Non-protein amino acid engineered P450DA enzyme mutant and preparation method thereof

Abstract

The invention discloses a method for preparing a non-protein amino acid engineered cytochrome P450DA enzyme mutant, and belongs to the technical field of biology. The method comprises the following steps: firstly, taking escherichia coli E. coli BL21 (DE3) as an original strain, and knocking out a delta pheA gene to construct a phenylalanine defect type genetically engineered bacterium; then, plasmids containing P450DA enzyme genes are transferred into the defective bacteria, and phenylalanine defective engineering bacteria containing the P450DA enzyme genes are obtained; then culturing the engineering bacteria in a phenylalanine defective culture medium containing non-protein amino acids (phenylalanine structural analogues), and performing induced expression to synthesize the engineered P450DA enzyme; and finally purifying the enzyme and analyzing the non-protein amino acid substitution degree through LC / MS-MS. The engineering means of P450DA enzyme is expanded, the cost is low, the operation is simple, and a foundation is laid for synthesis of chiral beta-halohydrin.

Description

Technical Field

[0001] This invention relates to the field of biotechnology, specifically to a non-protein amino acid-engineered P450DA enzyme mutant and its preparation method. Background Technology

[0002] Chiral β-halools are key pharmaceutical and chemical intermediates, serving as crucial building blocks for the synthesis of drugs such as luliconazole (an antifungal drug), soprenaline (a sympathomimetic drug), and sotalol (a hypertension drug). Currently, they are primarily synthesized through chemical catalysis and biocatalysis, both requiring the conversion of oxygen-containing substrates (carbonyl, hydroxyl, or ternary epoxy compounds) into chiral β-halools.

[0003] Cytochrome P450DA enzyme (PDB: 7F3H), derived from the strain Deinococcus apachensis, exhibits significant advantages in catalyzing the synthesis of chiral β-halools. (1) Compared with traditional organic synthesis, the reaction conditions are mild, no precious metals are required, and it is environmentally friendly.

[0004] (2) It is a self-sufficient enzyme, and the catalytic process does not require expensive coenzymes, resulting in low economic cost.

[0005] (3) No special oxygen-containing functional compounds are required as substrates. The carbon-hydrogen bonds (CH) on the β carbon atom (Cβ) of haloalkanes can be directly hydroxylated by oxygen molecules in the air, which is highly efficient and has high atom economy.

[0006] (4) After being improved by protein engineering techniques such as directed evolution, the catalytic activity and selectivity are enhanced, and the yield and ee value can both reach >99%.

[0007] However, the P450DA enzyme has a relatively large molecular weight (120483.54 Da, estimated by Expasy) and poor stability, which limits its industrial application. Furthermore, conventional protein engineering techniques such as directed evolution, post-translational modification, site-directed gene mutagenesis, and computer-aided protein design are unable to solve this stability problem.

[0008] Non-protein amino acids (compounds containing amino and carboxyl groups, excluding the 20 common amino acids that make up proteins in nature) are structurally diverse and are an important means of improving protein performance. However, their application in the field of biocatalysis is still in its early stages. Of the nearly 200 non-protein amino acids that have been discovered, fewer than 10 are used for the engineering modification of the cytochrome P450 enzyme family, and there are no reports on the engineering of P450DA enzymes from non-protein amino acids. Summary of the Invention

[0009] The present invention aims to provide a non-protein amino acid engineered P450DA enzyme mutant and its preparation method, thereby expanding the engineering technology of P450DA enzyme and solving the following technical problems: the poor stability of cytochrome P450DA enzyme cannot be solved by conventional protein engineering technology; there are no relevant reports on the engineering of non-protein amino acids in P450DA enzyme, and there is a lack of feasible technical means.

[0010] To achieve the above objectives, this invention prepares a non-protein amino acid-engineered P450DA enzyme mutant, which is prepared in a residue-specific manner using a selective pressure incorporation method. The selective pressure incorporation method refers to adding exogenous non-protein amino acids to an auxotrophic culture medium, culturing phenylalanine-deficient E. coli cells, expressing the P450DA enzyme gene, and synthesizing the non-protein amino acid-engineered P450DA enzyme mutant.

[0011] Specifically, the method includes the following steps: Step 1: Constructing a phenylalanine-deficient genetically engineered bacterium: Using E. coli BL21(DE3) as the starting strain, the ΔpheA gene was knocked out to prepare the phenylalanine-deficient genetically engineered bacterium E. coli BL21(DE3)-ΔpheA; Step 2: Construct phenylalanine-deficient engineered bacteria containing the P450DA enzyme gene: Extract the plasmid pET28b-P450DA containing the P450DA enzyme gene, and transform it into the phenylalanine-deficient genetically engineered bacteria obtained in Step 1 to obtain phenylalanine-deficient engineered bacteria containing the P450DA enzyme gene. Step 3: Induction of expression and synthesis of enzyme mutants: Add non-protein amino acids to the phenylalanine-deficient culture medium, culture the phenylalanine-deficient engineered bacteria containing the P450DA enzyme gene obtained in Step 2, induce the expression of the P450DA enzyme gene, and synthesize the P450DA enzyme mutant engineered with non-protein amino acids.

[0012] Furthermore, the P450DA enzyme is an enzyme isolated from the Deinococcus apachensis strain, with PDB number 7F3H and a relative molecular weight of 120483.54 Da (estimated by Expasy).

