Directional editing tool for genome of gramineous plant based on transposon-coded nuclease
By constructing plant genome editing systems using the coding sequences of transposon-encoded nucleases IsDge10, IsAam1, or enIscB, the problem of difficult delivery of CRISPR-Cas9 and Cas12a nucleases has been solved, enabling efficient targeted genome editing in plants, especially editing of non-coding regions.
Patent Information
- Application Number
- CN202511427206.7
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Priority Date
- 2024-05-31
- Filing Date
- 2025-05-30
- Publication Date
- 2025-12-12
AI Technical Summary
The large size of existing CRISPR-Cas9 and Cas12a nucleases makes it difficult to deliver genome editing tools, limiting their application in plants.
A plant genome editing system was constructed using the coding sequences of transposon-encoded nucleases IsDge10, IsAam1, or enIscB. The system includes transposon nuclease protein expression units and reRNA transcription expression cloning units, and is applicable to monocotyledons and gymnosperms. It recognizes TAM sequences for gene editing.
It enables efficient targeted genome editing in plants, especially editing of non-coding regions. The editing system is smaller and easier to deliver, and is applicable to grass plants such as rice, maize, sorghum, sugarcane, and wheat.
Smart Images

Figure CN121109441A_ABST
Abstract
Description
[0001] The present application is a divisional application of Chinese patent application No. 202510714172.3, entitled “Plant genome directed editing tool based on transposon-encoded nuclease”, filed on May 30, 2025. Chinese patent application No. 202510714172.3 claims priority to Chinese patent application No. 202410701975.0, filed on May 31, 2024. The present application also claims priority to Chinese patent application No. 202410701975.0. TECHNICAL FIELD
[0002] The present application belongs to the field of genetic engineering, and relates to a genome directed editing tool for plants in the family Poaceae based on a transposon-encoded nuclease. BACKGROUND
[0003] Genome directed editing technology is a frontier and hotspot field of biological research, which realizes precise genome directed editing through deletion, substitution, knock-in or nucleotide correction of specific regions of the genome. The CRISPR-Cas9 (Clustered regularly interspaced short palindromic repeats CRISPR-associated 9) system reported in 2012 has been widely used in the functional analysis of genes, the creation of new germplasm and genetic improvement of animals, plants and microorganisms due to its advantages of simple design and operation, high editing efficiency and wide universality. After the CRISPR-Cas9 system, researchers developed a new V-A type CRISPR-Cas system, CRISPR-Cas12a. However, the existing CRISPR-Cas9 and Cas12a nucleases have a large size (>1000Aa), which makes them face the problem of difficult delivery. Therefore, further development of compact nuclease genome editing systems with smaller size can effectively improve the delivery efficiency of editing tools, and thus expand the application range of plant genome editing tools.
[0004] Recently, researchers reported a compact TnpB nuclease system encoded by transposon (IS200 / IS605) (Xiang et al., 2023). The TnpB system contains a nuclease protein of about 391 amino acids and a reRNA (i.e. right element RNA, a long non-coding RNA derived from the RE element in ISDra2 transposon) expression unit, which can achieve single reRNA-guided DNA cleavage. The molecular weight of TnpB is only about one-third of Cas9 and Cas12a genome editing enzymes, providing an advantage for genome editing tool delivery. However, TnpB has only shown editing activity in mammalian cells, and genome editing tool development in plants has not yet been achieved. Therefore, the application prospect of TnpB system in plant genome editing is still unclear. SUMMARY
[0005] The technical problem to be solved by the present application is that the large protein size of CRISPR-Cas9 and Cas12a makes it difficult to deliver, which greatly limits the application range of plant genome editing tools based thereon.
[0006] The technical solution of the present application is a coding sequence of a transposon nuclease suitable for plant genome editing, which is the coding sequence of IsDge10, IsAam1 or enIscB. The coding sequence of IsDge10 is shown in Seq ID No. 13; the coding sequence of IsAam1 is shown in Seq ID No. 14; and the coding sequence of enIscB is shown in Seq ID No. 15.
[0007] The present application also provides an application of the above-mentioned coding sequence of the transposon nuclease in constructing a plant genome editing system.
[0008] The present application also provides a plant genome editing system based on a transposon nuclease, which comprises a transposon nuclease protein expression unit with the structure of promoter-transposon nuclease-terminator.
[0009] Among them, the transposon nuclease is a TnpB type transposon nuclease or an IscB type transposon nuclease.
[0010] Further, the TnpB type transposon nuclease is IsDge10 or IsAam1.
[0011] Further, the IscB type transposon nuclease is enIscB.
[0012] Specifically, the coding sequence of IsDge10 is shown in Seq ID No. 13.
[0013] Specifically, the coding sequence of IsAam1 is shown in Seq ID No. 14.
[0014] Specifically, the coding sequence of enIscB is shown in Seq ID No. 15.
[0015] Further, the 5' or / and 3' end of the transposon nuclease in the transposon nuclease protein expression unit is further fused with NLS.
[0016] Preferably, the plant genome editing system described above further comprises a reRNA transcription expression cloning unit, which has the structure of promoter-reRNA scaffold-terminator.
[0017] Further, the reRNA scaffold of the same type of transposon nuclease can be used interchangeably in the plant genome editing system described above. Further, the reRNA scaffold can be shown in the 12754-12936bp of Seq ID No. 1, Seq ID No. 12 or Seq ID No. 2.
[0018] Preferably, when the TnpB type transposon nuclease is used, the nucleotide sequence of the reRNA scaffold is shown in the 12754-12936bp of Seq ID No. 1 or Seq ID No. 12; when the IscB type transposon nuclease is used, the nucleotide sequence of the reRNA scaffold is shown in Seq ID No. 2.
[0019] More preferably, when the transposon nuclease used is IsDge10, the nucleotide sequence of the reRNA scaffold is shown in the 12754-12936bp of Seq ID No. 1 or Seq ID No. 12; when the transposon nuclease used is IsAam1, the nucleotide sequence of the reRNA scaffold is shown in the 12754-12936bp of Seq ID No. 1 or Seq ID No. 12; when the transposon nuclease used is enIscB, the nucleotide sequence of the reRNA scaffold is shown in Seq ID No. 2.
[0020] Specifically, the 5' or 3' end of the reRNA scaffold in the reRNA transcription expression cloning unit is further fused with lacZα.
[0021] Further, the two ends of lacZα are further provided with enzyme cutting sites.
[0022] Preferably, the enzyme cutting site is BsaI.
[0023] The promoter is a constitutive promoter, an inducible promoter or a tissue-specific promoter.
[0024] The promoter is a rice OsU6 promoter, a corn ZmUbi1 promoter, a Larix PE004 promoter, an Arabidopsis AtU6 promoter or a P35S.
[0025] Further, the nucleotide sequence of the Larix PE004 promoter is shown in Seq ID No. 4.
[0026] Further, in the plant genome editing system, the terminator is pinII, AtHSP, NOS or T35S.
[0027] In particular, in the plant genome editing system, the plant is a monocotyledon or a gymnosperm.
[0028] Specifically, the monocotyledon is a Gramineae plant.
