Genetically engineered saccharomycetes for producing salidroside as well as construction method and application of genetically engineered saccharomycetes

Abstract

The invention provides genetically engineered saccharomycetes for producing salidroside as well as a construction method and application of the genetically engineered saccharomycetes. According to the technical scheme, a series of exogenous genes are introduced into a yeast engineering strain through a gene recombination technology, meanwhile, a series of pichia pastoris endogenous glucosidase genes are knocked out, and the yeast engineering strain capable of producing salidroside is obtained. The engineered yeast has the advantages of clear metabolic background, strong heterologous expression ability and the like, and can realize low-cost fermentation by taking ethanol as a carbon source and combining with an inorganic salt culture medium. The fermentation period is short, the conversion rate of the intermediate tyrosol is high, no obvious accumulation exists, excellent industrial suitability is shown, and an efficient and economical new strategy is provided for large-scale production of salidroside.

Description

Technical Field

[0001] This invention belongs to the field of biotechnology, and more specifically, this invention relates to genetically engineered yeast strains for producing rhodioloside, their construction methods, and applications. Background Technology

[0002] Salidroside is the main active ingredient in plants of the Rhodiola genus. Due to its pharmacological activities such as anti-oxidation, anti-inflammation, anti-fatigue, anti-aging, and protection of the nervous and cardiovascular systems, it has broad application prospects and huge market value in the fields of medicine, food and health products, and cosmetics.

[0003] The production processes of rhodioloside can be divided into plant extraction, chemical synthesis, and bio-fermentation. Plant extraction is difficult to scale up due to the long growth cycle (5-7 years) of Rhodiola plants, scarcity of resources, low content of active ingredients (0.5-3% dry weight), and ecological damage caused by over-harvesting. Chemical synthesis requires multiple reactions and control of chiral centers, and suffers from problems such as the use of highly toxic reagents, environmental pollution, and high costs. Furthermore, the biocompatibility and purity of the product are insufficient, limiting the application of this method.

[0004] Natural microorganisms can synthesize trace amounts of rhodioloside or tyrosol, but the yield is extremely low and has no industrial value. Genetically engineered E. coli or yeast to produce rhodioloside has become a hot topic. By introducing key enzyme genes (such as tyrosine decarboxylase and UDP-glucosyltransferase) to build cell factories, rhodioloside can be synthesized de novo. However, problems such as low yield, high cost, accumulation of intermediate tyrosol, and long fermentation cycle still exist.

[0005] Therefore, there is an urgent need in this field to further study and develop novel chassis hosts and production processes for rhodioloside in order to achieve efficient synthesis and simplify operations and reduce costs in terms of process. Summary of the Invention

[0006] The purpose of this invention is to provide a genetically engineered yeast strain for producing rhodioloside, its construction method and application, in order to solve the problems of low synthesis efficiency, high cost, accumulation of intermediate tyrosol and long fermentation cycle of rhodioloside in the prior art.

[0007] In a first aspect of the invention, a method for producing (de novo) rhodioloside is provided, the method comprising: (1) providing a yeast strain transformed with an expression cassette of an exogenous group of enzymes: YNK1, URA6, KDC4, UPG1, PGM1, UGT33, ARO4, ARO7, XFPK, AAS; and the expression or activity of the following endogenous proteins being downregulated: EXG1, SPR1, YMR244W, or YESR; (2) culturing the yeast strain of (1) to produce rhodioloside.

[0008] In one or more embodiments, the downregulation is performed by methods including gene knockout / silencing and gene interference; preferably, the downregulation is performed by gene knockout / silencing through gene editing or homologous recombination; more preferably, the gene editing is performed by CRISPR / Cas9.

[0009] In one or more embodiments, YNK1, URA6, KDC4, UPG1, and PGM1 are derived from Pichia pastoris.

[0010] In one or more embodiments, the U8GT33 is derived from Rhodiola rosea.

[0011] In one or more embodiments, ARO4 and ARO7 are derived from Saccharomyces cerevisiae.

[0012] In one or more embodiments, the XFPK is derived from Bifidobacterium breve.

[0013] In one or more embodiments, the AAS is derived from parsley (Petroselinum crispum).

[0014] In one or more embodiments, the yeast engineered strain is transformed with expression cassettes containing the following appropriately tandem coding genes: UGT33+XFPK+AAS expression cassette, ARO4+ARO7+KDC4 expression cassette, and PGM1+YNK1+URA6+UPG1 expression cassette.

[0015] In one or more embodiments, when culturing the engineered yeast of (1), the engineered yeast is cultured using a yeast culture medium, and preferably a carbon source is added during the culture period; preferably, the carbon source is glucose and / or ethanol; preferably, the culture process is divided into a batch stage and a feeding stage, wherein the carbon source in the batch stage is glucose, and the feeding stage is glucose feeding (flow feeding) in the early stage and ethanol feeding in the middle and late stages.

[0016] In one or more embodiments, the culture is a shake flask culture (shake flask fermentation) or a fermenter culture (fermenter / bioreactor fermentation).

[0017] In one or more embodiments, the transformation / introduction is an exogenous transformation / introduction or a heterogeneous transformation / introduction.

[0018] In one or more embodiments, the enzyme comprises a heterologous enzyme relative to the engineered yeast.

[0019] In one or more embodiments, the engineered yeast is cultured using a yeast culture medium, preferably with the addition of a carbon source during the culture period; preferably, the carbon source is glucose and / or ethanol.

[0020] In one or more embodiments, glucose is added every 12 to 36 hours until a final concentration of 1 to 4% (v / v) is reached.

[0021] In one or more embodiments, during the cultivation process, the rotation speed is 1000±500 r / min; preferably 1000±300 r / min; more preferably 1000±100 r / min.

[0022] In one or more embodiments, glucose is used as the carbon source to promote cell growth during the initial stage of cultivation (initial fermentation). Glucose is continuously provided as feed until the cell mass grows to a wet weight of 200±50 g / L (preferably 200±35 g / L; more preferably 200±20 g / L). Then, the feed is switched to ethanol, and the feed rate is gradually increased from 2±1 ml / L / h (preferably 2±0.5 ml / L / h) to 12±4 ml / L / h (preferably 12±2 ml / L / h). Fermentation ends after 120±15 h (preferably 120±10 h or 120±5 h).

[0023] In one or more embodiments, the glucose flow rate during the feeding phase is gradually increased from 6±2 ml / L / h (preferably 6±1 ml / L / h) to 24±5 ml / L / h (preferably 24±3 ml / L / h), and fermentation ends after 120 h (preferably 120±10 h or 120±5 h).

[0024] In one or more embodiments, the dissolved oxygen during fermentation is maintained between 20% and 50%.

[0025] In one or more embodiments, the pH of the fermentation broth is maintained at 5.0-7.0 during fermentation.

[0026] In one or more embodiments, the yeast culture medium is YPD culture medium.

[0027] In one or more embodiments, reactor fermentation is based on BSM as the culture medium.

[0028] In one or more embodiments, the culture temperature is 30±2℃, more preferably 30±1℃.

[0029] In one or more embodiments, during large-scale fermentation, the stirring speed in the fermenter is 500-2000 r / min; preferably 800-1200 r / min.

[0030] In one or more embodiments, the culture time for producing rhodioloside is 60 to 160 hours, more preferably 80 to 120 hours, such as 100 or 110 hours.

