Diabetes diagnostic kit with GCKR gene mutation and application

Abstract

The invention discloses a GCKR gene mutation diabetes diagnosis kit and application thereof. The method comprises the following steps: determining two new gene mutation sites causing the presentation of the phenotype of type 2 diabetes mellitus: GCKR gene c.718Cgt; t, c, 1551Ggt; t mutation. According to a Chinese hereditary endocrine metabolic disease queue and reported GCKR mutation case information, GCKR gene mutation diabetes diagnosis sites are further expanded, phenotypic characteristics of novel diabetes caused by GCKR gene mutation are further extracted, a diagnosis scoring model, namely GCKR scores, for diagnosing the novel diabetes caused by GCKR gene mutation is constructed, and the GCKR scores are used for diagnosing the novel diabetes caused by GCKR gene mutation. And performing subject working curve verification to obtain an effective GCKR score diagnosis model. According to the method, a precise diabetes typing diagnosis system is further constructed, and after variation information is obtained, the patients are scored and typed again in combination with clinical phenotypes of the patients, so that precise diagnosis of diabetes is carried out. According to accurate typing of diabetes, patients are treated, complications are monitored and prevented, and grading guidance is performed on prenatal and postnatal care.

Description

[0001] This application is a divisional application of the parent application with the application number 202211277979.8, the application date of October 19, 2022, and the name of "Diabetes diagnostic kit based on GCKR gene mutation and application". TECHNICAL FIELD

[0002] The present application relates to the technical field of gene diagnosis kit for diabetes subtypes and prognosis prediction, in particular to the establishment of a new diabetes subtyping diagnostic kit based on GCKR gene inactivation mutation and subsequent clinical prediction application. BACKGROUND

[0003] Diabetes is a chronic systemic disease with heterogeneity and elevated blood glucose as the main feature. Its complication rate of disability and death is high. As of 2021, one in ten adults worldwide has diabetes, with a total of 537 million people, accounting for 10.5% of the global population. The prevalence of diabetes is growing at an alarming rate, placing a heavy burden on society. The World Health Organization and the International Diabetes Federation classify diabetes into 1 type diabetes, 2 type diabetes, mixed type diabetes and other special types of diabetes based on clinical characteristics and etiology. At present, many genome association studies or clustering studies have confirmed that diabetes needs more precise subtyping, and its clinical characteristics and prognosis differ significantly. It is urgent to find new markers for more accurate diagnosis and prediction of diabetes.

[0004] Most studies show that genes highly related to diabetes mainly encode molecules in the insulin synthesis, secretion and insulin action pathway. Genes that directly encode molecules involved in six-carbon sugar metabolism are very rare. GCK gene is currently the most important one found. GCK gene encodes glucose kinase, and its inactivation mutation can cause juvenile-onset adult-onset diabetes type 2 (MODY2). GCKR, as a post-transcriptional regulatory molecule of GCK, can bind to GCK and inhibit the kinase activity of GCK in the cytoplasm. The combination of GCK-GCKR is reversible. Unlike GCK, GCKR can also act as a receptor and bind to metabolic products such as fructose-1-phosphate, fructose-6-phosphate and glucose, and undergo conformational changes to regulate the binding ability with GCK, further participating in sugar metabolism. GCKR gene is located on chromosome 2, with 19 exons, and the full-length cDNA is 2189 bases, mainly expressed in hepatocytes. In recent years, more and more clinical studies have shown that single nucleotide polymorphisms located on GCKR, such as rs1260326 and rs780094, are closely related to metabolic glucose-lipid disease phenotypes, but the causal relationship between GCKR gene inactivation mutation and metabolic diseases, especially diabetes, has not been directly determined.

[0005] In summary, in order to further explore the role of GCKR in glycolipid metabolism disorders, and explore new diagnostic and predictive markers for diabetes, the present application is based on clinical, animal and cell verification, and it is clear that inactivation mutation of GCKR gene can lead to a new clinical manifestation of a new subtype of type 2 diabetes. Further, a diagnostic kit for detecting GCKR mutation in clinic is constructed, and a new diagnostic model of diabetes subtype caused by GCKR gene mutation is established, so as to realize precise diagnosis of diabetes in patients, and a new diabetes analysis, diagnosis, prediction and intervention system is constructed based on GCKR mutation, which is applied to predict complications and prognosis of different types of diabetes patients. Therefore, precise diagnosis and treatment can be realized for hundreds of millions of diabetes patients, and it has a broad clinical application prospect. SUMMARY

[0006] The primary purpose of the present application is to provide a GCKR gene mutation diabetes molecular marker, so as to realize precise diagnosis and prognosis prediction of diabetes.

[0007] The GCKR gene mutation diabetes molecular marker comprises at least one of c.718C>T, c.1551G>T mutations.

[0008] The secondary purpose of the present application is to provide a reagent for detecting at least one of c.718C>T, c.1551G>T mutations of GCKR gene in the preparation of a GCKR gene inactivation mutation diabetes diagnostic preparation.

[0009] The third purpose of the present application is to provide a GCKR gene inactivation mutation diabetes diagnostic kit, which comprises a reagent for detecting at least one of c.718C>T, c.1551G>T mutations of GCKR gene.