[0029] Preferably, the Gramineae plant is rice, corn, sorghum, sugarcane, wheat or barley.
[0030] Specifically, the gymnosperm is Larix, Pinus massoniana, Pinus tabulaeformis or Pinus elliottii.
[0031] The application also provides a vector, a cell or a host expressing the coding sequence of the aforementioned transposon nuclease.
[0032] The application further provides a vector, a cell or a host containing the aforementioned plant genome editing system.
[0033] The application also provides the aforementioned vector, cell or host for use in plant genome editing.
[0034] In particular, in the aforementioned use, the plant is a monocotyledon or a gymnosperm.
[0035] Specifically, the monocotyledon is a Gramineae plant.
[0036] Preferably, the Gramineae plant is rice, corn, sorghum, sugarcane, wheat or barley.
[0037] Specifically, the gymnosperm is Larix, Pinus massoniana, Pinus tabulaeformis or Pinus elliottii.
[0038] Advantages of the application:
[0039] The application provides transposon nuclease IsDge10, IsAam1 and enIscB coding genes, which can recognize TAM (TAM is Transposon associated motif, 5'-TTAT-3') and further carry out gene editing when expressed in plants, and the fragment deletion size is mostly a large fragment, which can be used for constructing an editing system for editing coding regions, non-coding regions and the like. The transposon nuclease editing system developed by the application and using the above transposon nuclease coding genes can be effectively used for plant genome targeted editing. The editing system is a compact nuclease system, which is different from the commonly used Cas12a and Cas9 CRISPR tools, and the protein is smaller (only 1 / 3 of the former), which is beneficial to effective delivery. The efficiency of the transposon nuclease editing system of the application in plant cells is tested, and the results show that the transposon nuclease expressed by the transposon nuclease coding gene of the application can recognize TAM (5'-TTAT-3'); the fragment deletion size caused by the transposon nuclease editing system of the application is mostly 7-12 bp (a large fragment), especially 6-10 bp deletion, which can be suitable for editing coding regions, non-coding regions and the like; and the transposon nuclease editing system of the application can be widely applied to monocotyledonous plants (rice, corn, sorghum, sugarcane, wheat, barley and the like), gymnosperms (larch, Chinese pine, Chinese red pine, slash pine and the like) and the like. In summary, the application provides a new gene targeted modification tool based on transposon coding nuclease, which can simply, quickly and efficiently carry out genome targeted knockout editing on plants, and has a good application prospect in the field of plant genome editing technology (especially in the aspect of non-coding region editing). BRIEF DESCRIPTION OF DRAWINGS
[0040] Figure 1 , a schematic diagram of vector construction of the transposon nuclease plant genome targeted editing system. A: a transposon nuclease protein expression unit, wherein the transposon nuclease can be IsDge10, IsAam1, enIscB or Fanzor. B: a reRNA transcription expression cloning unit, wherein the reRNA Scaffold can be IsDge10 Scaffold, IsAam1 Scaffold or Fanzor Scaffold. C: an enIscB reRNA transcription expression unit; D: a transposon nuclease plant genome targeted editing system, wherein the transposon nuclease can be IsDge10, IsAam1 or Fanzor. The reRNA Scaffold can be the Scaffold corresponding to the selected nuclease. E: an enIscB plant genome targeted editing system. pZmUbi: a maize Ubiquitin promoter; TnpB: a TnpB protein gene; NLS: a nuclear localization signal; lacZα: a lacZα gene.
[0041] Figure 2 A. Editing efficiency analysis of IsDge10 in rice protoplast. B. Editing efficiency analysis of IsAam1 in rice protoplast. C. Editing efficiency analysis of SpuFz in rice protoplast. D. Editing efficiency analysis of enIscB in rice protoplast.
[0042] Figure 3 Analysis of fragment deletion size caused by TTAT TAM recognition site of IsDge10 plant genome directed editing system.
[0043] Figure 4 Larch IsDge10 gene editing skeleton vector.
[0044] Figure 5 Editing efficiency and editing feature detection of IsDge10 larch genome editing system.
[0045] Figure 6 Larch endogenous gene editing efficiency detection based on IsDge10 genome editing system. DETAILED DESCRIPTION
[0046] Transposon nucleases have the advantage of small protein size, which provides an advantage for genome editing tool delivery. Transposon-encoded nucleases are divided into three categories: TnpB, IscB and Fanzor. Among them, the prokaryotic transposon-encoded TnpB and IscB proteins are the ancestors of Cas12 and Cas9 nucleases, respectively; Fanzor is a eukaryotic source of transposon-encoded nucleases. However, only TnpB shows editing efficiency in mammalian cells, and has not been applied in plant genome editing. Therefore, the applicant hopes to obtain a transposon nuclease editing tool that can be widely applied in plants.
[0047] To solve the aforementioned problems, the applicant, through the preliminary work, selected TnpB class IsDge10 and IsAam1, IscB class enIscB and Fanzor class SpuFz as the research object of modification. The inventors first optimized the coding sequence of IsDge10, IsAam1, enIscB and SpuFz to make it more suitable for expression in plant genome. Further, a plant genome directed editing system was constructed, including two core regions of transposon nuclease protein expression unit and reRNA transcription expression cloning unit. The structure of the transposon nuclease protein expression unit is promoter-transposon nuclease-terminator, and the structure of the reRNA transcription expression cloning unit is promoter-reRNA scaffold-terminator. The promoters, transposon nucleases and terminators in the two units can be replaced according to the needs, for example: the promoter can be selected according to the editing purpose and the difference of application species (for example, monocotyledonous plants or gymnosperms. Monocotyledonous plants are grass family plants, such as rice, corn, sorghum, sugarcane, wheat or barley, etc.; gymnosperms can be larch, pinus massoniana, pinus tabulaeformis or pinus elliotii). In addition, the corresponding reRNA scaffold also needs to be replaced according to the selected transposon nuclease.
[0048] After the construction of the aforementioned directed editing system, it is loaded into the backbone vector to obtain the directed modification backbone vector. In order to verify whether the editing system can be used, the applicant selected monocotyledonous plants (taking rice as an example) and gymnosperms (taking larch as an example) to carry out editing experiments. The results showed that among the above four transposon nuclease editing systems, the editing systems based on IsDge10, IsAam1 and enIscB can realize the directed modification of genome, and the SpuFz editing system failed. The cleavage characteristics analysis showed that unlike the Cas9 editing system, the transposon nuclease editing system can recognize TAM sequence, which is not only suitable for editing coding region, but also suitable for editing non-coding region; can cause the deletion of the fragment at its downstream 7-12 bp, especially the deletion of 6-10 bp.