[0031] In one or more embodiments, fermentation is completed after 96±40 hours, preferably 96±30 hours, 96±20 hours or 96±10 hours.

[0032] In another aspect of the invention, a yeast engineered strain for producing rhodioloside is provided, wherein the yeast engineered strain is transformed with an expression cassette of the following exogenous enzymes: YNK1, URA6, KDC4, UPG1, PGM1, UGT33, ARO4, ARO7, XFPK, AAS; and the expression or activity of the following endogenous proteins is downregulated: EXG1, SPR1, YMR244W, or YESR.

[0033] In one or more embodiments, the engineered yeast includes Pichia pastoris; preferably, the engineered yeast includes Pichia pastoris GS115.

[0034] In one or more embodiments, the gene encoding YNK1 has the nucleotide sequence shown in SEQ ID NO:7, or its degenerate sequence, or a nucleotide sequence encoding a functional protein that is 70% or more (preferably 80% or more; more preferably 90% or more; more preferably 93% or more; more preferably 95% or more; more preferably 97% or more) identical to the sequence in SEQ ID NO:7.

[0035] In one or more embodiments, the gene encoding URA6 has the nucleotide sequence shown in SEQ ID NO:8, or its degenerate sequence, or a nucleotide sequence encoding a functional protein that is 70% or more (preferably 80% or more; more preferably 90% or more; more preferably 93% or more; more preferably 95% or more; more preferably 97% or more) identical to the sequence in SEQ ID NO:8.

[0036] In one or more embodiments, the gene encoding KDC4 has the nucleotide sequence shown in SEQ ID NO:10, or its degenerate sequence, or a nucleotide sequence encoding a functional protein that is 70% or more (preferably 80% or more; more preferably 90% or more; more preferably 93% or more; more preferably 95% or more; more preferably 97% or more) identical to the sequence in SEQ ID NO:10.

[0037] In one or more embodiments, the gene encoding UPG1 has the nucleotide sequence shown in SEQ ID NO:9, or its degenerate sequence, or a nucleotide sequence encoding a functional protein that is 70% or more (preferably 80% or more; more preferably 90% or more; more preferably 93% or more; more preferably 95% or more; more preferably 97% or more) identical to the sequence in SEQ ID NO:9.

[0038] In one or more embodiments, the gene encoding PGM1 has the nucleotide sequence shown in SEQ ID NO:6, or its degenerate sequence, or a nucleotide sequence encoding a functional protein that is 70% or more (preferably 80% or more; more preferably 90% or more; more preferably 93% or more; more preferably 95% or more; more preferably 97% or more) identical to the sequence in SEQ ID NO:6.

[0039] In one or more embodiments, the gene encoding U8GT33 has the nucleotide sequence shown in SEQ ID NO:1, or its degenerate sequence, or a nucleotide sequence encoding a functional protein that is 70% or more (preferably 80% or more; more preferably 90% or more; more preferably 93% or more; more preferably 95% or more; more preferably 97% or more) identical to the sequence in SEQ ID NO:1.

[0040] In one or more embodiments, the ARO4 is a mutant with the K229L mutation; preferably, the gene encoding the mutant has the nucleotide sequence shown in SEQ ID NO:2, or its degenerate sequence, or a nucleotide sequence encoding a functional protein that has more than 70% (preferably more than 80%; more preferably more than 90%; more preferably more than 93%; more preferably more than 95%; more preferably more than 97%) identity with the sequence of SEQ ID NO:2.

[0041] In one or more embodiments, the ARO7 is a mutant with a G141S mutation; preferably, the gene encoding the mutant has the nucleotide sequence shown in SEQ ID NO:3, or its degenerate sequence, or a nucleotide sequence encoding a functional protein that has more than 70% (preferably more than 80%; more preferably more than 90%; more preferably more than 93%; more preferably more than 95%; more preferably more than 97%) identity with the sequence of SEQ ID NO:3.

[0042] In one or more embodiments, the XFPK has the nucleotide sequence shown in SEQ ID NO:4, or its degenerate sequence, or a nucleotide sequence encoding a functional protein that is 70% or more (preferably 80% or more; more preferably 90% or more; more preferably 93% or more; more preferably 95% or more; more preferably 97% or more) identical to the sequence in SEQ ID NO:4.

[0043] In one or more embodiments, the gene encoding AAS has the nucleotide sequence shown in SEQ ID NO:5, or its degenerate sequence, or a nucleotide sequence encoding a functional protein that is 70% or more (preferably 80% or more; more preferably 90% or more; more preferably 93% or more; more preferably 95% or more; more preferably 97% or more) identical to the sequence in SEQ ID NO:5.

[0044] In another aspect of the invention, the use of a gene combination is provided for conversion into engineered yeast strains to prepare rhodioloside compounds; said gene combination includes: genes encoding histone enzymes: YNK1, URA6, KDC4, UPG1, PGM1, UGT33, ARO4, ARO7, XFPK, AAS; and downregulators of histone proteins or their encoding genes: EXG1, SPR1, YMR244W, or YESR; preferably, said downregulator is a gene editing reagent or homologous recombination reagent, which performs gene knockout / silencing by gene editing or homologous recombination to achieve said downregulation; more preferably, said downregulator includes sgRNA.

[0045] In one or more embodiments, the gene combination is placed in one or more expression constructs. For example, expression cassettes of the following appropriately tandem enzymes are formed: UGT33+XFPK+AAS expression cassette, ARO4+ARO7+KDC4 expression cassette, and PGM1+YNK1+URA6+UPG1 expression cassette, said expression cassettes being placed in their respective constructs.

[0046] In another aspect of the invention, a kit for producing (de novo synthesis) rhodioloside is provided, comprising: genes encoding YNK1, URA6, KDC4, UPG1, PGM1, UGT33, ARO4, ARO7, XFPK, and AAS; an expression cassette containing said genes; an expression construct (including an expression plasmid); and a downregulator of the following histones or their encoding genes: EXG1, SPR1, YMR244W, or YESR; preferably, the downregulator is a gene editing reagent or a homologous recombination reagent, wherein the downregulation is performed by gene knockout / silencing through gene editing or homologous recombination; more preferably, the downregulator comprises sgRNA.

[0047] In another aspect of the invention, a kit for producing (de novo) rhodioloside is provided, comprising any of the engineered yeast strains described above.

[0048] The rhodioloside biosynthesis method proposed in this invention has a shorter fermentation cycle, higher production efficiency, no intermediate product residue, and lower cost compared with other biosynthesis methods, making it more suitable for large-scale industrial production.

[0049] Other aspects of the invention will be apparent to those skilled in the art from the disclosure herein. Attached Figure Description

[0050] Figure 1 A schematic diagram of the de novo biosynthesis pathway of rhodioloside in yeast designed in this invention.

[0051] Figure 2 1. Fermentation diagram of a 3L reactor for the strain that produces rhodioloside (using ethanol as the carbon source).