[0010] The fourth object of the present application is to provide the use of a reagent for detecting a combination of mutations in the preparation of a diagnostic preparation for diabetes caused by mutations in the GCKR gene; said combination of mutations: c.230A>G, c.1250C>T, c.307G>A, c.1748C>T, c.754G>A, c.581G>A, c.1551G>T, c.718C>T, c.679C>T, c.69delG, c.869+3A>T, c.1241-10C>T, c.1423-22C>T, c.1619G>A, c.1834C>T, c.395C>T, c.940G>T, g.4378G>A, g.4780G>A, c.750+144C>G, c.354+1G>A, c.152G>A, c.548_549del, c.655A>G, c.919T>G, c.1135dup, c.1147C>A, c.1187T>A, c.1433G>A, c.1499T>G, c.1555G>A, c.1618C>T; a heterozygous, homozygous, compound heterozygous inactivating mutation of at least one of the above, and the maximum allele frequency MAF < 1%; diagnosed as GCKR mutant diabetes.

[0011] (Variation nomenclature follows HGVS Recommendations for the Description of Sequence Variants: 2016 Update; cDNA reference sequence: NM_001486.4, gDNA reference sequence: NG_028024.1.)

[0012] Further, a patient with diabetes who does not carry any of the above heterozygous, homozygous, compound heterozygous inactivating mutations, but carries a single nucleotide polymorphism of the GCKR gene with MAF > 5%, including at least one of rs1260326 (c.1337T>C) and rs780094 (g.26532T>C) (both sites are T to C is the disease) is a patient with diabetes carrying the GCKR polymorphism site.

[0013] The diagnostic kit for diabetes caused by mutations in the GCKR gene comprises the detection reagent for the mutations or polymorphisms described above.

[0014] The fifth object of the present application is to provide a combination of indicators for diagnosing GCKR mutant diabetes in patients with diabetes, comprising: obesity, blood lipid disorder, hyperuricemia, proteinuria and fatty liver.

[0015] Further, according to the GCKR score formula:

[0016] GCKR score = P(obesity) x 7.3 + P(dyslipidemia) x 7.91 + P(high uric acid) x 3.59 + P(proteinuria) x 2.67 + P(fatty liver) x 4.44; wherein the P value is the frequency of occurrence of each complication index of the diabetic patient, 1 for containing the complication index, and 0 for not containing the complication; when the score is greater than 14.69 points, it is diagnosed as GCKR gene mutation type diabetes.

[0017] In the present application, the obesity or overweight of Chinese adults is defined as the BMI greater than or equal to 24 Kg / m 2 The dyslipidemia is defined according to the standard of Chinese Adult Dyslipidemia Prevention and Treatment Guidelines (2016 revised edition), the hyperuricemia is defined according to the Chinese Hyperuricemia and Gout Diagnosis and Treatment Guidelines (2019), the proteinuria is defined according to the standard of urinary microalbumin / urinary creatinine ratio greater than or equal to 30 mg / g and urine routine urine protein positive, and the fatty liver is defined according to the imageological means of abdominal color Doppler ultrasound, CT and MRI indicating fatty deposition or fatty liver, or the pathological result of liver puncture indicating fatty liver.

[0018] The sixth object of the present application is to provide a GCKR gene mutation type diabetes diagnosis kit for diabetic patients, which comprises reagents for detecting the diabetes complication indexes of diabetic patients, including obesity, dyslipidemia, high uric acid, proteinuria and fatty liver.

[0019] Based on the Chinese genetic endocrine metabolic disease cohort constructed by the inventors in the early stage, a never-verified gene mutation site that can cause a type 2 diabetes phenotype is determined by a whole exon sequencing combined with candidate gene mutation verification method: GCKR gene c.718C>T, c.1551G>T mutation, the wild type cDNA of the GCKR gene is shown in SEQ ID NO. 1. Further, a cDNA fluorescent plasmid and a FLAG tag plasmid carrying the GCKR gene cDNA and the c.718C>T, c.1551G>T mutation are constructed, which are transfected into target cells, and the subcellular localization of the mutated GCKR protein, the GCK-GCKR binding capacity and the GCK activity are detected, further confirming that the GCKR gene c.718C>T, c.1551G>T mutation is an inactivation mutation, and can cause a type 2 diabetes phenotype in clinic.

[0020] The present application adopts CRISP-Cas9 technology to construct GCKR c.718C>T mutant mice, which are fed in SPF level environment, and it is found that the GCKR c.718C>T mutant mice have higher glycosylated hemoglobin, lower glucose tolerance, lower insulin sensitivity, obesity, higher blood lipids and higher uric acid compared with wild type littermates, which is consistent with the clinical phenotype, thereby further confirming that the GCKR mutation can cause the generation of the above-mentioned diabetes-related phenotypes.

[0021] The present application further constructs a GCKR gene inactivation mutation detection kit. The present application adopts a MassARRAY method, i.e., a matrix assisted laser desorption / ionization time of flight mass spectrometry (MALDI-TOF-MS). The kit contains reagents suitable for detecting GCKR gene mutants, primers, subsequent analysis procedures, and is applied to detecting and classifying all patients clinically diagnosed as having diabetes, and the accuracy of the kit is verified by a receiver operating characteristic curve.

