtilis 168 / pBE2R-P trunc-1293 -CPs.

[0125] 5) The plate medium, seed medium, and fermentation medium are the same as in Example 3.

[0126] Take the recombinant Bacillus subtilis 168 / pBE2R-P trunc-525 -CPs, B. subtilis 168 / pBE2R-P trunc-552 -CPs, B. subtilis 168 / pBE2R-P trunc-1293 -CPs, and recombinant Bacillus subtilis 168 / pBE2R-P 43 -CPs stored at -80°C, and inoculate them on fresh LB plate medium, and incubate them at 37°C overnight for activation.

[0127] 6) Respectively from recombinant B. subtilis 168 / pBE2R-P trunc-525 -CPs, B. subtilis 168 / pBE2R-trunc-551-CPs, B. subtilis 168 / pBE2R-P trunc-1293 -CPs and recombinant B. subtilis 168 / pBE2R-P 43 -CPs were inoculated in seed liquid culture medium with a loop, cultured alone at 35°C, 180 rpm for 12 h to obtain seed liquid.

[0128] 7) The seed liquid was inoculated in 100 mL fermentation medium (500 mL flask) at 10% inoculation amount, cultured at 35°C, 200 rpm for 60 h to obtain fermentation liquid containing carboxypeptidase.

[0129] 8) The fermentation liquid was centrifuged at 8000-12000 rpm / min, 4°C for 10-20 min, the bacterial pellet was washed with 0.9% (w / v) NaCl solution for 5 times and resuspended, and then broken by ultrasonic disrupter at a power of 35W for 5 min, and the supernatant was collected for detection of carboxypeptidase activity.

[0130] 9) The results of comparison of the activity of the truncated promoter with that of the original promoter are shown in Table 1 Figure 4 , which shows that the activity of the original promoter P carp-525 , P carp-551 , P carp-1293 was improved after truncation of the upstream sequence to obtain the modified promoter P trunc-525 , P trunc-551 , P trunc-1293 , which all improved the enzyme production in B. subtilis 168, and the recombinant B. subtilis 168 / pBE2R-P trunc-525 -CPs produced the most obvious improvement in enzyme production, which was increased by 65% compared with the original, and the expression reached 134.24 U・ml⁻¹, while the recombinant B. subtilis 168 / pBE2R-P trunc-551 -CPs and the recombinant B. subtilis 168 / pBE2R-P trunc-1293 -CPs were increased by 42% and 55.5% respectively compared with the original, so the promoter P trunc-525 was selected for further optimization.

[0131] Example 5 Optimization of fermentation conditions of carboxypeptidase-producing strain

[0132] I. Effect of carbon source addition amount on carboxypeptidase enzyme activity

[0133] 1) Plate medium: 10 g / L of proteose peptone, 5 g / L of yeast extract, 10 g / L of NaCl, 20 g / L of agar, add distilled water to 1000 ml, pH naturally, sterilize at 121°C for 20 min.

[0134] 2) Seed medium: 10 g / L of proteose peptone, 5 g / L of yeast extract, 10 g / L of NaCl, the pH value of the seed medium is 7.0, sterilize at 121°C for 15 min.

[0135] 3) Fermentation medium: glucose addition amount is set to 5 g / L (fermentation medium 1), 10 g / L (fermentation medium 2), 15 g / L (fermentation medium 3), 20 g / L (fermentation medium 4), 25 g / L (fermentation medium 5), 10 g / L of proteose peptone, 5 g / L of yeast extract, 10 g / L of NaCl, the pH value of the fermentation medium is 7.5, sterilize at 110°C for 10 min.

[0136] 4) Recombinant B. subtilis 168 / pBE2R-P trunc525 -CPs are coated on fresh LB plate medium and incubated at 37°C overnight for activation.

[0137] 5) The activated plate of recombinant B. subtilis 168 / pBE2R-P trunc-525 -CPs is inoculated with a ring in the seed liquid medium, cultured at 35°C and 180 rpm for 12 h, and a seed liquid is obtained.

[0138] 6) The seed liquid is inoculated in 100 mL of fermentation medium (500 mL flask) with different carbon source addition amounts at an inoculation amount of 10%, and cultured at 35°C and 200 rpm for 60 h to obtain a fermentation liquid containing carboxypeptidase.

[0139] 7) The fermentation liquid is centrifuged at 8000-12000 rpm / min and 4°C for 10-20 min, the bacterial pellet is washed with 0.9% (w / v) NaCl solution for 5 times, resuspended, broken by an ultrasonic disrupter at a power of 35W for 5 min, and the supernatant is collected by centrifugation for detection of carboxypeptidase enzyme activity. The results are shown in Table 5.