[0052] Figure 3 1. Fermentation diagram of a 3L reactor for the strain that produces rhodioloside (using glucose as the carbon source). Detailed Implementation

[0053] Through in-depth research, the inventors of this invention have introduced a series of exogenous genes into engineered yeast strains while simultaneously knocking out a series of other genes using gene recombination technology, resulting in engineered yeast strains capable of producing rhodioloside. These engineered yeast strains possess advantages such as a clear metabolic background and strong heterologous expression ability, enabling low-cost fermentation using ethanol as a carbon source in conjunction with inorganic salt culture media. Furthermore, they exhibit a short fermentation cycle, high conversion rate of the intermediate tyrosol, and no significant accumulation, demonstrating excellent industrial adaptability and providing a new, efficient, and economical strategy for the large-scale production of rhodioloside.

[0054] the term

[0055] As used in this invention, the term "expression cassette" or "gene expression cassette" refers to a gene expression system containing all the necessary elements required to express a target polypeptide, typically including the following elements: a promoter, a gene sequence encoding the polypeptide, and a terminator; additionally, it may optionally include a signal peptide encoding sequence, etc.; these elements are operatively linked.

[0056] As used in this invention, "exogenous" or "heterogeneous" refers to the relationship between two or more nucleic acid or protein sequences from different sources, or the relationship between a protein (or nucleic acid) from different sources and a host cell. For example, if the combination of nucleic acid and host cell is not normally naturally occurring, then the nucleic acid is exogenous to that host cell. A particular sequence is "exogenous" to the cell or organism into which it is inserted.

[0057] As used in this invention, "operably linked" or "operationally linked" refers to a functional spatial arrangement of two or more nucleic acid regions or nucleic acid sequences. For example, a promoter region is placed at a specific position relative to the nucleic acid sequence of the target gene, such that transcription of the nucleic acid sequence is guided by the promoter region, thereby the promoter region is "operably linked" to the nucleic acid sequence.

[0058] As used in this invention, the term "expression construct" or "expression building block" refers to a recombinant DNA molecule containing a desired nucleic acid coding sequence, which may contain one or more gene expression cassettes. The "construct" is typically contained within an expression vector.

[0059] Production System Overview

[0060] Although research has been conducted in this field on the synthesis of rhodioloside in prokaryotic hosts (such as *E. coli*) (reaching a maximum yield of 9.34 g / L), the production process generally requires the exogenous addition of tyrosine precursors, leading to a significant increase in cost. In engineered bacteria that synthesize tyrosine de novo, the heterologous expression activity of the key rate-limiting enzyme (TyrDC / UGT) is insufficient, requiring multiple rounds of codon optimization and gene copy number enhancement. Competitive pathways (such as phenylalanine / tryptophan branching) also require multiple gene knockouts (such as ΔfeaB / ΔpheA) to direct carbon flow, making engineering difficult. To improve tyrosol supply, some studies have attempted to construct *E. coli*-yeast co-culture systems, but this dual-strain coupling process is cumbersome, and the hydroxytyrosol conversion efficiency is unstable, with an actual yield of only 0.44 g / L.

[0061] For eukaryotic hosts, *Saccharomyces cerevisiae* possesses the ability to synthesize tyrosol naturally, but the wild-type yield is extremely low (27 mg / L). Through rational modification (including removing feedback inhibition, balancing the supply of precursors E4P / PEP, and knocking out competing genes PDC1 / PHA2), the yield was significantly increased to 26.55 g / L. However, this requires batch-wise addition of yeast extract and a long fermentation cycle (168 hours), and the inhibitory effect of intracellular tyrosol accumulation on growth has not been fundamentally resolved. Product accumulation exceeding 5 g / L induces cytotoxicity, and even with metabolic engineering, production efficiency remains difficult to improve. While *Pichia pastoris* is widely used for protein expression, there are currently no successful cases of its efficient synthesis of rhodioloside in this field.

[0062] This invention provides a genetically engineered yeast strain for producing rhodioloside. By heterologously expressing the following enzymes in the engineered yeast strain: glycosyltransferase (UGT), feedback-insensitive DAHP synthase (ARO4), feedback-insensitive shikimate mutase (ARO7), phosphatosterolase (XFPK), aromatic aldehyde synthase (AAS), decarboxylase (KDC4), phosphogluconomutase (PGM1), UMP-CMP kinase (URA6), nucleoside diphosphate kinase (YNK1), UDP-glucose pyrophosphorylase (UPG1), and knockout glycosyl hydrolases (EXG1, SPR1, YMR244W, YESR), de novo synthesis of rhodioloside in yeast cells was achieved. A schematic diagram of the synthetic pathway of the product of this invention is shown below. Figure 1 .

[0063] The recombinant yeast engineered strain constructed in this invention has good compatibility with the plant enzymes / microbial enzymes preferred in this invention. Compared with prokaryotic Escherichia coli, it has unique advantages in heterologous expression, achieving good expression and catalytic activity without modification of the enzyme structure, and efficiently producing rhodioloside.

[0064] Genes and their expression systems

[0065] In this invention, the efficient production of rhodioloside in engineered yeast is achieved by transforming a combination of 10 genes (YNK1, URA6, KDC4, UPG1, PGM1, UGT33, ARO4, ARO7, XFPK, AAS) and knocking out the EXG1, SPR1, YMR244W, and YESR genes in engineered yeast. The inventors have successfully achieved the co-expression of these heterologous genes in yeast cells and the high-activity production of the compound.

[0066] The genes described in this invention can be naturally occurring, such as those that can be isolated or purified from autotrophic plants or microorganisms. Alternatively, the genes can be artificially prepared, for example, obtained using conventional genetic engineering recombination techniques or through artificial synthesis.

[0067] The nucleotide sequences of the aforementioned genes may be identical to those shown in SEQ ID NO:1-10, or they may be degenerate variants of these sequences. As used in this invention, a "degenerate variant" refers to a nucleic acid sequence encoding a protein with the same function but differing from the sequences selected from SEQ ID NO:1-10. This invention includes both the natural sequences of the aforementioned genes and sequences after codon optimization. In this invention, recombinant expression of the natural gene sequences is currently used. It is anticipated that further optimization using codon optimization methods known in the art, and the establishment of optimized yeast engineered strains, can further increase yield. These further optimization techniques based on the scheme of this invention should also be included in the technical solution of this invention.

[0068] The gene may include: a coding sequence that encodes only the mature polypeptide; a coding sequence of the mature polypeptide and various additional coding sequences; a coding sequence of the mature polypeptide (and optional additional coding sequences) and a non-coding sequence.

[0069] The present invention also relates to variants of the aforementioned gene that encode a polypeptide that differs from its corresponding wild-type polypeptide in amino acid sequence, and is a fragment, analogue, or derivative of the wild-type polypeptide. This polynucleotide variant can be a naturally occurring allelic variant or a non-naturally occurring variant. These nucleotide variants include substitution variants, deletion variants, and insertion variants. As is known in the art, an allelic variant is a form of polynucleotide substitution, which may be the substitution, deletion, or insertion of one or more nucleotides, but does not substantially alter the function of the polypeptide it encodes.

[0070] The present invention also relates to polynucleotides that hybridize with the above-described sequences and have at least 50%, preferably at least 70%, and more preferably at least 80% identity between the two sequences. The present invention particularly relates to polynucleotides that hybridize with the polynucleotides described herein under stringent conditions. In the present invention, “stringent conditions” means: (1) hybridization and elution at lower ionic strength and higher temperatures, such as 0.2×SSC, 0.1% SDS, 60°C; or (2) hybridization with a denaturing agent, such as 50% (v / v) formamide, 0.1% fetal bovine serum / 0.1% Ficoll, 42°C, etc.; or (3) hybridization only occurs when the identity between the two sequences is at least 90%, more preferably at least 95%. Furthermore, the polypeptides encoded by the hybridizable polynucleotides have the same biological functions and activities as the corresponding wild-type polypeptides.