[0022] The present application further performs high-throughput sequencing on new diabetes patients, finds that a variety of missense mutations and large fragment deletion caused gene function loss mutations can all lead to monogenic diabetes of type 2 diabetes phenotype. The information of GCKR mutation cases reported at present is collected, the phenotype characteristics of new diabetes caused by GCKR gene mutation are further extracted, the clinical characteristics are weighted according to the frequency of the clinical characteristics, the clinical characteristics are scored, a diagnostic scoring model for diagnosing new diabetes caused by GCKR gene mutation, i.e., a GCKR score, is constructed, and a receiver operating characteristic curve verification is performed to obtain an effective GCKR score diagnostic model. The undiscovered GCKR inactivation variations are also included in the protection scope of the present application.

[0023] The diabetes precise typing diagnostic system constructed by the present application contains the following contents: DNA samples of diabetes patients are detected by using a new diabetes typing diagnostic kit based on GCKR gene mutation, variation information is obtained, the patients are scored and retyped for precise diabetes diagnosis in combination with the clinical phenotypes of the patients. According to the precise typing of diabetes, the patients are treated, complications are monitored and prevented, and hierarchical guidance for eugenics is provided.

[0024] The present application is directed to a first type of diabetes typing based on GCKR gene mutation, i.e., carrying GCKR gene inactivation mutation, and constructs a diagnostic model based on clinical phenotypes, so as to provide theoretical and technical support for early precise diagnosis and typing of severe diabetes with complications. BRIEF DESCRIPTION OF DRAWINGS

[0025] The present application will be further described below in combination with the drawings and examples, in which:

[0026] Figure 1 The collected family map of two cases of autosomal dominant hereditary diabetes;

[0027] (A) Family 1, carrying GCKR c.718C>T p.Gln240* mutation; (B) Family 2, carrying GCKR c.1551G>T p.Trp517Cys mutation; square represents male, circle represents female, filled represents disease, arrow represents proband, slash represents death.

[0028] Figure 2 Peak map for GCKR gene sequencing of two families;

[0029] (A) Family 1, proband II-4 carrying GCKR c.718C>T p.Gln240* mutation, proband III-3’s son not carrying this mutation;

[0030] (B) Family 2, proband III-4 carrying GCKR c.1551G>T p.Trp517Cys mutation, proband III-5’s sister not carrying this mutation.

[0031] Figure 3 Vector structure map with fluorescent GFP sequence and GCKR sequence;

[0032] Red box represents GCKR cDNA insertion site XhoI / KpnI.

[0033] Figure 4 GCK enzyme activity detection suggests that GCKR p.Gln240* and p.Trp517Cys cause GCK activity to decrease.

[0034] (A) GCKR wild type mutant vector and GCK fluorescent vector localization in cells, red fluorescence is GCK, green fluorescence is GCKR wild or mutant protein; (B) GCK activity detection after plasmid transfection of HepG2 cells, ***p<0.001.

[0035] Figure 5 GCKR-GLN240* heterozygous mutant mice are consistent with the phenotype of patients carrying GCKR gene c.718C>T heterozygous mutation in clinic; (A) wild type mice (left) and heterozygous mice (right) appearance map; (B) HbA1c levels of wild type mice (WT) and heterozygous mice (Het); (C-D) IPGTT and ITT of wild type mice and heterozygous mice; (E-F) serum uric acid and triglyceride levels of wild type mice and heterozygous mice; *p<0.05.

[0036] Figure 6 Receiver operating characteristic curve analysis results of GCKR gene diabetes detection kit detection accuracy in 49 subjects; the gold standard is first generation sequencing.

[0037] Figure 7Results of a receiver operating characteristic analysis for 17 individuals carrying a GCKR mutation and 33 individuals not carrying a GCKR mutation. DETAILED DESCRIPTION

[0038] The embodiments of the present application will be described in detail below with specific embodiments, examples of which are shown in the accompanying drawings, the embodiments described below by referring to the drawings are exemplary and are intended to explain the present application, and cannot be understood as a limitation of the present application. All other embodiments obtained by other persons in the art without making creative efforts are within the scope of protection of the present application.

[0039] The present application provides a new type of diabetes mutant caused by GCKR gene inactivation mutation, a mutant mouse model, a mutation detection kit and a diagnosis system of diabetes caused by GCKR mutation, so as to realize precise diagnosis and prognosis prediction of diabetes.

[0040] 1. A new type of diabetes caused by GCKR gene mutation

[0041] The inventors collected two autosomal dominant hereditary diabetes pedigrees, Figure 1 The pedigree of the above family is shown, and represents a normal female; represents a normal male; represents a female patient; represents a male patient; and the arrow indicates the proband. Both probands are clinically diagnosed as type 2 diabetes. The inventors collected peripheral whole blood of the diabetes patients and non-diabetes patients of the two families for the next step of gene detection, and the specific process is as follows:

[0042] (1) Fragmentation of genomic DNA sample

[0043] The undegraded genomic DNA sample that passed the detection was randomly broken by a high-focusing ultrasonic disrupter (Covaris) to form fragments with a length of about 180-280 bp.