[0013] Furthermore, the specific process for extracting the plasmid containing the P450DA enzyme gene in step 2 is as follows: a bacterial culture is obtained from the engineered bacteria pET28b-P450DA / E. coli BL21(DE3) containing Kan resistance, and the plasmid pET28b-P450DA is extracted from the bacterial culture.

[0014] Furthermore, the non-protein amino acid is a phenylalanine structural analogue, specifically a compound in which 1 to 4 hydrogen atoms on the benzene ring of phenylalanine are substituted; the substituent group is a halogen, methyl, hydroxyl, nitro, amino, or trifluoromethyl, wherein the halogen is fluorine, chlorine, bromine, or iodine; when the number of substituted hydrogen atoms is 2 to 4, the substituent group can be the same group or different groups.

[0015] Furthermore, the composition and preparation requirements of the phenylalanine-deficient culture medium in step 3 are as follows: it contains Na2HPO4•12H2O, KH2PO4, NaCl, NH4Cl, glycerol, Fe2(SO4)3, thiamine, biotin, and 19 kinds of natural amino acids, wherein the natural amino acids do not contain phenylalanine. After dissolving and mixing with ddH2O, it is dispensed and sterilized for later use. Before use, sterilized MgSO4 solution, CaCl2 solution and kanamycin need to be added.

[0016] Furthermore, the non-protein amino acids added in step 3 are based on the final concentration of the L-enantiomer, which is 0.1~20 mM.

[0017] Furthermore, the final concentration of the non-protein amino acids added in step 3 as L-enantiomers is preferably 0.5~10 mM. Furthermore, the non-protein amino acid-engineered P450DA enzyme mutant synthesized in step 3 carries a histidine tag, which is a series of histidine peptides fused to the ends of the recombinant protein.

[0018] The present invention has the following outstanding advantages: (1) It has expanded the application of non-protein amino acids in the field of engineering modification of the cytochrome P450 enzyme family and enriched the engineering technology means of the cytochrome P450 enzyme family. (2) The auxotrophic genetically engineered bacteria and non-protein amino acids have diverse and low-cost acquisition methods, and the process of engineered biological enzymes is simple. Therefore, this invention provides a simple, fast and economical protein engineering technology for P450DA.

[0019] (3) P450DA enzyme mutants with non-protein amino acid engineering were successfully prepared (such as P450DA enzyme containing 3-fluorophenylalanine, in which the average substitution degree of 3-fluorophenylalanine for phenylalanine reached 76.6%), which enriched the P450DA enzyme resources and provided a new, green and highly atom-economical strategy for the synthesis of important pharmaceutical and chemical intermediates, chiral β-haloalcohols, laying the theoretical basis and practical foundation. Attached Figure Description

[0020] Figure 1 Here are the chemical structural formulas of the non-protein amino acids used in this invention; Figure 2 Mass spectra of the reference peptide; where a: mass spectrum of the wild-type peptide; b: mass spectrum of the 3-fluorophenylalanine-containing P450DA enzyme mutant peptide. Caption: F* represents the position of the 3-fluorophenylalanine substitution. Figure 3 The preparation route for the substrate 1-halo-2-phenylethanol; Figure 4 The preparation route for the product reference standard β-haloalcohol; Figure 5 A whole-cell catalytic route for the synthesis of β-halools from 1-halo-2-phenylethane; Figure 6 The effect of metal ion type on the whole-cell catalytic activity of wild-type whole-cell and fluorine-substituted phenylalanine-engineered bioenzymes; Figure 7 The effect of dimethyl sulfoxide content on the whole-cell catalytic activity of wild-type whole-cell and fluorinated substituted phenylalanine-engineered bioenzymes. Detailed Implementation

[0021] The following detailed description illustrates the specific implementation method: Example 1: A method for preparing a P450DA enzyme mutant by incorporating non-protein amino acids into the P450DA enzyme includes the following steps: Step 1: Constructing a phenylalanine-deficient genetically engineered bacterium This invention uses Escherichia coli BL21(DE3) as the starting strain, knocks out the ΔpheA gene, and prepares an alanine-deficient strain E. coli BL21(DE3)-ΔpheA.

[0022] The phenylalanine-deficient Escherichia coli E. coli BL21(DE3)-ΔpheA can also be purchased from Guangzhou Yuanjing Biotechnology Co., Ltd. and stored at -80℃.

[0023] Step 2: Construct a phenylalanine-deficient engineered bacterium containing the P450DA enzyme gene. (1) Preparation of competent cells Remove the phenylalanine-deficient Escherichia coli E. coli BL21(DE3)-ΔpheA from the -80℃ freezer in step 1 above, culture to obtain 50 mL of bacterial culture, centrifuge (4℃, 4000 rpm for 12 min), collect the bacterial cells, add 10 mL of sterile and pre-cooled 0.1 M CaCl2 solution to fully suspend the bacterial cells, place in an ice bath for 10 min, centrifuge (4℃, 4000 rpm for 10 min), collect the bacterial cells, and add 1 mL of sterile and pre-cooled 0.1 M CaCl2 solution (15% glycerol, v / v).