[0071] The genes of this invention are preferably obtained from Rhodiola rosea, Saccharomyces cerevisiae, Bifidobacterium breve, parsley, and Pichia pastoris. This invention may also include other genes obtained from other microorganisms that are highly homologous (e.g., have more than 70%, such as 80%, 90%, 95%, or even 98% sequence identity) to the corresponding genes in Rhodiola rosea, Saccharomyces cerevisiae, Bifidobacterium breve, parsley, and Pichia pastoris. Methods and tools for comparing sequence identity are also well known in the art, such as BLAST.

[0072] The full-length sequences or fragments of the genes of this invention can generally be obtained by PCR amplification, recombination, or artificial synthesis. For PCR amplification, primers can be designed based on the nucleotide sequences disclosed in this invention, especially the open reading frame sequences, to amplify the relevant sequences. When the sequences are long, two or more PCR amplifications can be performed, and then the fragments amplified from each amplification can be spliced ​​together in the correct order.

[0073] The present invention also relates to a vector containing the aforementioned polynucleotide, and a host cell generated by genetic engineering using the aforementioned vector.

[0074] In this invention, the sequences of each gene can be inserted into a recombinant expression vector. The term "recombinant expression vector" refers to bacterial plasmids, bacteriophages, yeast plasmids, plant cell viruses, mammalian cell viruses, or other vectors well-known in the art. In short, any plasmid and vector can be used as long as it can replicate and remain stable within the host. An important characteristic of expression vectors is that they typically contain an origin of replication, a promoter, a marker gene, and translational control elements.

[0075] The sequences of each gene can be inserted separately into a recombinant expression vector, and multiple recombinant expression vectors can be co-transformed into host cells; expression cassettes of multiple genes can also be inserted in tandem into the same recombinant expression vector and transformed into host cells. The recombinant expression vector may also contain expression regulatory sequences operatively linked to the gene sequences to facilitate protein expression. It should be understood that those skilled in the art, after understanding the technical content of this invention, can easily construct recombinant expression vectors. The obtained recombinant expression vectors are also included in this invention.

[0076] In expression regulatory sequences or expression cassettes, inducible or constitutive promoters can be applied according to different needs. Inducible promoters can achieve more controllable protein expression and compound production, which is beneficial for industrial applications.

[0077] As a preferred embodiment of the present invention, an expression vector (expression construct) is provided, comprising expression cassettes of the following genes: YNK1, URA6, KDC4, UPG1, PGM1, UGT33, ARO4, ARO7, XFPK, AAS, and the knockout of EXG1, SPR1, YMR244W, and YESR genes.

[0078] The expression vector (expression construct) can be established using techniques familiar to those skilled in the art. Once the desired gene is known, those skilled in the art can establish the expression construct. The gene sequence can be inserted into different expression constructs (such as expression vectors) or into the same expression construct, as long as the encoded polypeptide can be effectively expressed and active after transformation into cells. As a preferred embodiment of the present invention, the expression vector is pGAP Zα.

[0079] Vectors containing the aforementioned appropriate gene sequences and appropriate promoters or control sequences can be used to transform suitable host cells to enable them to express proteins. In this invention, the host cell is preferably an engineered yeast strain, more preferably Pichia pastoris, such as Pichia pastoris GS115.

[0080] Transforming host cells with recombinant DNA can be performed using conventional techniques well known to those skilled in the art. When the host is a eukaryote, the following DNA transformation methods can be used: calcium phosphate coprecipitation, conventional mechanical methods such as microinjection, electroporation, and liposome packaging.

[0081] The obtained transformants can be cultured using conventional methods, and the culture medium used can be a yeast culture medium well-known in the art. Culture should be carried out under conditions suitable for yeast cell growth.

[0082] This invention also provides a kit for the biosynthesis of rhodioloside, comprising: YNK1, URA6, KDC4, UPG1, PGM1, UGT33, ARO4, ARO7, XFPK, AAS; and down-regulators of histones or their encoding genes: EXG1, SPR1, YMR244W, or YESR. More preferably, the kit also includes instructions for use describing the method of biosynthesis.

[0083] The recombinant Pichia pastoris strain obtained through gene recombination technology in this invention has advantages such as a clear metabolic background and strong heterologous expression ability. It can achieve low-cost fermentation using ethanol as a carbon source and combined with inorganic salt culture medium. Moreover, it has a short fermentation cycle, high conversion rate of the intermediate tyrosol, and no significant accumulation, demonstrating excellent industrial adaptability and providing an efficient and economical new strategy for the large-scale production of rhodioloside.

[0084] Methods for synthesizing rhodioloside

[0085] The structural formula of rhodioloside is shown below.

[0086]

[0087] This invention discloses a method for producing rhodioloside via heterologous microbial synthesis. The method includes: transforming 10 exogenous genes (preferably YNK1, URA6, KDC4, UPG1, PGM1, UGT33, ARO4, ARO7, XFPK, and AAS) into engineered yeast strains, and knocking out endogenous EXG1, SPR1, YMR244W, and YESR genes to produce rhodioloside.

[0088] This invention also provides a fermentation culture method for a recombinant yeast engineered strain for producing rhodioloside. The rhodioloside-producing yeast engineered strain of this invention can be cultured in yeast culture medium, preferably with carbon source supplementation during culture; preferably with glucose added every 12-36 hours; more preferably with glucose added to a final concentration of 1-4% (v / v). Particularly noteworthy is that the recombinant yeast engineered strain of this invention exhibits ideal enzyme activity and mobilizes the endogenous mechanisms of yeast cells during production. Therefore, the intermediate tyrosol in the technical solution of this invention has a high conversion rate and no significant accumulation, which is beneficial for large-scale production. In a preferred embodiment of this invention, the inventors optimized the culture time to 60-140 hours, preferably 70-130 hours, and more preferably 80-120 hours, based on the production characteristics of the recombinant yeast engineered strain for producing rhodioloside.

[0089] In a specific embodiment of the present invention, a preferred method for producing rhodioloside is provided, comprising: culturing recombinant bacteria to the logarithmic growth phase in liquid YPD culture at 30°C and 200 r / min; collecting the bacterial cells, washing them twice with sterile water, and then transferring them to YPD medium for culturing at 30°C and 200 r / min for 96 h; adding 2% glucose to the liquid medium every 24 h during fermentation.

[0090] After obtaining the fermentation product, rhodioloside can be extracted from it using techniques known in this invention. High-performance liquid chromatography (HPLC) can be used to analyze and identify the product to confirm that the desired compound has been obtained.

[0091] Reagent test kit

[0092] The present invention also provides a kit containing engineered strains for producing the rhodioloside. Furthermore, it may also include a culture medium for yeast cells and reagents for isolating or detecting the rhodioloside. More preferably, the kit may also include instructions for use explaining the method for biosynthesizing the rhodioloside.