[0049] Example 1 Construction of plant genome directed modification backbone vector
[0050] 1. Construction of IsDge10 plant genome directed modification backbone vector
[0051] The IsDge10 codon is optimized, and the new IsDge10 gene editing skeleton vector is constructed by using different module assembly methods. First, design module 1 (MOD_A), which is an IsDge10 nuclease protein expression unit containing NLS coding sequence at the 5' end and 3' end (ZmUbi1-NLS-IsDge10-NLS-AtHSP), wherein the IsDge10 is codon-optimized and the NLS-IsDge10-NLS (Seq ID No. 5, wherein the 46th-1218th bp is IsDge10) is synthesized by a biological company. Then, the NLS-IsDge10-NLS unit, the constitutive promoter ZmUbi1 element from corn and the Arabidopsis AtHSP terminator element are assembled into module 1 (MOD_A) by the Golden Gate method, wherein the promoter unit can be replaced by LarPE004 (Seq ID No. 4, ZL202010619161.4) for constructing the IsDge10 larch genome editing vector. Figure 1
[0052] Secondly, design module 2 (MOD_B), which is a reRNA transcription expression cloning unit OsU6-IsDge10 scaffold-lacZα-poly T. The rice OsU6 promoter and IsDge10 scaffold-lacZα-poly T are assembled into module 2 (MOD_B) by the Gibson Assembly method, wherein the OsU6 promoter can be replaced by the Arabidopsis AtU6 promoter. Figure 1
[0053] Finally, module 1 and module 2 are assembled into pTrans_210d by the Golden Gate method. Through the transformation of bacterial competence, single clone PCR verification, extraction of recombinant plasmid, Sanger sequencing verification, finally the new IsDge10 gene editing skeleton vector, namely Seq ID No. 1, is obtained.
[0054] 2. Construction of IsAam1 plant genome directed modification skeleton vector
[0055] The new IsAam1 gene editing skeleton vector is constructed by IsAam1 codon optimization and different module assembly. First, design module 1 (MOD_A), which is an IsAam1 nuclease protein expression unit containing NLS coding sequence at the 5' end and 3' end (ZmUbi1-NLS-IsAam1-NLS-AtHSP), wherein IsAam1 is codon-optimized and synthesized by a biological company NLS-IsAam1-NLS (Seq ID No. 6, wherein 46-1152 bp is IsAam1). Then, the NLS-IsAam1-NLS unit, the constitutive promoter ZmUbi1 element from corn and the Arabidopsis AtHSP terminator element are assembled into module 1 (MOD_A) by the Golden Gate method, wherein the promoter unit can be replaced by LarPE004 (ZL202010619161.4). Figure 1
[0056] Secondly, design module 2 (MOD_B), which is a reRNA transcription expression cloning unit OsU6-IsAam1 scaffold-lacZα-poly T. The rice OsU6 promoter and IsAam1 scaffold-lacZα-poly T (Seq ID No. 9) are assembled into module 2 (MOD_B) by the Gibson Assembly method, wherein the OsU6 promoter can be replaced by the Arabidopsis AtU6 promoter. Figure 1
[0057] Finally, module 1 and module 2 are assembled into pTrans_210d by the Golden Gate method. Through transformation of bacterial competent cells, single clone PCR verification, extraction of recombinant plasmid and Sanger sequencing verification, the new IsAam1 gene editing skeleton vector is finally obtained.
[0058] 3. Construction of enIscB plant genome directed modification skeleton vector
[0059] The enIscB codon is optimized, and a new enIscB gene editing skeleton vector is constructed by assembling different modules. First, design module 1 (MOD_A), which is an enIscB nuclease protein expression unit containing NLS coding sequences at the 5' and 3' ends (ZmUbi1-NLS-enIscB-NLS-AtHSP), wherein enIscB is codon-optimized and synthesized by a biological company NLS-enIscB-NLS (Seq ID No. 7, wherein 46-1533 bp is enIscB). Then, the NLS-enIscB-NLS unit, the constitutive promoter ZmUbi1 element from corn, and the Arabidopsis AtHSP terminator element are assembled into module 1 (MOD_A) by the Golden Gate method. Figure 1 ), wherein the promoter unit can be replaced by LarPE004 (ZL202010619161.4).
[0060] Secondly, design module 2 (MOD_B), which is a reRNA transcription expression cloning unit OsU6-lacZα-enIscBscaffold-poly T. The rice OsU6 promoter and lacZα-enIscBscaffold-poly T (Seq ID No. 10) are assembled into module 2 (MOD_B) by the Gibson Assembly method. Figure 1 ), wherein the OsU6 promoter can be replaced by the Arabidopsis AtU6 promoter.
[0061] Finally, module 1 and module 2 are assembled into pTrans_210d by the Golden Gate method. Through transformation of bacterial competent cells, single colony PCR verification, extraction of recombinant plasmids, and Sanger sequencing verification, a new enIscB gene editing skeleton vector is finally obtained.
[0062] 4. Construction of SpuFz plant genome directed modification skeleton vector
[0063] The SpuFz codon is optimized, and a new SpuFz gene editing skeleton vector is constructed by assembling different modules. First, design module 1 (MOD_A), which is a SpuFz nuclease protein expression unit containing NLS coding sequences at the 5' and 3' ends (ZmUbi1-NLS-SpuFz-NLS-AtHSP), wherein SpuFz is codon-optimized and synthesized by a biological company NLS-SpuFz-NLS (Seq ID No. 8, wherein 46-1959 bp is SpuFz). Then, the NLS-SpuFz-NLS unit, the constitutive promoter ZmUbi1 element from corn, and the Arabidopsis AtHSP terminator element are assembled into module 1 (MOD_A) by the Golden Gate method.Figure 1 ), wherein the promoter unit can be replaced by LarPE004 (ZL202010619161.4).
[0064] Secondly, the design module 2 (MOD_B) is reRNA transcription expression cloning unit OsU6-SpuFz scaffold-lacZ alpha-poly T. The rice OsU6 promoter and SpuFz scaffold-lacZ alpha-poly T (Seq ID No. 11) are assembled into module 2 (MOD_B) by the method of Gibson Assembly. Figure 1 ), wherein the OsU6 promoter can be replaced by Arabidopsis AtU6 promoter.
[0065] Finally, module 1 and module 2 are assembled into pTrans_210d by the Golden Gate method. Through the transformation of bacterial competence, single clone PCR verification, extraction of recombinant plasmid, Sanger sequencing verification, finally the new SpuFz gene editing skeleton vector is obtained.