[0044] (2) Paired-end linker ligation reaction

[0045] The linker was added in a ratio of 1:10 of the molecular weight of the genomic DNA and the linker, and T4 DNA ligase was used to connect the Illumina or other company sequencing adapter to both ends of the library DNA.

[0046] (3) Genomic DNA fragment amplification library construction and hybridization reaction

[0047] DNA library construction of the ligated adaptor genomic DNA was performed using ligation-mediated PCR (LM-PCR). The qualified samples were hybridized and amplified with SureSelect Target Enrichment System (Agilent Technologies, Inc., Santa Clara, CA, USA) kit.

[0048] (4) High-throughput sequencing and bioinformatics analysis of sequencing results

[0049] The captured DNA library was sequenced using Illumina Hiseq X Ten sequencing platform (Illumina, San Diego, CA). The obtained sequencing results were converted into base read information using Illumina base calling software, and the obtained sequence length was about 150 bp of pair-end reads. After sequencing, the original sequence was analyzed, and through the evaluation of data quality, it was determined whether it met the standard. If it met the standard, the sample was subjected to variation detection, including SNP, InDel, CNV, and annotation. If it did not meet the standard, it needed to be measured or re-constructed according to the actual situation.

[0050] (5) Data statistics and analysis

[0051] The original image data file obtained by the original sequencing data through the Illumina sequencing platform was converted into the original sequencing sequence (Sequenced Reads) through base calling analysis, that is, Raw Data. Using SOAPaligner alignment software, reads were aligned with the reference genome, and information such as total base amount, read number and read length, coverage and sequencing depth was counted to determine the effectiveness of the data.

[0052] (6) Variation screening of sequencing results

[0053] According to the specific filtering criteria, the main contents include: removing low-quality sequencing results and continuous low-quality fragments, and removing adapter sequences; according to the genetic mode, the mutations are divided into four types of recessive, dominant, X-linked and Y-linked mutations, and according to the family situation, the mutations in one type are preferentially screened; remove polymorphism and synonymous mutations, and leave relatively rare non-synonymous mutations, splice site mutations and indels (insertion and deletion) and the like; detect the record and allele frequency (allele frequency) frequency of the mutation in the 1000GenomesProjects and dbSNP database; use bioinformatics websites such as SIFT, MutationTaster and PolyPhen-2 to predict the pathogenicity of the mutation; according to the patient's clinical symptoms and related gene functions, the suspicious mutations are screened out for mutation verification and family analysis; and according to the American College of Medical Genetics and Genomics (ACMG) guidelines to evaluate the pathogenicity level of the variation.

[0054] (7) First-generation sequencing verification

[0055] PCR-Sanger sequencing was used to verify the mutation and family analysis of the proband and parents. According to the human GCKR gene sequence (NG_028024.1) in GenBank, primers were designed for the 9th and 17th exons of GCKR gene and their flanking sequences using Premier 5.0 software as follows:

[0056] GCKR-9F: 5'-GGGACACAGTGCCTCTAAAAGT-3', see SEQ ID NO. 4;

[0057] GCKR-9R: 5'-TTTGAGAGAGAGGGTTGGAATGA-3', see SEQ ID NO. 5;

[0058] GCKR-17F: 5'-TAAACGCTGGGCTGCTCAAA-3', see SEQ ID NO. 6;

[0059] GCKR-17R: 5'-TAAGCATTGAGGCCAGGTCC-3', see SEQ ID NO. 7;

[0060] The specificity of the primers was analyzed using Primer_BLAST software of NCBI.

[0061] PCR reaction system:

[0062]

[0063] PCR reaction conditions: 95℃ pre-denaturation 90s; 94℃ denaturation 40s, 57-60℃ annealing 40s, 72℃ extension 40s, a total of 35 cycles; 72℃ extension 5min. 2μL PCR product was subjected to 20g / L agarose gel electrophoresis, and after determining the product size, bidirectional sequencing analysis was performed using an ABI377 DNA sequencer. The sequencing results were analyzed by BLAST analysis with reference to the normal sequence. The specific sequencing peak chart is shown in Figure 2 .

[0064] (8) Family segregation analysis

[0065] The present application is evaluated according to the ACMG recommended autosomal dominant inheritance mode Z value (also known as Likeliihood ratio). The specific formula is:

[0066]

[0067] The two families carrying GCKR gene c.718C>T, c.1551G>T mutations were subjected to family segregation analysis, Z(family 1) = 1.5, Z(family 2) = 0.6, i.e. the two mutations of GCKR gene and the diabetes phenotype exist in segregation.

[0068] According to the above process, the typing diagnosis of diabetes patients can be realized in the clinic. Steps 2 and 3 below are only verification work before the preparation of the kit, and are not necessary steps for clinical detection.