[0093] This invention also provides a kit for constructing the engineered strain for producing rhodioloside. The kit may include a series of constructs, such as those provided in the embodiments of this invention, or other constructs containing the gene but with different gene arrangements or tandem configurations. The expression vector (expression construct) can be established using techniques familiar to those skilled in the art. Once the desired enzyme and the desired cell system for expression are known, those skilled in the art can establish the expression construct. The gene sequence can be inserted into different expression constructs (such as expression vectors) or into the same expression construct, as long as the encoded polypeptide can be effectively expressed and active after transformation into cells. The kit may also include yeast cells, yeast cell culture medium, and reagents for the isolation or detection of rhodioloside. More preferably, the kit may also include instructions for use describing the method for biosynthesizing rhodioloside.

[0094] The main advantages of this invention are:

[0095] This invention utilizes recombinant Pichia pastoris for heterologous production of rhodioloside, solving problems such as the consumption of large amounts of plant raw materials, limitations imposed by seasonal and geographical factors, and low content of active ingredients in plant extraction methods. It also avoids the complex reactions, use of highly toxic reagents, environmental pollution, and high costs associated with chemical synthesis methods, thus opening a new avenue for the industrial production of rhodioloside. Therefore, the recombinant Pichia pastoris strain of this invention has the potential for industrial-scale production of rhodioloside.

[0096] This invention enables whole-cell de novo biosynthesis of rhodioloside using recombinant Pichia pastoris. It achieves low-cost fermentation with ethanol as the carbon source and an inorganic salt culture medium, minimizing impurity interference and facilitating product separation and purification. Furthermore, the short fermentation cycle, high conversion rate of the intermediate tyrosol, and lack of significant accumulation demonstrate excellent industrial adaptability, providing a new, efficient, and economical strategy for the large-scale production of rhodioloside.

[0097] The present invention will be further illustrated below with reference to specific embodiments. It should be understood that these embodiments are for illustrative purposes only and are not intended to limit the scope of the invention. Experimental methods in the following embodiments that do not specify specific conditions are generally performed according to conventional conditions such as those described in J. Sambrook et al., Molecular Cloning: A Laboratory Manual, 3rd Edition, Science Press, 2002, or according to the manufacturer's recommendations.

[0098] culture medium

[0099] YPD liquid culture medium: glucose 20.0 g / L, peptone 20.0 g / L, yeast extract 10.0 g / L.

[0100] YPD solid medium: glucose 20.0 g / L, peptone 20.0 g / L, yeast extract 10.0 g / L, agar 20.0 g / L.

[0101] YND solid medium: glucose 20.0 g / L, amino-free yeast nitrogen source (YNB) 6.7 g / L, agar 20.0 g / L.

[0102] The formulation of BSM inorganic salt culture medium is shown in Table 1.

[0103] Table 1

[0104]

[0105] Example 1: Construction of expression plasmid

[0106] 1. Genetic information and P GAP Construction of plasmids expressing each gene

[0107] The overexpressed genes involved are shown in Table 2.

[0108] Table 2

[0109] Gene source sequence YNK1 Pichia pastoris (Pp) SEQ ID NO: 7 URA6 Pichia pastoris (Pp) SEQ ID NO: 8 KDC4 Pichia pastoris (Pp) SEQ ID NO: 10 UPG1 Pichia pastoris (Pp) SEQ ID NO: 9 PGM1 Pichia pastoris (Pp) SEQ ID NO: 6 U8GT33 Rhodiola rosea (Rr.) SEQ ID NO: 1 ARO4(K229L) Saccharomyces cerevisiae (Sc) SEQ ID NO: 2 ARO7(G141S) Saccharomyces cerevisiae (Sc) SEQ ID NO: 3 XFPK Bifidobacterium breve (Bb) SEQ ID NO: 4 AAS Parsley (Petroselinum crispum; PC) SEQ ID NO: 5

[0110] Genes RrU8GT33, BbXFPK, and PcAAS were synthesized by Nanjing Genscript Biotech Co., Ltd. and directly constructed onto the vector plasmid pGAP Zα (Invitrogen). ScARO4 and ScARO7 were obtained from the Saccharomyces cerevisiae genome, and PpPGM1, PpYNK1, PpURA6, PpUPG1, and PpKDC4 were obtained from the Pichia pastoris genome and directly constructed onto the vector plasmid pGAP Zα (Invitrogen).

[0111] The obtained plasmids are named: pGAP_RrU8GT33, pGAP_BbXFPK, pGAP_PcAAS, pGAP_ScARO4 K229L pGAP_ScARO7 G141S , pGAP_PpPGM1, pGAP_PpYNK1, pGAP_PpURA6, pGAP_PpUPG1, pGAP_PpKDC4.

[0112] 2. Construction of gene combination plasmids

[0113] The plasmid pGAP_ScARO4 constructed in step "1" above K229L pGAP_ScARO7 G141SUsing pGAP_BbXFPK, pGAP_PcAAS, pGAP_PpPGM1, pGAP_PpYNK1, pGAP_PpURA6, and pGAP_PpUPG1 as templates, PCR amplification (primers SEQ ID NO: 11, 12) yielded ScARO4 containing both the promoter and terminator. K229L ScARO7 G141S Complete expression cassettes of the genes BbXFPK, PcAAS, PpPGM1, PpYNK1, PpURA6, and PpUPG1 are provided. A seamless assembly kit allows the linearized plasmid and gene expression cassettes to be linked to obtain plasmid pGAP_ScARO4. K229L +ScARO7 G141S pGAP_BbXFPK+PcAAS, pGAP_PpPGM1+PpYNK1, and pGAP_PpURA6+PpUPG1.

[0114] Using the previously constructed plasmids pGAP_RrU8GT33, pGAP_PpKDC4, and pGAP_ScARO4 K229L +ScARO7 G141S Using pGAP_BbXFPK+PcAAS, pGAP_PpPGM1+PpYNK1, and pGAP_PpURA6+PpUPG1 as templates, PCR amplification (primers SEQ ID NO: 12, 13) yielded RrU8GT33, PpKDC4, and ScARO4, which contain promoters and terminators. K229L +ScARO7 G141S Complete expression cassettes of the genes pGAP_RrU8GT33+BbXFPK+PcAAS, PpPGM1+PpYNK1, and PpURA6+PpUPG1 were obtained. A seamless assembly kit was used to link the linearized plasmids and gene expression cassettes to obtain plasmids pGAP_RrU8GT33+BbXFPK+PcAAS and pGAP_ScARO4. K229L +ScARO7 G141S +PpKDC4, pGAP_PpPGM1+PpYNK1+PpURA6+PpUPG1.

[0115] 3. Construction of gene combinatorial plasmids containing homologous arms

[0116] Plasmids pDAg2, pDFg1, and pDTg1 were double-digested with ApaI and XhoI (see Liu Q, Shi X, Song L, et al. CRISPR-Cas9 mediated genomic multilociintegration in Pichia pastoris[J]. Microbial Cell Factories, 2019, 18:144), and linearized plasmids were recovered. The plasmids pGAP_RrU8GT33+BbXFPK+PcAAS and pGAP_ScARO4 constructed in step "2" above were then used. K229L +ScARO7 G141S Using +PpKDC4, pGAP_PpPGM1+PpYNK1+PpURA6+PpUPG1 as templates, fragments containing multiple gene expression cassettes were obtained by PCR amplification (primers SEQ ID NO: 14-15). The linearized plasmid and the gene expression cassette fragments were then ligated using a seamless assembly kit to obtain the following plasmid:

[0117] pDAg2_RrU8GT33+BbXFPK+PcAAS;

[0118] pDFg1_ScARO4 K229L +ScARO7 G141S +PpKDC4;

[0119] pDTg1_PpPGM1+PpYNK1+PpURA6+PpUPG1.