[0024] (2) Transformation plasmid Take 100 µL of competent cells from step (1) above, add 10 µL of plasmid pET28b-P450DA containing the P450DA enzyme gene (purchased directly from biotechnology companies such as Guangzhou Yuanjing Biotechnology Co., Ltd., or by culturing pET28b-P450DA / E. coli BL21(DE3) engineered bacteria and then extracting the plasmid pET28b-P450DA containing the P450DA enzyme gene using a plasmid extraction kit (purchased from Axygen). The pET28b-P450DA / E. coli BL21(DE3) engineered bacteria can be purchased directly), mix well (ice bath, 30 min), heat shock (42℃ water bath) for 90 s, then place in an ice bath for 2 min, add 600 µL of liquid LB Escherichia coli complete culture medium (yeast extract 5 g / L, peptone 10 g / L, NaCl). 10 g / L), and after 1 h of recovery (37℃, 150 rpm), the engineered strain pET28b-P450DA / E. coli BL21(DE3)-ΔpheA containing the P450DA enzyme gene and phenylalanine auxotroph was obtained.

[0025] (3) Validation of engineered bacteria Take the engineered bacteria pET28b-P450DA / E. coliBL21(DE3)-ΔpheA from the above steps, and culture to obtain 10 mL of bacterial suspension (Kan resistant); take 800 µL of bacterial suspension, add 800 µL of 30% glycerol aqueous solution, send the sample, and perform plasmid sequencing; the sequencing primer sequence is GAAATCTATAGTCAAAACCA; the sequencing was completed by Sangon Biotech (Shanghai) Co., Ltd.

[0026] Step 3: Express the target gene and synthesize the non-protein amino acid engineered P450DA enzyme mutant. Take the auxotrophic genetically engineered bacteria that were successfully sequenced in step 2 above, and use the selective pressure incorporation method to induce the expression of the cytochrome P450DA enzyme gene in a residue-specific manner to synthesize a non-protein amino acid engineered P450DA enzyme mutant; purify and preliminarily characterize the engineered P450DA enzyme mutant by SDS-PAGE.

[0027] Cytochrome P450DA enzyme (PDB: 7F3H) was isolated from Deinococcus apachensis strain, with a relative molecular weight of 120483.54 Da (estimated by Expasy); the P450DA enzyme mutant engineered in this invention contains 45 phenylalanine residues; the recombinant protein with histidine tag in this invention is a peptide segment with multiple histidine residues fused to its terminal.

[0028] The term "selective pressure incorporation" comes from the English word "selective pressure incorporation," which refers to the process of adding exogenous non-protein amino acids to auxotrophic culture media, culturing auxotrophic cells, inducing the expression of the P450DA enzyme gene, and synthesizing engineered P450DA enzyme mutants. This is an operation well known to those skilled in the art.

[0029] The term "auxotrophic strain" comes from the English word "auxotrophic strain"; the host cell used in this invention is E. coli; the auxotrophic E. coli cells used in this invention are phenylalanine-deficient cells.

[0030] The auxotrophic culture medium used in this invention is a phenylalanine auxotrophic medium: 17.1 g / L Na2HPO4•12H2O, 3.0 g / L KH2PO4, 0.5 g / L NaCl, 1.0 g / L NH4Cl, 5.0 g / L glycerol, 1 μM Fe2(SO4)3, 35 mg / L thiamine, 35 mg / L biotin, and 0.35 mM each of 19 natural amino acids (excluding phenylalanine). The medium is dissolved in ddH2O, mixed, dispensed, and sterilized (115℃, 30 min) for later use. Before use, the medium also requires the addition of 2 mL / L sterilized 1.0 M MgSO4 solution, 1 mL / L 0.1 M CaCl2 solution, and kanamycin (0.1%, v / v). When inducing the expression of the protein gene to be tested, the amount of non-protein amino acids added to the phenylalanine-deficient liquid culture medium should be based on the final concentration of the L-enantiomer, which is 0.1-20 mM, with the optimum being 0.5-10 mM.

[0031] The non-protein amino acid used in this invention is a phenylalanine structural analogue, which is a compound in which one hydrogen atom on the benzene ring of phenylalanine is replaced by a group. Figure 1 The non-protein amino acid can also be a compound in which multiple hydrogen atoms on the benzene ring of phenylalanine are replaced by the same or different groups; the group refers to a halogen element or methyl or hydroxy or nitro or amino or trifluoromethyl; the halogen element refers to fluorine or chlorine or bromine or iodine.

[0032] The term "residue-specific incorporation" comes from the English word "residue-specific incorporation," which refers to a non-protein amino acid that replaces the parent amino acid phenylalanine in the amino acid sequence of the P450DA enzyme to be engineered, and the position of the substituted phenylalanine is uncertain. Step 4: LC / MS-MS assessment of the degree of non-protein amino acid substitution in engineered P450DA enzymes. (1) Preparation of LC / MS-MS test samples The P450DA enzyme containing non-protein amino acids synthesized in step 3 above was purified, and then hydrolyzed, desalted, and concentrated to prepare LC / MS-MS analysis samples. The purification method mentioned above is metal affinity chromatography; the hydrolysis method mentioned above uses trypsin as the protease; the desalting and concentration methods mentioned above use Millipore ZipTip series desalting columns.

[0033] (2) LC / MS-MS test: The present invention uses the LC / MS-MS method to determine the relative molecular weight and content of a certain peptide in the sample to be tested, and analyzes the LC / MS-MS data to obtain the degree of non-protein amino acid substitution; the LC / MS-MS test was completed by the Public Technology Center of Shanghai Institute of Materia Medica, Chinese Academy of Sciences; the method for analyzing the LC / MS-MS results is a well known operation to those skilled in the art.

