Heat-aging-resistant skin care composition suitable for sensitive skin as well as preparation method and application of heat-aging-resistant skin care composition

Abstract

The invention discloses a heat-aging-resistant skin care composition suitable for sensitive skin as well as a preparation method and application of the heat-aging-resistant skin care composition, and relates to the technical field of cosmetics. The invention provides a heat-aging-resistant skin care composition. The heat-aging-resistant skin care composition is prepared from the following components in parts by weight: 0.1 to 5 parts of golden camellia flower extract, 0.05 to 1 part of ampelopsis grossedentata leaf extract, 0.01 to 1 part of herba andrographitis leaf extract and 0.1 to 3 parts of beta-glucan. According to the invention, the four components cooperate and act together from multiple dimensions of signal source, catalytic process, inflammation amplification and barrier protection, and ET-1 / MITF axis signal transduction is significantly down-regulated, so that the effects of resisting thermal aging, brightening skin color and resisting darkness are achieved.

Description

Technical Field

[0001] This application relates to the field of cosmetic technology, and in particular to a skin care composition for sensitive skin that resists heat aging, its preparation method, and its application. Background Technology

[0002] Thermal aging is an accelerated aging phenomenon caused by prolonged or repeated exposure to high-temperature environments such as sunlight, infrared radiation, high-temperature equipment, and hot steam. Its essence lies in the direct damage of heat to collagen structure, inducing oxidative stress and chronic inflammation, leading to irreversible damage such as skin barrier disruption, loss of elasticity, and pigmentation. Its core mechanisms include high-temperature activation of TRPV1 receptors inducing neurogenic inflammation, overexpression of matrix metalloproteinases (MMPs) degrading collagen and elastin fibers, reactive oxygen species (ROS) causing oxidative damage, and heat stress prompting keratinocytes to release endothelin (ET-1), triggering pigmentation disorders. Experimental data shows that after 15 minutes of sun exposure at midday in summer, the dermal temperature can reach 43°C, a temperature that triggers thermal aging. Current skincare technologies targeting thermal aging have significant limitations: firstly, they rely on single-pathway intervention with highly active ingredients, such as retinol and its derivatives stimulating collagen regeneration, and high-concentration vitamin C derivatives for antioxidant effects. While effective in specific anti-aging or antioxidant dimensions, these methods are highly irritating to sensitive skin, easily causing adverse reactions such as barrier damage, redness, and peeling. Secondly, plant extract compound formulations, such as the combination of golden camellia extract and oat β-glucan in existing technologies (patent number CN202510548234), only provide basic antioxidant and moisturizing effects, offering little improvement for the neuroinflammation and accompanying dullness unique to heat aging. Thirdly, physical barrier strategies, such as adding UV shielding agents like zinc oxide and titanium dioxide, are passive protection methods. They cannot target and inhibit TRPV1 activation and ET-1 release to improve heat-induced dullness, and the nanoparticles pose a risk of clogging pores, resulting in a long repair cycle and raising concerns about safety for sensitive skin. Overall, existing technologies do not address the core mechanisms of heat aging and have minimal effect on improving problems such as heat-induced erythema, deep collagen loss, and persistent redness. This application is made in view of the aforementioned deficiencies in the prior art. Summary of the Invention

[0003] Based on this, the purpose of this application is to overcome the shortcomings of the prior art and provide a skin care composition for sensitive skin that resists heat aging, as well as its preparation method and application.

[0004] To achieve the above objectives, the technical solution adopted in this application is as follows: a skin care composition for resisting heat aging, comprising the following ingredients in parts by weight: 0.1-5 parts of Camellia chrysantha flower extract, 0.05-1 parts of Ampelopsis japonica leaf extract, 0.01-1 parts of Andrographis paniculata leaf extract, and 0.1-3 parts of β-glucan.