[0120] Example 2: Preparation of the target recombinant yeast

[0121] 1. PCR verification of recombinant strains

[0122] Each DNA fragment and its corresponding gRNA plasmid were electroporated into Pichia pastoris (GS115). After recovery, the fragments were plated on YND (or YPD(NTC)) solid medium and cultured for 5 days (or 3 days). Fresh colonies were then picked and cultured in YPD liquid medium. The genomes of each transformant were extracted using a yeast genome extraction kit. The integration or knockout of each gene involved in rhodioloside synthesis was identified by clonal PCR.

[0123] Cloning PCR reaction conditions:

[0124] (1) Initial denaturation at 95℃ for 5 min;

[0125] (2) Denaturation at 95℃ for 30s, annealing at 50℃ for 30s, extension at 72℃ for 1min / kb, cycle the reaction 30 times.

[0126] (3) Finally extend at 72℃ for 7 minutes.

[0127] 2. Obtaining Rhodioloside-producing strains

[0128] Using plasmids pDAg2_RrU8GT33+BbXFPK+PcAAS and pDFg1_ScARO4 K229L +ScARO7 G141S Using +PpKDC4, pDTg1_PpPGM1+PpYNK1+PpURA6+PpUPG1 as templates, gene fragments containing homologous arms were amplified by PCR. These fragments, along with the circular plasmid 3.5k-PFg1+PAg2+PTg1 (primers and circular plasmid are described in Liu Q et al. CRISPR-Cas9 mediated genomic multilociintegration in Pichia pastoris[J]. Microbial Cell Factories, 2019, 18:144), were simultaneously electrotransformed into competent Pichia pastoris cells. Recombinants were screened using YND solid culture, yielding 10 gene fragments (RrU8GT33, ScARO4, etc.). K229L ScARO7 G141S The recombinant Pichia pastoris strain S1 (BbXFPK, PcAAS, PpKDC4, PpPGM1, PpYNK1, PpURA6, PpUPG1) was streaked onto YPD solid medium and recombinant strains were validated by PCR to ensure that the circular plasmid was not lost.

[0129] The information on the knockout genes involved is shown in Table 3.

[0130] Table 3

[0131]

[0132] Using donor plasmids that knock out the YMR244W and YESR genes as templates, two donor fragments were obtained by PCR amplification. These fragments, along with the gRNA-Cas9 plasmids BB3pN-YMR244W-gRNA1 and BB3pN-YESR-gRNA1, were then electrotransformed into the aforementioned Pichia pastoris competent cells S1 (donor plasmids, primers, and gRNA plasmids are described in Qian Z et al. High-level de novobiosynthesis of medical plant-derived flavonoid glycosides[J]. Nature Synthesis, 2025). Recombinants were screened using YPD(NTC) solid culture, yielding 10 gene sequences (RrU8GT33, ScARO4...). K229LScARO7 G141S The Pichia pastoris genetically engineered strain S2, with two genes (YMR244W and YESR) simultaneously knocked out (BbXFPK, PcAAS, PpKDC4, PpPGM1, PpYNK1, PpURA6, PpUPG1), was streaked onto YPD solid medium and recombinant strains were verified by PCR to ensure that the gRNA plasmid was lost.

[0133] Using donor plasmids that knocked out EXG1 and SPR1 genes as templates, two donor fragments were obtained by PCR amplification. These fragments, along with the gRNA-Cas9 plasmids BB3pN_pGAP_3EXG1_pLAT1_Cas9 and BB3pN_pGAP_2SPR1_pLAT1_Cas9, were simultaneously electrotransformed into the above-mentioned Pichia pastoris competent cells S2 (donor plasmids, primers, and gRNA plasmids are described in Qian Z et al. High-level de novo biosynthesis of medical plant-derived flavonoid glycosides[J]. Nature Synthesis, 2025). Recombinants were screened using YPD(NTC) solid culture, yielding 10 gene variants (RrU8GT33, ScARO4...). K229L ScARO7 G141S The Pichia pastoris genetically engineered strain S3, with four genes simultaneously knocked out (EXG1, SPR1, YMR244W, YESR) (BbXFPK, PcAAS, PpKDC4, PpPGM1, PpYNK1, PpURA6, PpUPG1), was used. This strain was streaked onto YPD solid medium, and PCR verification of the recombinant strain was performed again to ensure the loss of the circular plasmid.

[0134] Example 3: Fermentation process of recombinant engineered bacteria in 250ml conical flasks

[0135] The strains that produce rhodioloside contain 10 genes: RrU8GT33, ScARO4 K229L ScARO7 G141S BbXFPK, PcAAS, PpKDC4, PpPGM1, PpYNK1, PpURA6, and PpUPG1; and knock out four genes: EXG1, SPR1, YMR244W, and YESR.

[0136] The recombinant bacteria were cultured to the logarithmic growth phase in liquid YPD medium at 30℃ and 200 rpm. The cells were collected, washed twice with sterile water, and then transferred to a 250 mL Erlenmeyer flask containing 50 mL of liquid YPD medium. The flask was then incubated at 30℃ and 200 rpm for 96 h. During fermentation, 2% (v / v) glucose was added to the liquid medium every 24 h.

[0137] Example 4: Fermentation process in a 3L reactor

[0138] The basal medium BSM (formulation has been commercialized by Invitrogen) was used as the culture medium. The fermentation process was divided into batch stage and fed-batch stage. The carbon source in the batch stage was glucose. In the fed-batch stage, glucose was fed in the early stage (flow feed) and ethanol was fed in the middle and late stages.

[0139] During the process, the stirring speed in the fermenter should be controlled at 1000 r / min; oxygen should be provided to ensure that the dissolved oxygen during fermentation is maintained between 20-50%; and ammonia should be provided to ensure that the pH of the fermentation broth is maintained between 5.0-7.0.

[0140] In the early stage of fermentation, glucose was used as the carbon source to promote cell growth. Glucose was continuously provided as feed until the cells grew to 200 g / L wet weight. Then, ethanol was switched to fed feed, and the feed rate was gradually increased from 2 ml / L / h to 12 ml / L / h. Fermentation ended after 120 h of culture.

[0141] The basal medium BSM (formulation has been commercialized by Invitrogen) was used as the culture medium. The fermentation process was divided into batch stage and fed-batch stage. The carbon source was glucose. During the fed-batch stage, the glucose flow rate was gradually increased from 6 ml / L / h to 24 ml / L / h. Fermentation ended after 120 h.

[0142] During the process, the stirring speed in the fermenter should be controlled at 1000 r / min; oxygen should be provided to ensure that the dissolved oxygen during fermentation is maintained between 20-50%; and ammonia should be provided to ensure that the pH of the fermentation broth is maintained between 5.0-7.0.