[0140] Table 5 Effect of different fermentation media on enzyme production by bacteria

[0141] Fermentation medium Enzyme activity (U / ml) Fermentation medium 1 94.01 Fermentation medium 2 134.24 Fermentation medium 3 175.00 Fermentation medium 4 148.80 Fermentation medium 5 106.79

[0142] The experimental results show that the recombinant Bacillus subtilis B. subtilis 168 / pBE2R-P trunc-525 The optimal carbon source addition concentration for expressing carboxypeptidase by the CPs is 15 g / L. At this time, the enzyme activity reaches a peak (175.00 U / ml). Below this concentration, enzyme production is limited by insufficient carbon source; above this concentration, cell activity and protein expression are inhibited due to typical overflow metabolism (accumulation of acetic acid) and carbon metabolic substance repression (CCR) effects of Bacillus subtilis.

[0143] II. Effect of different fermentation temperatures on carboxypeptidase enzyme activity

[0144] 1) Plate medium: 10 g / L of proteose peptone, 5 g / L of yeast extract, 10 g / L of NaCl, 20 g / L of agar, add distilled water to 1000 ml, pH naturally, sterilize at 121°C for 20 min.

[0145] 2) Seed medium: 10 g / L of proteose peptone, 5 g / L of yeast extract, 10 g / L of NaCl, the pH value of the seed medium is 7.0, sterilize at 121°C for 15 min.

[0146] 3) Fermentation medium: 15 g / L of glucose, 10 g / L of proteose peptone, 5 g / L of yeast extract, 10 g / L of NaCl, the pH value of the fermentation medium is 7.5, sterilize at 110°C for 10 min.

[0147] 4) Take the recombinant Bacillus subtilis B. subtilis 168 / pBE2R-P trunc-525 -CPs are coated on fresh LB plate medium and activated at 37°C overnight.

[0148] 5) From the recombinant Bacillus subtilis B. subtilis 168 / pBE2R-P trunc-525 -CPs, a ring is picked from the activated plate and inoculated in the seed liquid medium, cultured at 35°C at 180 rpm for 12 h, and a seed liquid is obtained.

[0149] 6) The seed liquid is inoculated in 100 mL of fermentation medium (500 mL flask) with different carbon source addition amounts at an inoculation amount of 10%, the temperature is set to 25°C, 30°C, 35°C, 38°C, 40°C and 42°C respectively, and cultured at 200 rpm for 60 h to obtain a fermentation liquid containing carboxypeptidase.

[0150] 7) The fermentation broth was centrifuged at 8000-12000 rpm / min, 4°C for 10-20 min, the bacterial pellet was resuspended after repeated washing with 0.9% (w / v) NaCl solution for 5 times, and was broken by ultrasonic disrupter at a power of 35 W for 5 min, and the supernatant was centrifuged again for the detection of carboxypeptidase enzyme activity. The results are shown in Table 6.

[0151] Table 6 Enzyme activity at different temperatures

[0152] Fermentation temperature Enzyme activity (U / ml) 25℃ 108.90 30℃ 163.42 35℃ 175.00 38℃ 217.84 40℃ 185.56 42℃ 140.13

[0153] The experimental results show that the fermentation temperature has a significant influence on the expression of carboxypeptidase. The recombinant B. subtilis 168 / pBE2R-P trunc-525 The expression of carboxypeptidase by the recombinant B. subtilis 168 / pBE2R-P

[0154] III. Influence of different inoculation amounts on carboxypeptidase enzyme activity

[0155] 1) Plate medium: 10 g / L of proteose peptone, 5 g / L of yeast extract, 10 g / L of NaCl, 20 g / L of agar, and distilled water to 1000 ml, pH naturally, 121°C sterilization for 20 min.

[0156] 2) Seed medium: 10 g / L of proteose peptone, 5 g / L of yeast extract, and 10 g / L of NaCl, the pH value of the seed medium is 7.0, 121°C sterilization for 15 min.

[0157] 3) Fermentation medium: 15 g / L of glucose, 10 g / L of proteose peptone, 5 g / L of yeast extract, and 10 g / L of NaCl, the pH value of the fermentation medium is 7.5, 10°C sterilization for 10 min.

[0158] 4) The recombinant B. subtilis 168 / pBE2R-P trunc-525 -CPs stored at -80°C were respectively inoculated on fresh LB plate medium, and activated at 37°C overnight.

[0159] 5) A ring was picked from the activated plate of the recombinant B. subtilis 168 / pBE2R-P trunc-525 -CPs, inoculated in the seed liquid medium, and cultured at 35°C, 180 rpm for 12 h to obtain the seed liquid.