[0034] Example 2: Preparation of wild-type P450DA enzyme Phenylalanine-deficient E. coli host cells were cultured in LB complete medium (containing 0.1–20 mM of 20 protein amino acids) without the addition of exogenous non-protein amino acids to induce expression of the P450DA enzyme gene and synthesize wild-type P450DA enzyme; purified; and the results of SDS-PAGE analysis were confirmed by LC / MS-MS.

[0035] The results are as follows: The selected reference peptide has the following amino acid sequence: HPQYGHLHYLAGDAPVLNFFQLAR (as shown in SEQ ID No. 1), containing two phenylalanine residues. The wild-type reference peptide has a relative molecular weight of 2765.13 g / mol (Estimated by Expasy). The theoretically calculated mass-to-charge ratio is 692.2825, and the mass-to-charge ratio measured by LC / MS-MS is 692.11, with an error of 0.025%. The error is within a reasonable range. This demonstrates that the expression system, purification process, and LC / MS-MS detection method are accurate and reliable, and can provide a "standard reference" for comparison with the following engineered enzymes.

[0036] Example 3: Preparation of a 3-fluorophenylalanine-containing P450DA enzyme mutant In a phenylalanine-deficient culture medium, 0.1–20 mM 3-fluorophenylalanine (L-type) was added instead of exogenous phenylalanine. P450DA enzyme gene expression was induced in phenylalanine-deficient E. coli host cells to synthesize a P450DA enzyme mutant containing 3-fluorophenylalanine. The degree of 3-fluorophenylalanine substitution for phenylalanine was then assessed by LC / MS-MS.

[0037] In this embodiment, the bacteria were cultured in a phenylalanine-deficient medium containing 3-fluorophenylalanine but lacking phenylalanine. Three peptide signals (wild type, one 3-fluorophenylalanine substitute, and two 3-fluorophenylalanine substitutes) were detected by LC / MS-MS. The mass-to-charge ratio of each peptide type was within a reasonable range (0.025%) compared to the theoretical value. This directly proves that non-protein amino acids (3-fluorophenylalanine) can be recognized by phenylalanine-deficient engineered bacteria and incorporated into P450DA enzyme as a substitute for phenylalanine, thus achieving the "synthesis of engineered enzymes".

[0038] The results are as follows: (1) The amino acid sequence of the selected reference peptide is: HPQYGHLHYLAGDAPVLNFFQLAR (as shown in SEQ ID No. 1), and the reference peptide contains two phenylalanine residues. The relative molecular weight of the wild-type reference peptide is 2765.13 g / mol (Estimated by Expasy), and its corresponding peak is in Figure 2 In b, some phenylalanine residues in the reference peptide were not replaced by 3-fluorophenylalanine.

[0039] (2) The relative molecular weight of the reference peptide after being replaced by one 3-fluorophenylalanine residue is 2783.13 g / mol. The theoretically calculated mass-to-charge ratio of the peptide containing one 3-fluorophenylalanine residue is 696.7825, and the mass-to-charge ratio measured by LC / MS-MS is 696.61, with an error of 0.025%. The error is within a reasonable range. A portion of the phenylalanine residue in the reference peptide was replaced by one 3-fluorophenylalanine residue.

[0040] (3) The relative molecular weight of the peptide after the reference peptide was replaced by two 3-fluorophenylalanine residues was 2801.13 g / mol. The theoretically calculated mass-to-charge ratio of the peptide containing two 3-fluorophenylalanine residues was 701.2825, and the mass-to-charge ratio measured by LC / MS-MS was 701.11, with an error of 0.025%. The error is within a reasonable range. In some reference peptides, phenylalanine residues were replaced by one 3-fluorophenylalanine residue.

[0041] (4) The average degree of 3-fluorophenylalanine substitution for phenylalanine in P450DA enzyme is 76.6%, which proves that this technical solution is an efficient P450DA enzyme engineering method, providing a technical basis for subsequent exploration of enzyme performance optimization.

[0042] in conclusion: Through comparative experiments of Examples 1 and 2, this invention demonstrates for the first time that the selective pressure incorporation method can successfully incorporate non-protein amino acids (3-fluorophenylalanine) into P450DA enzymes, and establishes a complete "preparation-purification-detection" technical process, directly filling the gap in this technical field and solving the problem of "lack of technical means for engineering P450DA enzymes with non-protein amino acids" in the prior art.

[0043] Example 4: Preparation of a 2-fluorophenylalanine-containing P450DA enzyme mutant In a phenylalanine-deficient culture medium, 0.1–20 mM 2-fluorophenylalanine (L-type) was added instead of exogenous phenylalanine. P450DA enzyme gene expression was induced in phenylalanine-deficient E. coli host cells to synthesize a P450DA enzyme mutant containing 2-fluorophenylalanine. The degree of 2-fluorophenylalanine substitution for phenylalanine was assessed by LC / MS-MS after purification.