[0143] Example 5: Extraction and identification of fermentation products from recombinant strains

[0144] The recombinant strain, after the aforementioned verification, was cultured in YPD liquid medium to the logarithmic growth phase, and 50 OD (Note: OD value is yeast concentration unit, 1 OD is approximately 5 x 10⁻⁶) was collected. 7Yeast cells (OD values ​​were measured at 600 nm using a UV spectrophotometer) were washed twice with sterile water and then transferred to 50 mL of YPD liquid medium. Fermentation was carried out at 30℃ and 200 rpm for 96 h. 1 mL of the fermentation broth was mixed thoroughly with an equal volume of methanol and centrifuged at 12000 g for 2 min. The supernatant was filtered and analyzed by high-performance liquid chromatography (HPLC).

[0145] High-performance liquid chromatography (HPLC) analysis was performed using an Agilent 1100 reverse-phase HPLC system. A C18 column was used at 30°C, and the UV detection wavelength was 224 nm. Phase A consisted of 100% acetonitrile, and phase B consisted of 0.1% formic acid. The elution method was as follows: 0–18 min, 10% phase A; 18–20 min, 10%–100% phase A; 20–25 min, 100% phase A; 25–26 min, 100%–10% phase A; 26–30 min, 10% phase A.

[0146] Example 6: Cell biomass and product yield during fermentation

[0147] 1. Conical flask fermentation culture

[0148] Fermentation was carried out according to the 250ml Erlenmeyer flask fermentation method described in Example 3. Samples were taken 96 hours after fermentation, and the rhodioloside yield was determined to be 6.0 g / L. Under the same conditions, Pichia pastoris GS115 cells (without the introduction of exogenous genes or gene knockout) produced approximately 68.3 mg / L of naturally occurring tyrosol.

[0149] 2-3L reactor fermentation culture

[0150] Fermentation was carried out according to the 3L reactor fermentation method described in Example 4. Samples were taken after 8-12 hours of fermentation to determine the wet weight of the cells and the amount of rhodioloside product.

[0151] Fermentation and production of strains with ethanol and glucose as carbon sources are shown in [link to relevant documentation]. Figure 2 and 3 As fermentation time increased, the cell biomass and product yield of the strain gradually increased. At 108h and 92h of fermentation, the yield of rhodioloside reached 15.7g / L, and the accumulation of tyrosol was the highest at 203.0mg / L and 131.5mg / L, respectively.

[0152] 3. Impact analysis of gene introduction / knockout

[0153] The inventors used the same method as before to investigate the effects of the introduction of exogenous genes or gene knockout on the production of rhodioloside (Table 4) and conducted analysis.

[0154] Table 4

[0155]

[0156] Sequence information

[0157] RrU8GT33 (SEQ ID NO:1); Rhodiola rosea; DNA; 1-1494

[0158]

[0159] ScARO4 K229L (SEQ ID NO:2); Saccharomyces cerevisiae; DNA; 1-1110

[0160]

[0161] ScARO7 G141S (SEQ ID NO:3); Saccharomyces cerevisiae; DNA; 1 - 768

[0162] atggatttcacaaaaccagaaactgttttaaatctacaaaatattagagatgaattagttagaatggaggattcgatcatcttcaaatttattgagaggtcgcatttcgccacatgtccttcagtttatgaggcaaaccatccaggtttagaaattccgaattttaaaggatctttcttggattgggctctttcaaatcttgaaattgcgcattctcgcatcagaagattcgaatcacctgatgaaactcccttctttcctgacaagattcagaaatcattcttaccgagcattaactacccacaaattttggcgccttatgccccagaagttaattacaatgataaaataaaaaaagtttatattgaaaagattataccattaatttcgaaaagagatggtgatgataagaataacttcTCttctgttgccactagagatatagaatgtttgcaaagcttgagtaggagaatccactttggcaagtttgttgctgaagccaagttccaatcggatatcccgctatacacaaagctgatcaaaagtaaagatgtcgaggggataatgaagaatatcaccaattctgccgttgaagaaaagattctagaaagattaactaagaaggctgaagtctatggtgtggaccctaccaacgagtcaggtgaaagaaggattactccagaatatttggtaaaaatttataaggaaattgttatacctatcactaaggaagttgaggtggaatacttgctaagaaggttggaagag

[0163] BbXFPK(SEQ ID NO:4); Bifidobacterium breve; DNA; 1 - 2478

[0164]

[0165] PcAAS (SEQ ID NO:5); Parsley; DNA; 1-1545

[0166]

[0167] PpPGM1 (SEQ ID NO:6); Pichia pastoris; DNA; 1-1698

[0168]

[0169] PpYNK1 (SEQ ID NO:7); Pichia pastoris; DNA; 1 - 459

[0170] atgtcccaaaacgagagaaccttcattgctgttaaaccagatggtgtccagagaggtctggtaccagagatcctgtccagattctggaacaagggttacaagttagttgctatcaagttgactttggctaacgaagacttgttgagagagcactatgctgatttgacctccaagccattcttcccatctctgctgtcttacatgttgagtggtccagtcttggctaccgtctgggagggtaaggatgttgtcaagcagggtagagctttgttgggtgctactaaccctttggcttccgccccaggtaccatcagaggtgacttcgccgttgacatgggtagaaacatcatccatggttccgactctgttgagtctgccgagaaggaaatcggtttgtggttcaaaaaggaggaacttgttgactacaagccaactttgacctcttggatctacgaataa

[0171] PpURA6 (SEQ ID NO:8); Pichia pastoris; DNA; 1 - 837

[0172] atgtttaccagatctgttagaaactcctttgtgagggcaggacctattcgtctcggtcccgttgtttctaagagactgtacagccaagcgcagaatggtggcattaaccataagagaattctgatcggacttggtctattggctattggaaccaccctttacgggacaaccaaccctaccaagactcctattgcatttgtggaaccagccacggaaagagcgtttaaggacggagacgtctctgtgatttttgttctcggaggtccaggagctggaaaaggtacccaatgtgccaaactagtgagtaattacggatttgttcacctgtcagctggagacttgttacgtgcagaacagaagagggaggggtctaagtatggagagatgatttcccagtatatcagagatggactgatagtacctcaagaggtcaccattgcgctcttggagcaggccatgaaggaaaacttcgagaaagggaagacacggttcttgattgatggattccctcgtaagatggaccaggccaaaacttttgaggaaaaagtcgcaaagtccaaggtgacacttttctttgattgtcccgaatcagtgctccttgagagattacttaaaagaggacagacaagcggaagagaggatgataatgcggagagtatcaaaaaaagattcaaaacattcgtggaaacttcgatgcctgtggtggactatttcgggaagcaaggacgcgttttgaaggtatcttgtgaccaccctgtggatcaagtgtattcacaggttgtgtcggtgctaaaagagaaggggatctttgccgataacgagacggagaataaataa

[0173] PpUPG1 (SEQ ID NO:9); Pichia pastoris; DNA; 1 - 1512

[0174] atgagcgcctatcaatctcctaagaaacacgtcaagactcagtccgcctatgctttcgacaacaccacaacaagcattgctgcctctcaaatgagaaacgttctcaaca

[0175] ccttggtcgactctgtgcatgcagccgatgagcacacaagggagcgtttcgaaaatgagatggacactttcttcgggttgtttcgtcgctacttagctgacaaggcctcc