[0160] 6) The seed liquid was inoculated into 100 mL fermentation medium (500 mL flask) with different carbon source addition amounts at 3%, 5%, 8%, 10%, and 12% inoculation amounts, respectively, and cultured at 38°C and 200 rpm for 60 h to obtain the fermentation liquid containing carboxypeptidase.

[0161] 7) The fermentation liquid was centrifuged at 8000-12000 rpm / min at 4°C for 10-20 min, the bacterial pellet was washed with 0.9% (w / v) NaCl solution for 5 times, resuspended, broken by using an ultrasonic disrupter at a power of 35 W for 5 min, and the supernatant was collected by centrifugation for detection of carboxypeptidase activity. The results are shown in Table 7.

[0162] Table 7 Enzyme activity of different inoculation amounts

[0163] Inoculum Enzyme activity (U / ml) 3% 155.57 5% 210.53 8% 239.21 10% 217.80 12% 203.34

[0164] The experimental results show that the inoculation amount has an important influence on the fermentation enzyme production process. When the recombinant B. subtilis 168 / pBE2R-P trunc-525 -CPs expresses carboxypeptidase, the enzyme activity is the highest when the inoculation amount is 8%, reaching 239.21 U / ml. Too low inoculation amount will cause the fermentation period to be prolonged, and too high inoculation amount will cause oxygen limitation and nutrient competition in the initial stage, which are not conducive to the final accumulation of enzyme.

[0165] Through comprehensive analysis of the above experimental results, appropriately deleting the redundant sequence upstream of the promoter and retaining the core part can significantly improve the transcription intensity of the promoter. The transcription activities of the three promoters P trunc-525 , P trunc-551 , and P trunc-1293 are all enhanced to different degrees (as shown in Figure 2 , 4 ), among which P trunc-525 has the most obvious activity improvement, which is increased by 65% compared with the original. Then, the recombinant B. subtilis 168 / pBE2R-P trunc-525 -CPs was subjected to multi-factor fermentation optimization, and finally the carboxypeptidase activity of the recombinant B. subtilis 168 / pBE2R-P trunc-525 -CPs was increased to 194.02%, and the expression amount reached 239.21 U・ml⁻¹.

Claims

1. A strong promoter derived from Bacillus subtilis, characterized in that, The strong promoter was obtained by screening the genome of Bacillus subtilis 13932. carp-525 P carp-551 P carp-1293 The nucleotide sequences are shown in SEQ ID NO:1-3, respectively.

2. The strong promoter derived from Bacillus subtilis according to claim 1, characterized in that, The promoter includes modifications to its sequence, including but not limited to deletions, insertions, omissions, substitutions, or combinations thereof of one or more nucleotides, which enable the modified promoter to have enhanced transcriptional activity.

3. The strong promoter derived from Bacillus subtilis according to claim 2, characterized in that, The modified promoter is P trunc-525 P trunc-551 P trunc-1293 The sequences are shown in SEQ ID NO:4-6 respectively.

4. The use of the strong promoter derived from Bacillus subtilis as described in any one of claims 1 to 3 in carboxypeptidase expression.

5. The application according to claim 4, characterized in that, The sequence of the carboxypeptidase is shown in SEQ ID NO.

7.

6. The application according to claim 5, characterized in that, A strong promoter was linked to a carboxypeptidase gene to form an expression cassette, which was then introduced into host cells to construct recombinant Bacillus subtilis for efficient expression of carboxypeptidase.

7. The application according to claim 6, characterized in that, The host cell is Bacillus subtilis (Bacillus subtilis) Bacillus subtilis 168.

8. The application according to claim 6, characterized in that, The recombinant Bacillus subtilis was first cultured in a seed culture medium at 25-42℃ and 200±40 rpm / min for 12-18 h to obtain a seed liquid. The obtained seed liquid was then inoculated into a fermentation culture medium at an inoculation rate of 3-15%, and fermented at 25-42℃ and 200±40 rpm / min for 36-72 h to obtain a fermentation broth containing carboxypeptidase.

9. The application according to claim 8, characterized in that, The seed culture medium comprises the following components: 10-15 g / L peptone, 5 g / L yeast extract, and 5-10 g / L NaCl. The pH of the seed culture medium is 6.5-7.5, and it is sterilized at 121°C for 15 min.

10. The application according to claim 8, characterized in that, The fermentation medium comprises the following components: glucose 10-20 g / L, peptone 10-15 g / L, yeast extract 5 g / L, and NaCl 5-10 g / L. The pH of the fermentation medium is 6.5-7.5, and it is sterilized at 110°C for 10 min.

Images