[0066] Seq ID No. 1 IsDge10 nuclease protein expression unit (ZmUbi1-NLS-IsDge10-NLS-AtHSP) + reRNA transcription expression cloning unit (OsU6-IsDge10 scaffold-lacZ alpha-poly T) wherein 11002-12174bp can be replaced by other transposon nucleases. Wherein 12754-13509bp is replaced according to the different selection of transposon nucleases, that is, the reRNA scaffold-terminator part of the reRNA transcription expression cloning unit (promoter-reRNA scaffold-terminator) can be replaced according to the different types of enzymes. For example, the structure of the 12754-13509bp fragment in Seq ID No. 1 is IsDge10 scaffold-lacZ alpha-poly T. The position of IsDge10 scaffold in it is 12754-12936bp;
[0067]
[0068] Seq ID No. 4 Larch LarPE004 promoter:
[0069]
[0070] Seq ID No. 5 NLS-IsDge10-NLS:
[0071]
[0072] Seq ID No. 6 NLS-IsAam1-NLS:
[0073]
[0074] Seq ID No. 7 NLS-enIscB-NLS:
[0075]
[0076] Seq ID No. 8 NLS-SpuFz-NLS:
[0077]
[0078] Seq ID No. 9 IsAam1 scaffold-lacZ alpha-poly T (wherein 1-182 bp is IsAam1 scaffold):
[0079] GACAGGGACGTCAATGCGGCAATCAATATCAAACATGAGGGCATGAAACGATTAGCAATAGCCTAACTTGTCCTCGAACCGTGGGACACACGGGGATCGCTCAGTCAACTTCCCGTCATGAGATGGGATTACCTGAGAAGCCCCCACCTCTAAGCGAAGCGTAGGTGGTGGGAGCATGTCACGGAGACCTTACAGTTGGACACAGGCCaacttgtgaagattgcaaaacgtggcggcgtgaccgcaatggaggcagtgcatgcatcgcgcaatgcactgacgggtgcccccctggagacgggcgccgctacagggcgcgtcccattcgccattcaggctgcgcaactgttgggaagggcgatcggtgcgggcctcttcgctattacgccagctggcgaaagggggatgtgctgcaaggcgattaagttgggtaacgccagggttttcccagtcacgacgttgtaaaacgacggccagtgagcgcgcgtaatacgactcactatagggcgaattgggtaccgggccccccctcgaggtcctccagcttttgttccctttagtgagggttaattgcgcgcttggcgtaatcatggtcatagctgtttcctgtgtgaaattgttatccgctcacaattccacacaacatacgagccggaagcataaagtgtaaagcctggggtgcctaatgagtgagctaactcacattaattgcgttgcgctcactgcccGCTTTCCACCGGTGGTCTCATTTTTTT.
[0080] Seq ID No. 10 lacZ alpha-enIscB scaffold-poly T (wherein 560-750 bp is enIscB scaffold):
[0081] TtacagttggacacaggccaacttgtgaagattgcaaaacgtggcggcgtgaccgcaatggaggcagtgcatgcatcgcgcaatgcactgacgggtgcccccctggagacgggcgccgctacagggcgcgtcccattcgccattcaggctgcgcaactgttgggaagggcgatcggtgcgggcctcttcgctattacgccagctggcgaaagggggatgtgctgcaaggcgattaagttgggtaacgccagggttttcccagtcacgacgttgtaaaacgacggccagtgagcgcgcgtaatacgactcactatagggcgaattgggtaccgggccccccctcgaggtcctccagcttttgttccctttagtgagggttaattgcgcgcttggcgtaatcatggtcatagctgtttcctgtgtgaaattgttatccgctcacaattccacacaacatacgagccggaagcataaagtgtaaagcctggggtgcctaatgagtgagctaactcacattaattgcgttgcgctcaCTGCCCGCTTTCCACCGGTGGTCTCAGGCTCGTCCAACTGCGGTTGAACGAGCACAGGCTGAGACATTCGTAAGGCCGAAAGGCCGGACGCACCCTGGGATTTCCCCAGTCCCCGGAACTGCATAGCGGATGCCAGTTGATGGAGCAATCTATCAGATAAGCCAGGGGGAACAATCACCTCTCTGTATCAGAGAGAGTTTTACAAAAGGAGGAACGGTTTTTTT.
[0082] Seq ID No. 11 SpuFz scaffold-lacZα-poly T (wherein 1-351 bp is SpuFz scaffold):
[0083] GAGTTTGTGGAGAAAAAATTCAAAACACGACCTCATTCAAGACCTTGGCGCCGTCGTGAAGGCAAGATTGAAAAAGTCCACGGACTGCTGGGTTGTACCAACCCTAACTGTTTGCAGCAAGCCTGGACATCGGGAATGCGCTACTGGAATCGAGATATGCTGTCAACCTGCAACATGCTATTGATTGTGAGATCAATGTTGGATGGACACGGTAGACCAGAAGTGTTCAGCAGGAGTGTTCCAGCCGTAGCGTAGAACGTAGATTGGTTAGATTAGGTTTTCCGAGCCGGTTGTCGCGCGGTTCAATCCCTGGTGCGGGTGCTAGTGCCAATACCCACCGGCTCCGCACTAGGAGACCTTACAGTTGGACACAGGCCaacttgtgaagattgcaaaacgtggcggcgtgaccgcaatggaggcagtgcatgcatcgcgcaatgcactgacgggtgcccccctggagacgggcgccgctacagggcgcgtcccattcgccattcaggctgcgcaactgttgggaagggcgatcggtgcgggcctcttcgctattacgccagctggcgaaagggggatgtgctgcaaggcgattaagttgggtaacgccagggttttcccagtcacgacgttgtaaaacgacggccagtgagcgcgcgtaatacgactcactatagggcgaattgggtaccgggccccccctcgaggtcctccagcttttgttccctttagtgagggttaattgcgcgcttggcgtaatcatggtcatagctgtttcctgtgtgaaattgttatccgctcacaattccacacaacatacgagccggaagcataaagtgtaaagcctggggtgcctaatgagtgagctaactcacattaattgcgttgcgctcactgcccGCTTTCCACCGGTGGTCTCATTTTTTT.
[0084] Seq ID No. 12 IsAam1 scaffold:
[0085] gacagggacgtcaatgcggcaatcaatatcaaacatgagggcatgaaacgattagcaatagcctaacttgtcctcgaaccgtgggacacacggggatcgctcagtcaacttcccgtcatgagatgggattacctgagaagcccccacctctaagcgaagcgtaggtggtgggagcatgtcac.
[0086] Seq ID No. 2 enlscB scaffold:
[0087] ggctcgtccaactgcggttgaacgagcacaggctgagacattcgtaaggccgaaaggccggacgcaccctgggatttccccagtccccggaactgcatagcggatgccagttgatggagcaatctatcagataagccagggggaacaatcacctctctgtatcagagagagttttacaaaaggaggaacgg.
[0088] Seq ID No. 3 SpuFz scaffold:
[0089] gagtttgtggagaaaaaattcaaaacacgacctcattcaagaccttggcgccgtcgtgaaggcaagattgaaaaagtccacggactgctgggttgtaccaaccctaactgtttgcagcaagcctggacatcgggaatgcgctactggaatcgagatatgctgtcaacctgcaacatgctattgattgtgagatcaatgttggatggacacggtagaccagaagtgttcagcaggagtgttccagccgtagcgtagaacgtagattggttagattaggttttccgagccggttgtcgcgcggttcaatccctggtgcgggtgctagtgccaatacccaccggctccgcacta.
[0090] Seq ID No. 13 Coding sequence of IsDge10:
[0091]
[0092] Seq ID No. 14 Coding sequence of IsAam1 :
[0093]
[0094] Seq ID No. 15 coding sequence of enlscB:
[0095]
[0096] Example 2 Rice endogenous gene targeted editing based on IsDge10 system
[0097] 1. Design of rice endogenous genome targeted editing guide reRNA
[0098] To test the editing efficiency of the constructed IsDge10 system on plant genome, 6 spacer sites with TAM of TTAT were obtained by scanning the rice genome (see Table 1) to design reRNA. According to the nucleic acid sequence of the designed reRNA site, the corresponding forward and reverse oligonucleotide chains were artificially synthesized, and the specific sequences are shown in Table 1 (the first 4 base sequences at the 5' end represent the sticky end complementary to the backbone vector, and the following sequences are the designed specific guide crRNA site).