[0176] ggttctactttggactgggacaaaatcaactcccccaccaaagaggaagtcgttaagtaccaagatcttaagagcgttgaaaacactgacaacttgtccaagcttgcc

[0177] gtgctcaagttgaatggtggtctgggaacctcaatgggttgtgttggaccgaaatccgttatcgaagttcgtgagggacaatccttcctggacctttccgttcgtcagatt

[0178] gaatacctcaacagaactttcgacaccgatgttccattgctattgatgaactctttcaacacggatgatgacactcatcatttgatccagaagtaccagggtcatcgtatt

[0179] cgtatccgcacattcaaccaatctcgatatccacgtattttcaaagattcactgcttcctgttccacagtcttatgatgattctttggaagcctggtatcctccaggtcacgg

[0180] tgatctctttgaatctctggtagcttcaggtgagttagatgtactattgcagcaaggtaaggaaatcttatttgtctccaacggtgataacttaggagcaactgtggacac

[0181] caagattttgaaccatatgattgaaacaggtgctgaatacattatggagcttacggataaaactagggctgatgttaagggtggtactttgatctcgtacgatggtcaag

[0182] tccgtctattggagattgcccaagttccaaaagagcatgttgaagagtttaaatctatcaagaaatttactaacttcaataccaataacttgtggatcaatttgaaggcta

[0183] tcaagcgtctggtagaatccgattcaatcaaagtggaaataattccaaacaacaagactatccgcgttggctctcaggaggttaacgttgtgcaattggagactgctgtt

[0184] ggtgccgctatcagacatttccgcaatgcacacggtgtggtggtatcaagatctcgtttcttgccagttaaaacatgttcagatctactgctagtcaaatctgacctgttct

[0185] atcttgaacatggttcactaaaaatagatcctgcccgttttggggctgctccacttattaagttgggttctcactttaagaaggtcaaggagttccaggatcggattcccc

[0186] atatgcctaaaatcttggaattggatcaccttacggttaccggtaatgttcagtttggtaaaggagtccagctaaaaggaactgtcattatcgtgtgttctgacggtcaaa

[0187] gaattgacatccctaacggatcaattcttgaaaatgttgttgttacaggtaaccttactattttggagcattag<00ness="font-family:宋体;font-size:12pt">

[0188] PpKDC4 (SEQ ID NO:10); Pichia pastoris; DNA; 1 - 1809

[0189]

[0190] SEQ ID NO:11; DNA; artificial sequence; primers

[0191] gaccttcgtttgtgcggatcagatcttttttgtagaaatgtc

[0192] SEQ ID NO:12; DNA; artificial sequence; primers

[0193] gctatggtgtgtgggggatcctctcacttaatcttctgtac

[0194] SEQ ID NO:13; DNA; artificial sequence; primers

[0195] gaagattaagtgagaggatcatcagatcttttttgtagaaatgtc

[0196] SEQ ID NO:14; DNA; artificial sequence; primers

[0197] ggcagtaattgatatactagattttggtcatgcatgagat

[0198] SEQ ID NO:15; DNA; artificial sequence; primers

[0199] Gacctaccctacgacgggccttgaagctatggtgtgtggg

[0200] The embodiments described above are merely illustrative of several implementations of the present invention, and while the descriptions are relatively specific and detailed, they should not be construed as limiting the scope of the present invention. It should be noted that those skilled in the art can make various modifications and improvements without departing from the concept of the present invention, and these all fall within the scope of protection of the present invention. Therefore, the scope of protection of this patent should be determined by the appended claims. Furthermore, all documents mentioned in this invention are incorporated herein by reference as if each document were individually incorporated by reference.

Claims

1. A method for producing salidroside, the method comprising: (1) providing a yeast engineering strain, wherein the yeast engineering strain is transformed with expression cassettes of the following exogenous enzymes: YNK1, URA6, KDC4, UPG1, PGM1, UGT33, ARO4, ARO7, XFPK, AAS; and the expression or activity of the following endogenous proteins is down-regulated: EXG1, SPR1, YMR244W or YESR; (2) culturing the yeast engineering strain of (1) to produce salidroside. The down-regulation is performed by methods including gene knockout / silencing, gene interference; preferably, the down-regulation is performed by gene knockout / silencing through gene editing or homologous recombination; more preferably, the gene editing is performed by CRISPR / Cas9 method.

2. The method of claim 1, wherein, The YNK1, URA6, KDC4, UPG1, PGM1 are from Pichia pastoris; 3. The method of claim 1, wherein, The U8GT33 is from Rhodiola rosea; The ARO4, ARO7 are from Saccharomyces cerevisiae; The XFPK is from Bifidobacterium breve; The AAS is from Petroselinum crispum. In the yeast engineering strain, expression cassettes containing the following suitably linked coding genes are transformed: UGT33+XFPK+AAS expression cassette, ARO4+ARO7+KDC4 expression cassette, PGM1+YNK1+URA6+UPG1 expression cassette.

4. The method of claim 1, wherein, When culturing the yeast engineering strain of (1), the yeast engineering strain is cultured using a yeast culture medium, preferably, a carbon source is supplemented during the culturing; preferably, the carbon source is glucose and / or ethanol; preferably, the culturing process is divided into a batch phase and a fed-batch phase, and the carbon source in the batch phase is glucose, wherein the carbon source in the fed-batch phase is supplemented with glucose in the early stage and supplemented with ethanol in the middle and late stages.

5. The method of claim 1, wherein, 6. A yeast engineering strain for producing salidroside, wherein the yeast engineering strain is transformed with expression cassettes of the following exogenous enzymes: YNK1, URA6, KDC4, UPG1, PGM1, UGT33, ARO4, ARO7, XFPK, AAS; and the expression or activity of the following endogenous proteins is down-regulated: EXG1, SPR1, YMR244W or YESR. The yeast engineering strain comprises Pichia pastoris; preferably, the yeast engineering strain comprises Pichia pastoris GS115.

7. The engineered yeast strain for producing rhodiolin of claim 6, wherein the yeast strain is Saccharomyces cerevisiae.

8. Use of a combination of genes for transforming into a yeast engineering strain to prepare salidroside compounds; the combination of genes comprises: genes encoding the following enzymes: YNK1, URA6, KDC4, UPG1, PGM1, UGT33, ARO4, ARO7, XFPK, AAS; and ​ a down-regulation agent of the group of histones or its encoding genes: EXG1, SPR1, YMR244W or YESR; preferably, the down-regulation agent is a gene editing agent or a homologous recombination agent, and the down-regulation is performed by gene knockout / silencing through gene editing or homologous recombination; more preferably, the down-regulation agent comprises sgRNA.

9. A kit for producing rhodioside, comprising: a gene encoding YNK1, URA6, KDC4, UPG1, PGM1, UGT33, ARO4, ARO7, XFPK, AAS, an expression cassette containing the gene, an expression construct, and a down-regulation agent of the group of histones or its encoding genes: EXG1, SPR1, YMR244W or YESR; preferably, the down-regulation agent is a gene editing agent or a homologous recombination agent, and the down-regulation is performed by gene knockout / silencing through gene editing or homologous recombination; more preferably, the down-regulation agent comprises sgRNA.

10. A kit for producing salidroside, comprising: The yeast engineering bacteria according to any one of claims 6 or 7.

Images