[0044] Example 5: Taking the 2-fluorophenylalanine-containing P450DA enzyme mutant as an example, a method for using it as a biocatalyst to synthesize β-haloalcohols includes the following steps: Step S1: Substrate synthesis and preparation of substrate storage solution (1) Substrate synthesis The substrate referred to in this invention is a substrate for biocatalytic hydroxylation reactions, specifically 1-halo-2-phenylethane; one substrate is 1-chloro-2-phenylethane; another non-limiting example of the substrate 1-halo-2-phenylethane includes 1-fluoro-2-phenylethane, 1-bromo-2-phenylethane, or 1-iodo-2-phenylethane, preferably 1-fluoro-2-phenylethane or 1-bromo-2-phenylethane; another non-limiting example of the substrate 1-halo-2-phenylethane further includes compounds in which one, two, three, four, or five hydrogen atoms on the benzene ring are substituted by the same substituent or different substituents, preferably one or two hydrogen atoms are substituted by the same substituent; the substituents mentioned above refer to compounds substituted with fluorine, chlorine, bromine, iodine, methyl, ethyl, methoxy, amino, or trifluoromethyl, preferably fluorine, chlorine, bromine, methyl, methoxy, or amino.

[0045] The substrate 1-halo-2-phenylethane referred to in this invention is synthesized from the corresponding 1-halo-2-phenylethanol. Figure 31-Halo-2-phenylethanol was purchased from Adamas, Acros, Amethyst, or Bailingwei. The reaction conditions for the halogenation reaction used in the method of this invention are well known to those skilled in the art. In a preferred embodiment of this invention, 1-chloro-2-phenylethanol is chlorinated to obtain 1-chloro-2-phenylethane under the following conditions: triphenylphosphine (PPh3, 1.1 equiv) and 2,2,2-trichloroacetamide (CCl3CONH2, 1 equiv) are dissolved in dichloromethane (CH2Cl2), under argon protection, and 1-chloro-2-phenylethanol (1 equiv) is added dropwise with stirring at room temperature, and the reaction is allowed to proceed overnight at room temperature. After the reaction is complete, the mixture is quenched with cold water, extracted, dried, and purified by silica gel column chromatography to obtain the target substrate 1-chloro-2-phenylethane.

[0046] (2) Preparation of substrate storage solution The biocatalytic reaction medium referred to in this invention is an aqueous solution. However, the substrates used in this invention are small organic molecule compounds with poor water solubility. Therefore, it is necessary to prepare a storage solution for the substrates and store it in a 4°C refrigerator for later use. The substrate storage solution is prepared as follows: 50 mM PB buffer (Na2HPO4 and KH2PO4), 0.1% (v / v) co-solvent DMSO, and the final substrate concentration is 1 M.

[0047] Step S2: Synthesize the product, use β-haloalcohol as a reference, and establish a standard curve. (1) Synthetic product reference standard β-haloalcohol The β-haloalcohol, the product reference standard referred to in this invention, is synthesized from styrene compounds. Figure 4 The conditions for synthesizing the β-haloalcohol are well known to those skilled in the art. In a preferred embodiment of the present invention, the reaction conditions for the synthesis of 2-chloro-1-phenylethanol are as follows: ammonium chloride (NH4Cl, 1 equiv) is dissolved in an acetone-water mixture (1:1, v / v), styrene (1 equiv) is added dropwise with stirring at room temperature, and the reaction is carried out overnight at room temperature. After the reaction is complete, the mixture is quenched with cold water, extracted, dried, and purified by silica gel column chromatography to obtain the product reference standard 2-chloro-1-phenylethanol.

[0048] (2) Establishing a standard curve This invention employs an HPLC method well-known to those skilled in the art to establish a standard curve for the product reference β-haloalcohol. Solutions of the product reference β-haloalcohol at different concentrations are prepared using PB buffer.

[0049] Step S3: Biocatalytic substrate hydroxylation reaction (1) Preparation of biocatalysts The biocatalyst referred to in this invention is the whole cell containing the engineered bioenzyme (2-fluorophenylalanine P450DA enzyme mutant) induced and expressed in Example 4. A small sample was taken from the bacterial culture after induction in step S3, diluted tenfold, and the OD600 value was measured. The remaining bacterial culture was centrifuged (9000 rpm, 3 min), and the bacterial cells were collected. The dry weight of the collected bacterial cells was calculated based on the correspondence between the OD600 value and the dry weight of the cells in the bacterial culture. The bacterial cells were resuspended in PB buffer to obtain a bacterial suspension with a concentration of 5-35 g cdw / L, preferably 10-25 g cdw / L.

[0050] (2) Catalytic substrate hydroxylation reaction The substrate hydroxylation reaction referred to in this invention refers to the use of the whole cell as a catalyst in 1) above to catalyze the β-carbon atom (C1-hydroxylation) of the substrate 1-halo-2-phenylethane. β The product β-halool () undergoes a hydroxylation reaction to yield a product β-halool () Figure 5 The hydroxylation reaction conditions used in the method of this invention are well known to those skilled in the art. In a preferred embodiment of this invention, the hydroxylation reaction conditions are as follows: the reaction system is PB buffer; the pH of the reaction system is 5-11, with an optimal pH of 7-10; the total volume of the reaction system is 1-20 mL, preferably 5-15 mL; the cell concentration is 20-70 g cdw / L, preferably 25-65 g cdw / L; the amount of co-solvent is 0.05-5% (v / v), with an optimal amount of 0.2-1.0%; the co-solvent referred to above is such as DMSO, EtOH, MeOH, CH3CN, or THF, with MeOH, CH3CN, or THF being preferred for solubilization; the reaction temperature is 5-45 °C, preferably 10-40 °C; the substrate concentration is 0.5-10 mM, preferably 1-7 mM; and the reaction time is 24 h.