[0099] Table 1 Design site and sequence of genome editing reRNA
[0100]
[0101]
[0102] 2. Construction of IsDge10+reRNA recombinant expression vector
[0103] Construction of expression vector based on IsDge10 backbone vector: reRNA01-F / R, reRNA02-F / R, reRNA03-F / R, reRNA04-F / R, reRNA05-F / R, reRNA06-F / R were mixed in equal proportions, and reacted at 95°C for 10 min, and then naturally annealed to form double-stranded DNA with sticky ends as an insertion fragment for constructing recombinant vectors. In a 200 μL PCR tube, TnpB plant genome targeted editing backbone vector, sticky end insertion fragment, BsaI endonuclease, and T4 DNA ligase were added, and enzyme digestion and ligation were performed at "37°C for 5 min→ 16°C for 10 min (15 cycles)→ 37°C for 10 min→ 65°C for 10 min→ 4°C for 10 min". The reaction product was taken for E. coli transformation. Positive transformants were identified by kanamycin resistance screening, colony PCR and enzyme digestion, and finally verified by sequencing to obtain IsDge10-reRNA01, IsDge10-reRNA02, IsDge10-reRNA03, IsDge10-reRNA04, IsDge10-reRNA05, and IsDge10-reRNA06 recombinant expression vectors.
[0104] 3. Rice protoplast transformation of IsDge10 recombinant expression vector
[0105] The specific process of IsDge10 recombinant expression vector in rice japonica protoplast isolation, transformation and DNA extraction refers to the experimental method disclosed in the reference (Tang X, Zheng X, Qi Y, Zhang D, Cheng Y, Tang A, Voytas DF, Zhang Y. 2006. A Single Transcript CRISPR-Cas9 System for Efficient Genome Editing in Plants. Mol Plant, 9(7): 1088-1091.).
[0106] 4. Detection of targeted editing results
[0107] The detection and analysis method of genomic NHEJ editing events is as follows: after the transformation of rice protoplast, 32°C dark culture for 48 hours, collection of transformed cells, CTAB method to extract rice protoplast genomic DNA, using the DNA as template, PCR amplification and NGS verification analysis, the primers used are shown in Table 2. The specific experimental method process refers to the experimental method disclosed in the reference (Zhong Z, Zhang Y, You Q, Tang X, Ren Q, Liu S, Yang L, Wang Y, Liu X, Liu B, Zhang T, Zheng X, Le Y, Zhang Y, Qi Y. 2018. Molecular Plant. Plant genome editing using FnCpf1 and LbCpf1 nucleases at redefined and altered PAM sites. Mol Plant, 11: 999-1002). The PCR product is gel purified, and then sequenced by Novogene (Tianjin, China) using NovaSeq 6000-PE150 sequencing strategy. The data is analyzed by CRISPRMatch software (You, Q., Zhong, Z., Ren, Q., Hassan, F., Zhang, Y., and Zhang, T. 2018. CRISPRMatch: an automatic calculation and visualization tool for high-throughput CRISPR genome-editing data analysis. Int. J. Biol. Sci. 14: 858-862.), and the mutation efficiency (i.e. editing efficiency) is calculated.
[0108] Table 2 Genomic editing PCR primer sequence information
[0109]
[0110]
[0111] Depend on Figure 2 A indicates that the compact IsDge10 plant genome editing tool constructed based on this invention can edit all six sites detected in rice, with an editing efficiency of approximately 2%–13%. Splicing characteristic analysis shows that the system can recognize the TAM (5'-TTAT-3') sequence, causing deletions of fragments 7–12 bp downstream of it, with deletions of 6–10 bp being the most common. Figure 3 The above demonstrates that IsDge10 can effectively edit endogenous sites in the rice genome.
[0112] Example 3: Targeted editing of endogenous genes in rice based on the IsAam1 system
[0113] 1. Design of reRNA as a guide for targeted editing of the rice endogenous genome
[0114] To test the editing efficiency of the constructed IsAam1 (Seq ID No. 6) system on plant genomes, the rice genome was scanned to obtain six spacer sites with TTMAA (see Table 3) for reRNA design. Based on the designed reRNA site nucleic acid sequences, corresponding forward and reverse oligonucleotide chains were artificially synthesized. The specific sequences are shown in Table 3 (the first four bases at the 5' end represent the sticky ends complementary to the backbone vector, and the subsequent sequences are the designed specific guide crRNA sites).
[0115] Table 3. Design sites and sequences of genome editing reRNAs
[0116]
[0117] 2. Construction of IsAam1+reRNA recombinant expression vector
[0118] Expression vector construction based on IsAam1 skeleton vector: reRNA01-F / R, reRNA02-F / R, reRNA03-F / R, reRNA04-F / R, reRNA05-F / R, reRNA06-F / R are mixed in equal proportions, 95℃ reaction for 10min, and then natural annealing, forming double-stranded DNA with sticky ends, as an insertion fragment for constructing recombinant vectors. Add IsAam1 plant genome directed editing skeleton vector, sticky end insertion fragment, BsaI endonuclease, T4 DNA ligase in a 200uL PCR tube, and perform enzyme digestion and ligation at "37℃ 5min→16℃ 10min (15 cycles)→37℃ 10min→65℃ 10min→4℃ 10min". Take the reaction product for E. coli transformation. Positive transformants are obtained by kanamycin resistance screening, colony PCR and enzyme digestion identification, and finally verified by sequencing to obtain IsAam1-reRNA01, IsAam1-reRNA02, IsAam1-reRNA03, IsAam1-reRNA04, IsAam1-reRNA05, IsAam1-reRNA06 recombinant expression vectors.
[0119] 3. Rice protoplast transformation of IsAam1 recombinant expression vector
[0120] The specific method of rice protoplast transformation is consistent with that in Example 2.
[0121] 4. Detection of directed editing results
[0122] The detection and analysis method of genomic NHEJ editing events is as follows: after rice protoplast transformation, 32℃ dark culture for 48 hours, collect the transformed cells, extract rice protoplast genomic DNA by CTAB method, use the DNA as a template for PCR amplification and NGS verification analysis, and the primers used are shown in Table 4. The analysis and data calculation method is consistent with that in Example 2.
[0123] Table 4: Genomic editing PCR primer sequence information
[0124]
[0125]
[0126] From Figure 2 B it can be seen that: the compact IsAam1 plant genome editing tool constructed based on the application can edit two sites at an editing efficiency of about 2.5% to 3.6% in the six sites detected in rice. It shows that IsAam1 can edit the endogenous sites in the rice genome.
[0127] Example 4 Rice endogenous gene targeted editing based on enIscB system
[0128] 1. Design of rice endogenous genome targeted editing guide reRNA
[0129] To test the editing efficiency of the constructed enIscB (Seq ID No. 7) system on plant genome, 6 spacer sites with TAM of TTGGAA or CAGGAA were obtained by scanning the rice genome (see Table 5) to design reRNA. According to the nucleic acid sequence of the designed reRNA site, the corresponding forward and reverse oligonucleotide chains were artificially synthesized, and the specific sequences are shown in Table 5 (the first 4 base sequences at the 5' end represent the sticky end complementary to the backbone vector, and the following sequences are the designed specific guide crRNA site).