[0069] 2. Construction and function verification of GCKR gene mutant

[0070] (1) Construction of GCKR construct with fluorescent GFP sequence: Commercial GV230 vector (purchased from Shanghai Jikai) was used. The specific structure is shown in Figure 3 The upstream primer with XhoI enzyme site and the downstream primer with KpnI enzyme site were designed for amplification of the upstream and downstream of the full-length open reading frame of GCKR gene. The primers contain the 5' end partial sequence of the target gene for PCR fishing of the target gene. The following PCR reaction system was prepared: one cycle of 98℃ for 5min, 30 cycles of 98℃ for 10s, 55℃ for 10s, 72℃ for 90s, and one cycle of 72℃ for 8min. The amplification was performed in a PCR instrument:

[0071]

[0072] The amplification primer sequences are as follows: GCKR (cDNA sequence is shown in SEQ ID NO. 1)

[0073] Upstream primer: TACCGGACTCAGATCTCGAGCGCCACCATGCCAGGCACAAAACGGTTTCAAC, see SEQ ID NO. 8;

[0074] Downstream primer: GATCCCGGGCCCGCGGTACCGTCTGAACGTCAGGCTCTAGGATCTC, see SEQ ID NO. 9;

[0075] GCKR c.718C>T (SEQ ID NO. 2)

[0076] Upstream primer:

[0077] TACCGGACTCAGATCTCGAGCGCCACCATGCCAGGCACAAAACGGTTTCAAC, see SEQ ID NO. 10;

[0078] Downstream primer:

[0079] GATCCCGGGCCCGCGGTACCGTTTTCTCCTGCATTTTCTGCATCC, SEQ ID NO. 11;

[0080] GCKR c.1551G>T (SEQ ID NO. 3)

[0081] Upstream primer:

[0082] TACCGGACTCAGATCTCGAGCGCCACCATGCCAGGCACAAAACGGTTTCAAC, see SEQ ID NO. 12;

[0083] Downstream primer: GATCCCGGGCCCGCGGTACCGTCTGAACGTCAGGCTCTAGGATCTC, see SEQ ID NO. 13.

[0084] The vector digestion system was prepared and reacted at 37°C for 3h or overnight. The vector digestion products were subjected to agarose gel electrophoresis, and the target band was recovered. The above PCR products were respectively connected with the recovered band using a ligase, and the connection products were transformed into DH5a competent cells, inoculated into kanamycin-resistant LB culture medium agar plates, and cultured at 37°C overnight. Single colonies were selected for Sanger sequencing to identify the sequence of the GFP tag construct containing the target band (GFP-GCKR-WT, i.e., wild-type plasmid without carrying mutations, Gln240* in GFP-GCKR-Gln240* represents carrying c.718C>T, Trp517Cys in GFP-GCKR-Trp517Cys carries c.1551G>T).

[0085] ②GCKR construct transfection of HEK293T cells

[0086] HEK293T cells were subcultured to 65-70%, and complete medium was replaced with Opti-MEM. A mixture of plasmid and P300 (1 μg plasmid added to P300 2 μL) was prepared with Opti-MEM (Thermo), and B solution was prepared with Lipo3000 (Thermo) diluent (equivalent to A solution). B solution was added to A solution, mixed thoroughly by blowing, and incubated at room temperature for 20-30 min. The mixture was added to the culture dish, gently shaken, and incubated at 37°C in a 5% CO2 incubator. After 6 hours, the complete medium was replaced. After 48 hours, low-sugar DMEM medium (5 mmol / L) and high-sugar DMEM medium (25 mmol / L) were replaced, and the fluorescence distribution and changes after 2 hours and 8 hours of intervention were observed under a fluorescence inverted microscope.

[0087] ③GCKR transfection of human hepatoma cell lines and detection of GCK activity

[0088] HepG2 cells were subcultured to 70%, and Opti-MEM was replaced. Plasmid and transfection reagent polyfect (MCE) were prepared with Opti-MEM, mixed thoroughly by blowing, and incubated at room temperature for 20-30 min. The mixture was added to the culture dish, gently shaken, and incubated at 37°C in a 5% CO2 incubator. After 6 hours, the complete medium was replaced. After 48 hours, the transfection efficiency and conditions were observed under a fluorescence inverted microscope, and the cells were collected. After ultrasonic lysis of the cells, glucose-6-phosphate dehydrogenase coupling method was used to detect NADPH absorbance at 340 nm, and the activity of GCK was calculated based on the number of cells, to determine the changes in GCK activity after GCKR mutation.

[0089] The above experimental results confirm that HEK293T cells transfected with GFP-GCKR-WT have green fluorescence mainly distributed in the nucleus, while cells transfected with GFP-GCKR-Gln240* have fluorescence showing that GCKR GLN240* has lost the ability to localize in the nucleus, and cells transfected with GFP-GCKR-Trp517Cys have fluorescence showing that GCKR Trp517Cys has nuclear localization. GCK enzyme activity detection suggests that GCKR Gln240* and Trp517Cys lead to a decrease in GCK activity, and the specific results are shown in Figure 4 , which suggests that GCKR gene c.718C>T, c.1551G>T mutations are inactivating mutations.