[0051] The analysis of the metal ion tolerance of the biocatalyst in this invention refers to adding 0.1 M stock solutions of different metal ions under optimal reaction conditions (pH, cell concentration, co-solvent volume, substrate concentration), and adjusting the volume to the optimal reaction volume, resulting in a final metal ion concentration of 1 mM. The hydroxylation reaction is then carried out at the optimal reaction temperature (shake, 250 rpm, 24 h). The metal ions referred to above include, for example, Mg... 2+ Ca 2+ Mn 2+ Co 2+ Ni 2+ Cu 2+ Zn 2+ Fe 2+The metal ion storage solutions mentioned above refer to solutions of MgSO4, CaCl2, MnSO4, CoCl2, NiCl2, CuSO4, ZnCl2, and FeSO4 prepared using PB buffer solution.

[0052] The analysis of the tolerance of the biocatalyst dimethyl sulfoxide in this invention refers to first mixing PB buffer at the optimal pH with 0.1%, 0.25%, 0.5%, 2.5%, 5%, 7.5%, 10%, and 15% (v / v) of the organic solvent dimethyl sulfoxide (DMSO) to a better total volume of the reaction system, adding E. coli cell resuspension to the optimal cell concentration, and then adding substrate stock solution to the optimal substrate concentration, and carrying out the hydroxylation reaction at the optimal reaction temperature (shake, 250 rpm, 24 h).

[0053] (3) Terminate the reaction, analyze the reaction sample, and detect the reaction product. After the reaction in (2) above is completed, the sample is extracted with ethyl acetate, and the water in the organic solvent is removed with a drying agent. The sample is then analyzed by HPLC. The HPLC uses a CHIRALCEL OD-H analytical column, with a mobile phase of isopropanol and n-hexane mixed solvent (5:95, v / v), a flow rate of 1 mL / min, and a detection wavelength of 220 nm.

[0054] Step S4: LC / MS-MS assessment of the degree of non-protein amino acid substitution in engineered P450DA enzymes. (1) Preparation of LC / MS-MS test samples The P450DA enzyme containing non-protein amino acids synthesized in step S3 above was purified, and then hydrolyzed, desalted, and concentrated to prepare LC / MS-MS analysis samples. The purification method mentioned above is metal affinity chromatography; the hydrolysis method mentioned above uses trypsin as the protease; the desalting and concentration methods mentioned above use Millipore ZipTip series desalting columns.

[0055] (2) LC / MS-MS test: The present invention uses the LC / MS-MS method to determine the relative molecular weight and content of a certain peptide in the sample to be tested, and analyzes the LC / MS-MS data to obtain the degree of non-protein amino acid substitution; the LC / MS-MS test was completed by the Public Technology Center of Shanghai Institute of Materia Medica, Chinese Academy of Sciences; the method for analyzing the LC / MS-MS results is a well known operation to those skilled in the art.

[0056] Analysis and Evaluation: Taking the 2-fluorophenylalanine-containing P450DA enzyme mutant as an example, the following four evaluation experiments constructed a control system by controlling variables such as "wild-type biocatalyst," "fluorine-substituted phenylalanine engineered biocatalyst (engineered P450DA enzyme)," "different metal ion environments," and "different DMSO concentration environments" to verify the optimization effect of "engineering of non-protein amino acids (fluorine-substituted phenylalanine)" on the performance of P450DA enzyme. I. Evaluation of Metal Ion Tolerance in Wild-Type Whole-Cell Catalytic Hydroxylation Reaction E. coli host cells were cultured in liquid complete culture medium to induce the expression of biological enzyme genes and synthesize biological enzymes; a small amount of bacterial solution was taken, diluted 10 times and the OD600 value was measured; the remaining bacterial solution was centrifuged and the bacterial cells were collected; the bacterial cells were resuspended in PB buffer.

[0057] A portion of the resuspended bacterial cells was added to the optimal reaction conditions (pH, solubilizer volume, substrate concentration) to obtain the optimal final cell concentration. Stock solutions of different metal ions were added, and the volume was adjusted to the optimal reaction volume, resulting in a final metal ion concentration of 1 mM. The hydroxylation reaction was carried out at the optimal reaction temperature (shake, 250 rpm, 24 h). After the reaction, samples were taken, and the generated products were analyzed by HPLC. In the control group experiment, no metal ions were added to the reaction system. The results are as follows: (1) In Co-containing 2+ In the reaction system, the wild-type biocatalyst exhibited the highest yield, reaching 55.9%; indicating that among the tested metal ions, Co... 2+ It has the least impact on the activity of wild-type biocatalysts.

[0058] (2) In Cu-containing 2+ In the reaction system, the wild-type biocatalyst had the lowest yield, only 14.7%; indicating that among the tested metal ions, Cu... 2+ It has the greatest impact on the activity of wild-type biocatalysts.

[0059] II. Evaluation of dimethyl sulfoxide tolerance to whole-cell catalytic hydroxylation reaction in wild-type cells First, PB buffer at the optimal pH was mixed with 0.1%, 0.25%, 0.5%, 2.5%, 5%, 7.5%, 10%, and 15% (v / v) of dimethyl sulfoxide (DMSO) organic solvent to achieve the optimal total reaction volume. A portion of the resuspended bacterial cells from Example 1 was added to the reaction system to the optimal cell concentration, followed by the addition of substrate stock solution to the optimal substrate concentration. The hydroxylation reaction was then carried out at the optimal reaction temperature (shake, 250 rpm, 24 h). After the reaction, samples were taken, and the generated product was analyzed by HPLC. The results are as follows: (1) In the reaction system with a dimethyl sulfoxide content of 7.5% (v / v), the wild-type biocatalyst had the highest yield, reaching 52.2%.