[0130] Table 5 Design site and sequence of genome editing reRNA
[0131]
[0132] 2. Construction of enIscB + reRNA recombinant expression vector
[0133] Construction of expression vector based on enIscB backbone vector: reRNA01-F / R, reRNA02-F / R, reRNA03-F / R, reRNA04-F / R, reRNA05-F / R, reRNA06-F / R were mixed in equal proportions, and reacted at 95°C for 10 min, and then naturally annealed to form double-stranded DNA with sticky ends as an insertion fragment for constructing recombinant vectors. enIscB plant genome targeted editing backbone vector, sticky end insertion fragment, BsaI endonuclease, and T4 DNA ligase were added in a 200 uL PCR tube, and enzyme digestion and ligation were performed at "37°C for 5 min→ 16°C for 10 min (15 cycles)→ 37°C for 10 min→ 65°C for 10 min→ 4°C for 10 min". The reaction product was used for E. coli transformation. Positive transformants were identified by kanamycin resistance screening, colony PCR, and enzyme digestion, and finally verified by sequencing to obtain enIscB-reRNA01, enIscB-reRNA02, enIscB-reRNA03, enIscB-reRNA04, enIscB-reRNA05, and enIscB-reRNA06 recombinant expression vectors.
[0134] 3. Rice protoplast transformation of enIscB recombinant expression vector
[0135] The specific method of rice protoplast transformation was the same as that in Example 2.
[0136] 4. Detection of targeted editing results
[0137] The genomic NHEJ editing event detection and analysis method is as follows: after rice protoplast transformation, 32℃ dark culture for 48 hours, collection of transformed cells, CTAB method for extracting rice protoplast genomic DNA, using the DNA as a template, PCR amplification and NGS verification analysis, the primers used are shown in Table 6. The analysis and data calculation method is consistent with that in Example 2.
[0138] Table 6 genomic editing PCR primer sequence information
[0139] Primer name Primer sequence Use enIscB-site01-F GGGACTTTGCTTAGCAGCTG Site01 NGS upstream primer enIscB-site01-R AGTTTAGCTGATATATGTT Site01 NGS downstream primer enIscB-site02-F ATTGCTGATCCTCCTCGTGT Site02 NGS upstream primer enIscB-site02-R CCCGCTAATTCTAGGTGGCCTC Site02 NGS downstream primer enIscB-site03-F TATCTTGTTGGCTGCTGCAA Site03 NGS upstream primer enIscB-site03-R ACAAGAAACACATCAACCACCAT Site03 NGS downstream primer enIscB-site04-F ATAGTGATATAACATGCATA Site04 NGS upstream primer enIscB-site04-R TGCTGTGATCCTAGCTATTT Site04 NGS downstream primer enIscB-site05-F TAACAGTGGCTGCTCAGCAG Site05 NGS upstream primer enIscB-site05-R GACTTGGATTGTGCCCTTGA Site05 NGS downstream primer enIscB-site06-F GCTTCGGCAGCAGCAGCAAT Site06 NGS upstream primer enIscB-site06-R CGACATGAGCGAGCCCTGCC Site06 NGS downstream primer
[0140] From Figure 2 D can be known: based on the compact enIscB plant genome editing tool constructed by the application, 5 sites in rice can be edited by enIscB, and the editing efficiency is about 2.1%~6.1%. It shows that enIscB can edit the endogenous site of rice genome.
[0141] Example 5 Directional editing of rice endogenous genes based on SpuFz system
[0142] 1. Design of rice endogenous genome directional editing guide reRNA
[0143] In order to test the editing efficiency of the constructed SpuFz (Seq ID No. 8) system on plant genome, 6 spacer sites with TAM as CATA were obtained by scanning rice genome (see Table 7) to design reRNA. According to the nucleic acid sequence of the designed reRNA site, the corresponding positive and negative oligonucleotide chains were artificially synthesized, and the specific sequences are shown in Table 7 (the first 4 base sequences at the 5' end represent the sticky end complementary to the backbone carrier, and the following sequence is the designed specific guide crRNA site).
[0144] Table 7 genomic editing reRNA design site and sequence
[0145]
[0146] 2. Construction of SpuFz+reRNA recombinant expression vector
[0147] Construction of expression vector based on SpuFz backbone vector: reRNA01-F / R, reRNA02-F / R, reRNA03-F / R, reRNA04-F / R, reRNA05-F / R, reRNA06-F / R were mixed in equal proportions, and 95℃ reaction was carried out for 10 min, and then natural annealing was carried out, to form double-stranded DNA with sticky ends, as an insertion fragment for constructing a recombinant vector. SpuFz plant genome directed editing backbone vector, sticky end insertion fragment, BsaI endonuclease, and T4 DNA ligase were added in a 200 uL PCR tube, and enzyme cutting and ligation were carried out at "37℃ for 5 min→ 16℃ for 10 min (15 cycles) → 37℃ for 10 min→ 65℃ for 10 min→ 4℃ for 10 min", and the reaction product was taken for E. coli transformation. Positive transformants were obtained through kanamycin resistance screening, colony PCR and enzyme cutting identification, and finally SpuFz-reRNA01, SpuFz-reRNA02, SpuFz-reRNA03, SpuFz-reRNA04, SpuFz-reRNA05 and SpuFz-reRNA06 recombinant expression vectors were obtained through sequencing verification.
[0148] 3. Rice protoplast transformation of SpuFz recombinant expression vector
[0149] The specific method of rice protoplast transformation is consistent with that in embodiment 2.
[0150] 4. Detection of directed editing results
[0151] The genome NHEJ editing event detection and analysis method is as follows: after rice protoplast transformation, 32℃ dark culture is carried out for 48 hours, the transformed cells are collected, and CTAB method is used to extract rice protoplast genomic DNA, the DNA is used as a template for PCR amplification and NGS verification analysis, and the primers used are shown in Table 8. The analysis and data calculation method is consistent with that in embodiment 2.
[0152] Table 8: Genomic editing PCR primer sequence information
[0153] Primer name Primer sequence Use SpuFz-site01-F ATCACGtatgtgccagttccacgagc Site01 NGS upstream primer SpuFz-site01-R CAAAAGcacctgcaccaataattgatgga Site01 NGS downstream primer SpuFz-site02-F AGTCAAgttccatgggccctcaaaga Site02 NGS upstream primer SpuFz-site02-R CACGATcacaccaggcgtatgttcct Site02 NGS downstream primer SpuFz-site03-F ATCACGgcatggcgcatgttttcctt Site03 NGS upstream primer SpuFz-site03-R TCCCGAtccagtcctctgaagaaaggt Site03 NGS downstream primer SpuFz-site04-F ATCACGgcatggcgcatgttttcctt Site04 NGS upstream primer SpuFz-site04-R CACGATcacaccaggcgtatgttcct Site04 NGS downstream primer SpuFz-site05-F ATCACGgcatggcgcatgttttcctt Site05 NGS upstream primer SpuFz-site05-R CACGATcacaccaggcgtatgttcct Site05 NGS downstream primer SpuFz-site06-F ATCACGgcatggcgcatgttttcctt Site06 NGS upstream primer SpuFz-site06-R CACGATcacaccaggcgtatgttcct Site06 NGS downstream primer CCGTCC cgacatcataccaaatgtgccc Site04 NGS upstream primer SpuFz-site04-R ACTGAT acagctcttggatcccatca Site04 NGS downstream primer SpuFz-site05-F CAGATC agggatggagggagaatagtt Site05 NGS upstream primer SpuFz-site05-R ATGAGC ccttcagcttgagcctacca Site05 NGS downstream primer SpuFz-site06-F CGTACG gaccagcacttcgatagcct Site06 NGS upstream primer SpuFz-site06-R TACAGC cacaagttatctgacagaggcct Site06 NGS downstream primer
[0154] It can be known from Figure 2 C that the compact SpuFz plant genome editing tool constructed based on the application is not detected to be edited in the 6 sites tested in rice.