[0090] 3. Construction and verification of GCKR mutant mouse model

[0091] Based on the results of the first and second parts, a mouse animal model was constructed with a nonsense mutation as the target. The specific process is as follows:

[0092] C57BL6J strain mice were constructed by CRISPR / Cas9 genome engineering technology, GLN240* (CAG-TAG) mutation site in the donor oligomer was introduced into mouse zygote by homologous directed repair for site-directed mutagenesis. After the F0 generation mice grew up, the tissues were taken for PCR amplification and sequencing to further determine the point mutation successful mice, and the wild type mice were mated to obtain F1 generation mice. After quarantine, GCKR GLN240* mutant mice were bred in the SPF environment barrier of the Department of Zoology of Central South University, the breeding temperature was 25°C, the breeding humidity was 50%-55%, the 12-hour light: 12-hour dark cycle, the hybrid male: hybrid female = 1:1 or 1:2 mating, after a large number of breeding, wild type and hybrid mice in the same litter were obtained for verification. Mice were grown to 16 weeks old, urine was collected by metabolic cages, mice were anesthetized with isoflurane, blood was taken by removing the eyeball, and the serum was collected after centrifugation at room temperature for 1 hour. The blood glucose, triglyceride (TG), total cholesterol (TC), low-density lipoprotein cholesterol (LDL-C), high-density lipoprotein cholesterol (HDL-C), free fatty acid (NEFA), and uric acid (UA) of mice were detected by using the automatic biochemical analyzer.

[0093] The results showed that: compared with the littermate wild type mice, GCKR p.Gln240* heterozygous mutant mice grew faster and were larger in size. The glycosylated hemoglobin of 16-week-old mice also showed that the heterozygotes were higher than the wild type mice. In addition, the results of glucose tolerance test and insulin tolerance test also suggested that the glucose tolerance of heterozygous mice was impaired, and the insulin resistance was impaired. The serum biochemical results showed that the heterozygous mice had dyslipidemia and elevated uric acid. The phenotype was consistent with that of patients carrying GCKR gene c.718C>T heterozygous mutation in clinic. The specific results are shown in Figure 5 .

[0094] 4. Construction of GCKR gene mutation diagnostic kit

[0095] The application adopts MassARRAY method, i.e. matrix assisted laser desorption / ionization time of flight mass spectrometry (MALDI-TOF-MS) to detect 32 sites, including pathogenic mutation sites (12 sites) of GCKR gene found by previous clinical cohort study of the research center, mutation sites (18 sites) of GCKR gene which can cause disease phenotype reported at present, and single nucleotide polymorphism sites (2 sites) of GCKR gene multi-gene synergistic mode. The application has the same protective effect on other sites to be found of diabetes, obesity, blood lipid disorder, hyperuricemia, fatty liver and other phenotypes caused by GCKR gene mutation. The specific steps are as follows:

[0096] (1) First, design primers for the following mutation sites, but not limited to: GCKR c.230A>G, c.1250C>T, c.307G>A, c.1748C>T, c.754G>A, c.581G>A, c.1551G>T, c.718C>T, c.679C>T, c.69delG, c.869+3A>T, c.1241-10C>T, c.1423-22C>T, c.1619G>A, c.1834C>T, c.395C>T, c.940G>T, g.4378G>A, g.4780G>A, c.750+144C>G, c.354+1G>A, c.152G>A, c.548_549del, c.655A>G, c.919T>G, c.1135dup, c.1147C>A, c.1187T>A, c.1433G>A, c.1499T>G, c.1555G>A, c.1618C>T; The specific design principle is: design mutation point primers for alleles, the 5' end of the primer is provided with 10mer tag (ACGTTGGATG, see SEQ ID NO. 14), finally making the PCR amplification product greater than 30 bp.

[0097] gDNA sample was diluted to 10 ng / μL, and reaction reagents were prepared: 100 mM dNTPs, 25 mM MgCl2, ultrapure water, 1 μM final concentration of primer 1 of step (1), 5 U / μL of HotStarTaq Plus DNA polymerase, 10×PCR buffer, 384-well plate. The above reagents were added to the 384-well plate respectively, mixed, sealed, centrifuged at room temperature for 1 min at 425 g. PCR amplification was performed according to the following conditions: one cycle of 94℃ for 2 min, 45 cycles of 94℃ for 20 s, 56℃ for 30 s, 72℃ for 60 s, one cycle of 72℃ for 3 min, and finally cooled to 4℃.

[0098] (3) Shrimp alkaline phosphatase (SAP) removal

[0099] Unreacted dNTPs were removed using SAP, and excess enzyme, buffer, mg 2+ and reagents were removed. 1×SAP buffer and 1.7 U / μL of SAP were added, mixed, incubated at 37℃ for 40 min, incubated at 85℃ for 5 min, and finally cooled to 4℃.

[0100] (4) Primer single base extension or iPLEX reaction

[0101] For each target, a single base extension primer was designed next to the mutation site, iPLEX enzyme and extension buffer were used, primer was added at a final concentration of 10 μM, and the first round of PCR product was used as a template. Extension was performed according to the following conditions: one cycle of 94℃ for 30 s, 45 cycles of 94℃ for 5 s, 52℃ for 5 s, 80℃ for 5 s, one cycle of 72℃ for 3 min, and finally cooled to 4℃. The final product was terminated after the extension primer was extended by one base at the mutation site.