[0060] (2) In the reaction system with a dimethyl sulfoxide content of 15% (v / v), the wild-type biocatalyst had the lowest yield of 43.8%.

[0061] III. Evaluation of the metal ion tolerance of the whole-cell catalytic hydroxylation reaction of the engineered P450DA bioenzyme mutant containing fluorinated phenylalanine. In a phenylalanine-deficient liquid culture medium, fluorinated phenylalanine was added instead of exogenous phenylalanine. E. coli host cells were cultured to induce the expression of a biological enzyme gene and synthesize the biological enzyme. A small amount of bacterial culture was taken, diluted tenfold, and the OD600 value was measured. The remaining bacterial culture was centrifuged, and the bacterial cells were collected. PB buffer was added to resuspend the bacterial cells.

[0062] A portion of the resuspended bacterial cells was added to the optimal reaction conditions (pH, solubilizer volume, substrate concentration) to obtain the optimal final cell concentration. Stock solutions of different metal ions were added, and the volume was adjusted to the optimal reaction volume, resulting in a final metal ion concentration of 1 mM. The hydroxylation reaction was carried out at the optimal reaction temperature (shake, 250 rpm, 24 h). After the reaction, samples were taken, and the generated products were analyzed by HPLC. In the control group experiment, no metal ions were added to the reaction system. The results are as follows: (1) The degree of substitution of fluorinated phenylalanine in the biological enzyme is 78%.

[0063] (2) Overall, in systems containing different metal ions, whole-cells of engineered bioenzymes containing fluorine-substituted phenylalanine have a higher yield than wild-type whole-cells, thus whole-cells containing engineered bioenzymes have stronger metal ion tolerance. Figure 6 ).

[0064] (3) Whole-cell reaction of fluorine-substituted phenylalanine engineered bioenzymes with Ni 2+ It has the highest tolerance, being 1.41 times that of the wild-type whole cell.

[0065] (4) Among all the metal ions tested, Co 2+ The impact on biocatalysts was minimal: the whole-cell catalytic yield of the fluorinated phenylalanine-engineered bio-enzyme was the highest, reaching 66.8%; the wild-type biocatalyst had the highest catalytic yield, reaching 55.9%.

[0066] IV. Evaluation of the dimethyl sulfoxide tolerance of the whole-cell catalytic hydroxylation reaction of the engineered P450DA bioenzyme mutant containing fluorinated phenylalanine. First, PB buffer at the optimal pH was mixed with 0.1%, 0.25%, 0.5%, 2.5%, 5%, 7.5%, 10%, and 15% (v / v) of dimethyl sulfoxide (DMSO) organic solvent to achieve the optimal total reaction volume. A portion of the resuspended bacterial cells from Example 3 was added to the reaction system to the optimal cell concentration, followed by substrate stock solution to the optimal substrate concentration. The hydroxylation reaction was then carried out at the optimal reaction temperature (shake, 250 rpm, 24 h). After the reaction, samples were taken, and the generated product was analyzed by HPLC. The results are as follows: (1) The degree of substitution of fluorinated phenylalanine in the biological enzyme is 78%.

[0067] (2) Overall, in reaction systems with different dimethyl sulfoxide contents, the whole-cells of fluorinated phenylalanine-engineered bioenzymes exhibited higher dimethyl sulfoxide tolerance than wild-type whole-cells. Figure 7 ).

[0068] (3) In the reaction system with a dimethyl sulfoxide content of 0.5% (v / v), the whole cell yield of the fluorinated phenylalanine engineered bioenzyme was the highest, reaching 68.8%, which is 1.34 times the whole cell yield of the wild type.

[0069] (4) In a reaction system with a dimethyl sulfoxide content of 10% (v / v), the whole cell of the fluorinated substituted phenylalanine engineered bioenzyme still has a high yield, reaching 54.4%.

[0070] in conclusion: 1. Conclusion on metal ion tolerance Wild-type P450DA enzymes showed significant differences in tolerance to different metal ions, particularly to Co. 2+ It exhibits the best adaptability (yield 55.9%) for Cu. 2+ The worst tolerance (yield 14.7%). After being engineered by substituting phenylalanine with fluorine, the overall metal ion tolerance of the enzyme was significantly improved. In all tested metal ion environments, the catalytic yield of the engineered enzyme was higher than that of the wild type, especially for Ni. 2+ The most significant improvement in tolerance was observed (1.41 times that of the wild type), and it also showed the best resistance to Co. 2+ Its adaptability has been further optimized (yield reached 66.8%).

[0071] 2. Conclusion on DMSO Tolerance Wild-type P450DA enzymes exhibit limited tolerance to DMSO, with the highest yield (52.2%) at a DMSO concentration of 7.5%, decreasing to 43.8% at a concentration of 15%. The engineered enzyme exhibits significantly better DMSO tolerance than the wild type, achieving a yield of 68.8% at 0.5% DMSO (1.34 times that of the wild type), and maintaining a high yield of 54.4% even at a high concentration of DMSO (10%), demonstrating its adaptability to catalytic systems with higher co-solvent concentrations.

[0072] 3. Conclusion on the effectiveness of the technology The engineering modification of non-protein amino acids (fluorinated phenylalanine) is an effective means to improve the "tolerance performance" (tolerance to metal ions and organic solvents) of P450DA enzymes. Moreover, the modified enzymes still maintain high catalytic activity, providing a feasible solution to the bottleneck of its industrial application.