[0155] Example 6: Construction of larch genome directed modification editing system
[0156] 1. Construction of IsDge10 larch genome directed modification backbone vector
[0157] The promoter unit is optimized, and the IsDge10 gene editing skeleton vector of larch is constructed by assembling different modules. First, design module 1 (MOD_A), which is the IsDge10 nuclease protein expression unit containing NLS coding sequence at the 5' end and 3' end (ZmUbi1-NLS-IsDge10-NLS-AtHSP), wherein IsDge10 is codon-optimized and synthesized by a biological company NLS-IsDge10-NLS (Seq ID No. 5, wherein 46-1218 bp is IsDge10). Then the NLS-IsDge10-NLS unit, the constitutive promoter LarPE004 (Seq ID No. 4, ZL202010619161.4) element from larch and the Arabidopsis AtHSP terminator element are assembled into module 1 by the Golden Gate method.
[0158] Secondly, design module 2 (MOD_B), which is the reRNA transcription expression cloning unit OsU6-IsDge10 scaffold-lacZα-poly T. The rice OsU6 promoter and IsDge10 scaffold-lacZα-poly T are assembled into module 2 by the method of Gibson Assembly.
[0159] Finally, module 1 and module 2 are assembled into pTrans_210d by the Golden Gate method. Through the transformation of bacterial competence, single colony PCR verification, extraction of recombinant plasmid, Sanger sequencing verification, finally the larch IsDge10 gene editing skeleton vector (pTrans_210d-IsDge10) is obtained. Figure 4 ).
[0160] 2. Test the editing efficiency of the IsDge10 larch genome editing system
[0161] In order to test the editing efficiency of the IsDge10 larch genome editing system constructed, the rice genome is scanned to obtain two spacer sites with TAM as TTAT (see Table 9) to design reRNA. According to the designed reRNA site nucleic acid sequence, the corresponding forward and reverse oligonucleotide chains are artificially synthesized, and the specific sequences are shown in Table 1 (the first 4 base sequences at the 5' end represent the sticky end complementary to the skeleton vector, and the following sequence is the designed specific guide crRNA site).
[0162] Table 9 Genome editing reRNA design site and sequence
[0163]
[0164] 3. Construction of IsDge10+reRNA recombinant expression vector
[0165] Construction of expression vector based on IsDge10 skeleton vector: reRNA01-F / R, reRNA02-F / R, reRNA03-F / R, reRNA04-F / R, reRNA05-F / R, reRNA06-F / R were mixed in equal proportions, 95℃ for 10min, and then naturally annealed to form double-stranded DNA with sticky ends as an insertion fragment for constructing recombinant vector. Add IsDge10 plant genome directed editing skeleton vector, sticky end insertion fragment, BsaI endonuclease, T4 DNA ligase in a 200uL PCR tube, and perform enzyme digestion and ligation at "37℃ for 5min→ 16℃ for 10min (15 cycles)→ 37℃ for 10min→ 65℃ for 10min→ 4℃ for 10min", and then take the reaction product for E. coli transformation. Positive transformants are screened by kanamycin resistance, colony PCR and enzyme digestion, and finally verified by sequencing to obtain IsDge10-reRNA01 and IsDge10-reRNA02 recombinant expression vectors.
[0166] 3. IsDge10 recombinant expression vector transformation of rice protoplast
[0167] The specific process of IsDge10 recombinant expression vector in rice Nipponbare protoplast isolation, transformation and DNA extraction refers to the experimental method disclosed in the reference (Tang X, Zheng X, Qi Y, Zhang D, Cheng Y, Tang A, Voytas DF, Zhang Y. 2006. A Single Transcript CRISPR-Cas9 System for Efficient Genome Editing in Plants. Mol Plant, 9(7): 1088-1091.).
[0168] 4. Detection of directed editing results
[0169] The genomic NHEJ editing event detection and analysis method is as follows: after transformation of rice protoplast, 32°C dark culture for 48 hours, collection of transformed cells, CTAB method extraction of rice protoplast genomic DNA, using the DNA as template, PCR amplification and NGS verification analysis, the primers used are shown in Table 10. The specific experimental method process refers to the experimental method disclosed in the reference (Zhong Z, Zhang Y, You Q, Tang X, Ren Q, Liu S, Yang L, Wang Y, Liu X, Liu B, Zhang T, Zheng X, Le Y, Zhang Y, Qi Y. 2018. Molecular Plant. Plant genome editing using FnCpf1 and LbCpf1 nucleases at redefined and altered PAM sites. Mol Plant, 11: 999-1002). The PCR product is gel purified, and then sequenced by Novogene (Tianjin, China) using NovaSeq 6000-PE150 sequencing strategy. The data is analyzed by CRISPRMatch software (You, Q., Zhong, Z., Ren, Q., Hassan, F., Zhang, Y., and Zhang, T. 2018. CRISPRMatch: an automatic calculation and visualization tool for high-throughput CRISPR genome-editing data analysis. Int. J. Biol. Sci. 14: 858-862.), and the mutation efficiency is calculated.
[0170] Table 10 Genomic editing PCR primer sequence information
[0171] Primer name Primer sequence Use IsDge10-site01-F atcagctgacgcggttaatg Site01 NGS upstream primer IsDge10-site01-R ccaggggaaagaaagcttgt Site01 NGS downstream primer IsDge10-site02-F gaggcagggaaacgttggta Site02 NGS upstream primer IsDge10-site02-R agcatcaccaagatacagagca Site02 NGS downstream primer
[0172] Based on the compact IsDge10 larch genome editing tool constructed in the application, at 2 sites detected in rice, IsDge10 can be edited, and the editing efficiency is about 6% to 15%. The cleavage characteristic analysis shows that the system can recognize TAM (5'-TTAT-3') sequence, causing the deletion of the fragment at 7 to 12 bp downstream, and the deletion of 6 to 10 bp is the majority. The above shows that the larch IsDge10 editing system can effectively edit the endogenous site in the rice genome Figure 5 ).