[0102] (5) Resin purification and mass spectrometry analysis

[0103] SpectroCLEAN grade resin was diluted with ultrapure water, plated after making a resin suspension, and the second round of PCR product was mixed with the resin. Ion exchange was used to remove ions adsorbed on the DNA fragments in the liquid, and mass spectrometry analysis was performed on the system to obtain peak patterns, thereby further analyzing the allele mutation of the specific mutation site, and obtaining the mutation site.

[0104] (6) The kit can also use second-generation and above sequencing methods to detect mutations of GCKR that have not been found or reported, and further analyze using the process in step 2, and include in the system of the present application.

[0105] 5. The diabetes precision typing kit based on GCKR mutation is used for diagnosing diabetes patients

[0106] 48 cases of diabetes patients diagnosed according to the 1999 WHO guidelines, the genotype of GCKR is determined by first-generation sequencing, and the GCKR gene mutation detection kit constructed in the above step is used to detect 32 sites of all subjects, wherein the results of all subjects detected by the kit are consistent with the results of first-generation sequencing, and the first-generation sequencing is used as the gold standard for genetic diagnosis, and the accuracy of the kit diagnosis is analyzed, and the results are shown in Figure 6 The area under the curve is 1.000, and the p value is 0.00001, and the accuracy reaches 100%.

[0107] According to the above sequencing results, the diabetes patients are divided into the following three categories:

[0108] ① Carrying GCKR gene heterozygous, homozygous, compound heterozygous inactivation mutation, and the maximum allele frequency (MAF) <1%. Including but not limited to GCKR c.230A>G, c.1250C>T, c.307G>A, c.1748C>T, c.754G>A, c.581G>A, c.1551G>T, c.718C>T, c.679C>T, c.69delG, c.869+3A>T, c.1241-10C>T, c.1423-22C>T, c.1619G>A, c.1834C>T, c.395C>T, c.940G>T, g.4378G>A, g.4780G>A, c.750+144C>G, c.354+1G>A, c.152G>A, c.548_549del, c.655A>G, c.919T>G, c.1135dup, c.1147C>A, c.1187T>A, c.1433G>A, c.1499T>G, c.1555G>A, c.1618C>T; Carriers of at least one of the above mutations are diagnosed as GCKR mutant diabetes.

[0109] ② Not carrying the variation shown in ① above, but carrying GCKR gene MAF>5% single nucleotide polymorphism, including rs1260326(c.1337T>C), rs780094(g.26532T>C) (both sites are T to C) at least one of the diabetes patients is a diabetes patient carrying GCKR polymorphic site. Show the effect of multiple gene influence.

[0110] ③ Diabetes patients who do not carry GCKR gene variations in ① and ② above, i.e. do not carry.

[0111] The first type presents a single gene diabetes phenotype, often combined with obesity, blood lipid disorders, hyperuricemia, fatty liver, and is prone to early onset diabetic nephropathy and uremia. Therefore, for the first type of patients, clinical guidance is provided based on the above phenotypes: regular monitoring of urine protein, liver and kidney function, and abdominal ultrasound is recommended, and strict control of diet and blood sugar is recommended. The threshold for screening for diabetic nephropathy is advanced, and if proteinuria occurs, early kidney function protection and urine protein reduction therapy is recommended. For fertility, prenatal diagnosis can be actively performed, and specific detection of GCKR gene mutations can be performed to prevent diabetes in offspring.

[0112] The second type is associated with blood lipid disorders, fatty liver, and elevated uric acid phenotypes confirmed by genome-wide association studies. Considering the high frequency of the second type of variation and linkage disequilibrium, it is recommended that patients carrying both mutations or one of the second type mutations undergo strict lifestyle interventions, including balanced diet, weight control, reducing high-sugar and high-fat diet, reasonable exercise, and regular treatment of diabetes.

[0113] The third type does not carry GCKR gene-related variations, and the incidence of diabetic nephropathy, complications, and comorbidities in diabetic patients is not significantly different from other types of diabetes. It is recommended to follow the regular treatment of other types of diabetes and routine follow-up.

[0114] 6. Establishment and verification of GCKR mutation diabetes diagnosis model

[0115] Based on the first five aspects, the inventors found that patients with GCKR gene inactivation mutations (i.e., the first type of patients described above) have more severe phenotypes and are prone to complications of diabetic nephropathy. Therefore, early screening of diabetic patients who need genetic testing in clinical practice is of great significance for the prognosis and treatment of such patients. Therefore, a frequency-weighted method for diagnosing GCKR gene mutation diabetes, GCKR score, is established (the result obtained by this score is consistent with the mutation judgment result of the first type described above, and the score formula can be directly used to determine whether it belongs to the patient group carrying GCKR gene inactivation mutations). The specific example operation is as follows:

[0116] A total of 39 patients carrying GCKR gene mutations and proband family patients were screened from the early genetic glycolipid disease cohort. Literature reported 35 cases of GCKR gene inactivation mutations. Based on the presence or absence of seven symptoms such as hypertension, blood lipid disorders, ketosis, obesity or overweight, hyperuricemia, proteinuria, and fatty liver, frequency statistics were performed. Then, according to the frequency percentage divided by 10, weight assignment was performed (see Table 1), and the GCKR score formula was obtained:

[0117] GCKR score = P(obesity) x 7.3 + P(dyslipidemia) x 7.91 + P(high uric acid) x 3.59 + P(proteinuria) x 2.67 + P(fatty liver) x 4.44; wherein the P value is the frequency of occurrence of each complication index of the diabetic patient, 1 for containing the complication index, and 0 for not containing the complication; when the score is greater than 14.69 points, it is diagnosed as GCKR gene mutation type diabetes.