[0073] 4. In existing technologies, the poor stability of P450DA enzymes is a bottleneck for industrial applications. In industrial catalysis scenarios, "residual metal ions" (such as trace metal ions in the reaction system or metal ions dissolved from equipment) and "organic solvent aids" (such as DMSO used to dissolve hydrophobic substrates) are common environmental stresses that further reduce enzyme stability and catalytic activity. The four sets of experiments above demonstrate that the engineered enzyme exhibits significantly better metal ion tolerance and DMSO tolerance than the wild type. Essentially, this is achieved by improving the enzyme's "environmental stability" through non-protein amino acid modification, directly addressing the core bottleneck of "poor stability" and enabling the enzyme to maintain high catalytic activity in more complex environments that more closely resemble industrial production.

[0074] 5. Four sets of experiments demonstrated through specific data that fluorinated phenylalanine can not only be successfully incorporated into P450DA enzyme (with a substitution rate of 78%), but also significantly improve the key performance of the enzyme (tolerance and stability). Moreover, the improvement effect can be quantified, directly verifying the feasibility and superiority of "non-protein amino acid engineering technology" in the modification of P450DA enzyme, filling the gap in this technical field, and solving the problem of "lack of feasible technical means" in the existing technology.

[0075] The above descriptions are merely embodiments of the present invention, and common knowledge such as specific technical solutions and / or characteristics are not described in detail here. It should be noted that those skilled in the art can make various modifications and improvements without departing from the technical solutions of the present invention, and these should also be considered within the scope of protection of the present invention. These modifications and improvements will not affect the effectiveness of the implementation of the present invention or the practicality of the patent. The scope of protection claimed in this application should be determined by the content of its claims, and the specific embodiments described in the specification can be used to interpret the content of the claims.

Claims

1. A method for preparing a non-protein amino acid-engineered P450DA enzyme mutant, characterized in that, It is prepared using a selective pressure incorporation method in a residue-specific manner; the selective pressure incorporation method refers to adding exogenous non-protein amino acids to an auxotrophic culture medium to cultivate phenylalanine auxotrophs. E. coli Cells express the P450DA enzyme gene and synthesize non-protein amino acid-engineered P450DA enzyme mutants.

2. The method according to claim 1, characterized in that, Includes the following steps: Step 1: Constructing a phenylalanine-deficient genetically engineered bacterium: using *Escherichia coli* as an example. E. coli Using BL21(DE3) as the starting strain, the ΔpheA gene was knocked out to prepare a phenylalanine-deficient genetically engineered bacterium. E. coli BL21(DE3)-ΔpheA; Step 2: Construct phenylalanine-deficient engineered bacteria containing the P450DA enzyme gene: Extract the plasmid pET28b-P450DA containing the P450DA enzyme gene, and transform it into the phenylalanine-deficient genetically engineered bacteria obtained in Step 1 to obtain phenylalanine-deficient engineered bacteria containing the P450DA enzyme gene. Step 3: Induction of expression and synthesis of enzyme mutants: Add non-protein amino acids to the phenylalanine-deficient culture medium, culture the phenylalanine-deficient engineered bacteria containing the P450DA enzyme gene obtained in Step 2, induce the expression of the P450DA enzyme gene, and synthesize the P450DA enzyme mutant engineered with non-protein amino acids.

3. The method according to claim 1, characterized in that, The non-protein amino acid is a phenylalanine structural analogue, specifically a compound in which 1 to 4 hydrogen atoms on the benzene ring of phenylalanine are substituted; the substituent group is a halogen, methyl, hydroxyl, nitro, amino, or trifluoromethyl, wherein the halogen is fluorine, chlorine, bromine, or iodine; when the number of substituted hydrogen atoms is 2 to 4, the substituent group can be the same group or different groups.

4. The method according to claim 3, characterized in that, The preferred halogen element is fluorine.

5. The method according to claim 4, characterized in that, The non-protein amino acids include one of 2-fluorophenylalanine, 3-fluorophenylalanine, and 4-fluorophenylalanine.

6. The method according to claim 1, characterized in that, The composition and preparation requirements of the phenylalanine-deficient culture medium in step 3 are as follows: it contains Na2HPO4•12H2O, KH2PO4, NaCl, NH4Cl, glycerol, Fe2(SO4)3, thiamine, biotin, and 19 kinds of natural amino acids, which do not contain phenylalanine. After dissolving and mixing with ddH2O, it is dispensed and sterilized for later use. Before use, sterilized MgSO4 solution, CaCl2 solution and kanamycin need to be added.

7. The method according to claim 1, characterized in that, The non-protein amino acids added in step 3 are based on the final concentration of the L-enantiomer, which is 0.1~20 mM.

8. The method according to claim 1, characterized in that, The final concentration of the non-protein amino acids added in step 3 in L-enantiomers is preferably 0.5 to 10 mM.

9. The method according to claim 1, characterized in that, The non-protein amino acid-engineered P450DA enzyme mutant synthesized in step 3 carries a histidine tag, which is a series of histidine peptides fused to the ends of the recombinant protein.

10. A non-protein amino acid-engineered P450DA enzyme mutant, characterized in that, The non-protein amino acid-engineered P450DA enzyme mutant was prepared using the method described in any one of claims 1 to 9.

Images