[0173] Example 7 Directional editing of larch endogenous genes based on the IsDge10 genome editing system
[0174] 1. Design of reRNA for genome-directed editing of larch endogenous genes
[0175] To test the editing efficiency of the constructed IsDge10 larch genome editing system on plant genomes, four spacer sites with TAM TTAT were obtained by scanning the larch genome (see Table 11) to design reRNA. According to the nucleic acid sequence of the designed reRNA site, the corresponding forward and reverse oligonucleotide chains were artificially synthesized, and the specific sequences are shown in Table 9 (the first four base sequences at the 5' end represent the sticky ends complementary to the backbone vector, and the following sequences are the designed specific guide crRNA sites).
[0176] Table 11. Design sites and sequences of genome editing reRNA
[0177]
[0178] 2. Construction of IsDge10 + reRNA recombinant expression vectors
[0179] Construction of expression vectors based on IsDge10 larch genome editing backbone vectors: reRNA01-F / R, reRNA02-F / R, reRNA03-F / R, and reRNA04-F / R were mixed at equal proportions, and reacted at 95°C for 10 min, and then naturally annealed to form double-stranded DNA with sticky ends as an insertion fragment for constructing recombinant vectors. IsDge10 larch genome-directed editing backbone vector, sticky-end insertion fragment, BsaI endonuclease, and T4 DNA ligase were added to a 200 μL PCR tube, and enzyme digestion and ligation were performed at "37°C for 5 min → 16°C for 10 min (15 cycles) → 37°C for 10 min → 65°C for 10 min → 4°C for 10 min". The reaction product was used for E. coli transformation. Positive transformants were identified by kanamycin resistance screening, colony PCR, and enzyme digestion, and finally verified by sequencing to obtain IsDge10-reRNA01, IsDge10-reRNA02, IsDge10-reRNA03, and IsDge10-reRNA04 recombinant expression vectors.
[0180] 3. IsDge10 recombinant expression vector larch protoplast transformation
[0181] Through larch protoplast preparation and transient transformation system, the endogenous gene targeting site-directed mutation vectors of different larch gene-directed editing systems were introduced into larch protoplast cells, and the protoplast genomic DNA was extracted after 48 h of culture. High-throughput sequencing primers were designed to amplify different target gene sites.
[0182] 4. Detection of directed editing results
[0183] The method for detecting and analyzing genomic NHEJ editing events is as follows: after transformation of larch protoplasts, dark culture for 48 hours, collection of transformed cells, CTAB method for extracting larch protoplast genome DNA, using the DNA as a template, PCR amplification and NGS verification analysis, the primers used are shown in Table 12. The analysis and data calculation method is consistent with that in Example 2.
[0184] Table 12 genomic editing PCR primer sequence information
[0185] Primer name Primer sequence Use LarMYB06-F GCATGTGTAAACAGATTAGATC LarMYB06 NGS upstream primer LarMYB06-R GATATGTAAGACAAAAAAAAGAAGA LarMYB06 NGS downstream primer LarCKX01-F AGAGCATTCTAGCGCAGAATGA LarCKX01 NGS upstream primer LarCKX01-R CTCTGTCCTGGAGCAAGGATAG LarCKX01 NGS downstream primer Lar_miR1314-F GAATTCCAAGGCTGAATCTG Lar_miR1314 NGS upstream primer Lar_miR1314-R AGGTCGAGATGGAATCAAGT Lar_miR1314 NGS downstream primer
[0186] The compact IsDge10 plant genome editing tool constructed based on the application can effectively edit the Lar_miR1314 site detected in larch, and the editing efficiency is 1.4%. It shows that IsDge10 can effectively edit the endogenous site in the larch genome. Figure 6 )
Claims
1. Use of a coding sequence of a transposon nuclease in constructing a plant genome editing system; the plant is a plant of the family Poaceae; the transposon nuclease is IsDge10, IsAam1 or enIscB; the coding sequence of IsDge10 is shown in Seq ID No. 13; the coding sequence of IsAam1 is shown in Seq ID No. 14; the coding sequence of enIscB is shown in Seq ID No.
15.
2. Use according to claim 1, characterized in that: The plant of the family Poaceae is rice, corn, sorghum, sugarcane, wheat or barley.
3. A plant genome editing system based on transposon nucleases, characterized in that: The plant genome editing system comprises a transposon nuclease protein expression unit, which has the structure of promoter-transposon nuclease-terminator; the plant is a plant of the family Poaceae.
4. The plant genome editing system of claim 3, wherein: The transposon nuclease is a TnpB type transposon nuclease or an IscB type transposon nuclease. Preferably, the TnpB type transposon nuclease is IsDge10 or IsAam1; or the IscB type transposon nuclease is enIscB.
5. The plant genome editing system of claim 4, wherein: The coding sequence of IsDge10 is shown in Seq ID No. 13; or the coding sequence of IsAam1 is shown in Seq ID No. 14; or the coding sequence of enIscB is shown in Seq ID No.
15.
6. The plant genome editing system of claim 3, wherein: In the transposon nuclease protein expression unit, the 5' or / and 3' end of the transposon nuclease is further fused with NLS.
7. The plant genome editing system of claim 3, wherein: The plant genome editing system further comprises a reRNA transcription expression cloning unit, which has the structure of promoter-reRNA scaffold-terminator. Preferably, the nucleotide sequence of the reRNA scaffold is shown in Seq ID No. 1, 12754-12936 bp, Seq ID No. 12 or Seq ID No.
2. Preferably, when a TnpB type transposon nuclease is used, the nucleotide sequence of the reRNA scaffold is shown in Seq ID No. 1, 12754-12936 bp or Seq ID No. 12; when an IscB type transposon nuclease is used, the nucleotide sequence of the reRNA scaffold is shown in Seq ID No.
2. More preferably, when the transposon nuclease used is IsDge10, the nucleotide sequence of the reRNA scaffold is shown in Seq ID No. 1, 12754-12936 bp or Seq ID No. 12; when the transposon nuclease used is IsAam1, the nucleotide sequence of the reRNA scaffold is shown in Seq ID No. 1, 12754-12936 bp or Seq ID No. 12; when the transposon nuclease used is enIscB, the nucleotide sequence of the reRNA scaffold is shown in Seq ID No.
2.
8. The plant genome editing system of claim 13, wherein: The 5' end or 3' end of the reRNA scaffold of the reRNA transcription expression cloning unit is further fused with lacZα. Preferably, the two ends of lacZα are further provided with enzyme cutting sites; Preferably, the enzyme cutting sites are BsaI.
9. The plant genome editing system according to any one of claims 3 to 8, wherein: The promoter is a constitutive promoter, an inducible promoter or a tissue-specific promoter; or the terminator is pinII, AtHSP, NOS or T35S. Preferably, the promoter is rice OsU6 promoter, corn ZmUbi1 promoter, Arabidopsis AtU6 promoter or P35S.
10. The plant genome editing system according to any one of claims 3 to 9, wherein: The plant is a gramineous plant, preferably rice, corn, sorghum, sugarcane, wheat or barley.
11. A vector, cell or host containing the plant genome editing system according to any one of claims 3-10.
12. Use of the vector, cell or host according to claim 11 in plant genome editing; the monocotyledon is a gramineous plant; preferably, the gramineous plant is rice, corn, sorghum, sugarcane, wheat or barley.
Citation Information
Patent Citations
Efficient endogenous promoter of larch and application
CN113943733A