[0118] In the present application, Chinese adult obesity or overweight is defined as BMI greater than or equal to 24 Kg / m 2 , dyslipidemia is defined according to the Chinese Adult Dyslipidemia Prevention and Treatment Guidelines (2016 revised edition), hyperuricemia is defined according to the Chinese Hyperuricemia and Gout Diagnosis and Treatment Guidelines (2019), proteinuria is defined according to the urinary albumin / creatinine ratio greater than or equal to 30 mg / g and the urine routine urine protein positive standard, and fatty liver is defined according to the abdominal color Doppler ultrasound, CT, MRI imaging method indicating fat deposition or fatty liver, or the liver biopsy pathological result indicating fatty liver.

[0119] According to the formula, each patient clinically diagnosed as diabetes and having a family history is scored, and the inventors performed a receiver operating characteristic curve analysis in 20 cases carrying GCKR gene mutations and 33 cases not carrying GCKR gene mutations, and the results are shown in Figure 7 . It can be found that the area under the curve of the GCKR score receiver operating characteristic curve reaches 0.800, and the p value is 0.0003, which has strong diagnostic value. According to the Youden index analysis, the appropriate cut-off value is 14.69 points, that is, according to the cumulative score of the seven symptoms of GCKR score, when the score is greater than 14.69 points, the sensitivity is 75% (95% CI: 53.13%-88.81%), and the specificity is 84.9% (95% CI: 69.08%-93.35%).

[0120] Table 1 GCKR score

[0121]

[0122] SEQ ID NO. 1:

[0123]

[0124] SEQ ID NO. 2:

[0125]

[0126] SEQ ID NO. 3:

[0127]

Claims

1. Molecular markers of diabetes associated with GCKR gene mutations; including: c.718C>T mutation.

2. Application of reagents for detecting at least one of c.718C>T in the GCKR gene in the preparation of diagnostic agents for diabetes with GCKR gene inactivation mutations.

3. A diagnostic kit for diabetes caused by GCKR gene inactivation mutation, characterized in that, It contains reagents for detecting at least one of the c.718C>T mutations in the GCKR gene.

4. Application of reagents for detecting combined gene mutations in the preparation of diagnostic agents for diabetes based on GCKR gene mutations; wherein the combined gene mutations include c.718C>T mutation, and also include GCKR c.230A>G, c.1250C>T, c.307G>A, c.1748C>T, c.754G>A, c.581G>A, c.1551G>T, c.718C>T, c.679C>T, c.69delG, c.869+3A>T, c.1241-10C>T, c.1423-22C>T, c.1619G>A, c.1834C>T, c.395C> Individuals carrying at least one of the following mutations: T, c.940G>T, g.4378G>A, g.4780G>A, c.750+144C>G, c.354+1G>A, c.152G>A, c.548_549del, c.655A>G, c.919T>G, c.1135dup, c.1147C>A, c.1187T>A, c.1433G>A, c.1499T>G, c.1555G>A, or c.1618C>T; individuals carrying heterozygous, homozygous, or compound heterozygous inactivated mutations, with a maximum allele frequency (MAF) <1%; are diagnosed with GCKR-mutant diabetes mellitus.

5. The application according to claim 4, characterized in that, Individuals who do not carry any of the heterozygous, homozygous, or compound heterozygous inactivating mutations, but who carry a single nucleotide polymorphism (SNP) of >5% in the GCKR gene, including at least one of rs1260326 (c.1337T>C) or rs780094 (g.26532T>C), are considered to have diabetes carrying the GCKR polymorphism site.

6. A diagnostic kit for diabetes caused by GCKR gene mutation, characterized in that, The reagent includes a detection reagent for detecting the mutations or polymorphisms described in claim 4 or 5.

7. Application of a combined diagnostic reagent for diabetic complication indicators in the preparation of a diagnostic agent for GCKR gene-mutant diabetes in diabetic patients; the diabetic complication indicators include: Obesity, dyslipidemia, hyperuricemia, proteinuria, and fatty liver.

8. The application according to claim 7, characterized in that, Judged according to the GCKR scoring formula: GCKR score = P(obesity) × 7.3 + P(dyslipidemia) × 7.91 + P(hyperuricemia) × 3.59 + P(proteinuria) × 2.67 + P(fatty liver) × 4.44; where P is the frequency of occurrence of each diabetic patient's complication indicator, with 1 for the presence of this complication indicator and 0 for the absence of this complication indicator; when the score is greater than 14.69, the diagnosis is GCKR gene mutation type diabetes.

9. A diagnostic kit for GCKR gene mutation-type diabetes in diabetic patients, characterized in that, The reagents include indicators for detecting diabetic complications in diabetic patients, including obesity, dyslipidemia, hyperuricemia, proteinuria, and fatty liver.

Images