[0005] Camellia chrysantha flower extract activates the SIRT6 pathway through flavonoids, inhibiting heat stress-induced glycation damage; it also directly blocks the TRPV1 signaling pathway, reducing neurogenic inflammation and improving skin cell survival after heat stress. Ampelopsis japonica leaf extract, with dihydromyricetin as its core, activates the Nrf2 / ARE pathway to enhance antioxidant capacity and eliminate ROS generated by heat stress; it also directly inhibits MMP-1 (a key enzyme in collagen degradation) expression, reducing collagen loss, while simultaneously inhibiting tyrosinase activity. Andrographis paniculata leaf extract, relying on andrographolide, reduces the secretion of pro-inflammatory factors such as IL-6 and TNF-α, alleviating heat-induced chronic inflammation; its sterol structure can embed into stratum corneum lipids, accelerating barrier repair and regulating skin metabolism, reducing the continuous damage to the barrier caused by heat stress. β-glucan binds to the skin's CD44 receptor through a helical structure composed of glycosidic bonds, stimulating tight junction protein expression and enhancing epidermal cohesion; its hydroxyl network can retain moisture for a long time, increasing stratum corneum hydration and barrier function. The three components of this invention—Camellia chrysantha flower extract, Ampelopsis japonica leaf extract, and Andrographis paniculata leaf extract—can directly inhibit heat stress, thereby improving heat aging; β-glucan indirectly improves heat aging by strengthening the skin barrier function and reducing secondary damage and persistent inflammation caused by external heat stimulation.

[0006] This invention utilizes the synergistic effects of Camellia chrysantha flower extract, Ampelopsis japonica leaf extract, Andrographis paniculata leaf extract, and β-glucan. While these four ingredients are not traditional whitening agents, they exhibit an unexpected synergistic effect in inhibiting hyperpigmentation associated with heat aging. The core mechanism lies in their combined blocking of the heat stress-induced pigmentation signaling pathway. Heat aging not only degrades collagen but also activates keratinocytes to release endothelin-1 (ET-1) and α-MSH. These signals stimulate the upregulation of microphthalmia transcription factor (MITF) in melanocytes, thereby promoting tyrosinase activation and melanin synthesis.

[0007] This invention utilizes the synergistic effects of Camellia chrysantha flower extract, Ampelopsis japonica leaf extract, Andrographis paniculata leaf extract, and β-glucan to work together from multiple dimensions, including signal source, catalytic process, inflammation amplification, and barrier protection, to significantly downregulate the ET-1 / MITF axis signal transduction, thereby achieving unexpected skin brightening and anti-dullness effects that cannot be achieved by using any single ingredient alone.

[0008] Preferably, the anti-heat aging skin care composition comprises the following ingredients in parts by weight: 1-3 parts of Camellia chrysantha flower extract, 0.1-0.3 parts of Ampelopsis japonica leaf extract, 0.1-0.3 parts of Andrographis paniculata leaf extract, and 0.5-1 parts of β-glucan.

[0009] The inventors discovered in their actual research that the weight parts of the components in the composition provided by this invention will affect the performance of the product. When the weight parts of the components are further selected within the above range, the resulting product has better anti-heat aging and skin brightening and anti-dullness effects.

[0010] Preferably, the mass percentage of the *Ampelopsis grossedentata* leaf extract is 4-10% based on the total mass of the anti-heat aging skincare composition.

[0011] The inventors discovered in their actual research that, based on the total mass of the anti-heat aging skincare composition, when the mass percentage of the Ampelopsis japonica leaf extract is within the above-mentioned range, the anti-heat aging, skin brightening, and anti-dullness effects are better.

[0012] Preferably, the β-glucan content is 15-30% by weight, based on the total mass of the anti-heat aging skincare composition.

[0013] The inventors discovered in their actual research that, based on the total mass of the anti-heat aging skincare composition, when the mass percentage of β-glucan is within the above-mentioned range, the anti-heat aging and skin brightening and anti-dullness effects are better.

[0014] Optionally, the β-glucan is at least one of oat β-glucan and schizophyllin; the schizophyllin is a β-glucan directly extracted from the fruiting body, mycelium or fermentation broth of Schizophyllum commune.

[0015] Preferably, the number-average molecular weight of the β-glucan is 50,000 to 250,000 Da.

[0016] Preferably, the preparation method of the Amaranthus pulveratus leaf extract includes the following steps: drying and pulverizing Amaranthus pulveratus leaves, sieving to obtain coarse powder of Amaranthus pulveratus leaves; then adding a eutectic solvent for ultrasonic extraction, filtering, concentrating and drying the extract to obtain Amaranthus pulveratus leaf extract.

[0017] Preferably, the hydrogen bond acceptor of the eutectic solvent is at least one of betaine, sodium PCA, and panthenol; the hydrogen bond donor of the eutectic solvent is at least one of dipropylene glycol, 1,3-propanediol, and glycerol polyether-26; the weight ratio of the hydrogen bond acceptor to the hydrogen bond donor is 1:(1-3); and / or, the water content of the eutectic solvent is 30-60%.

[0018] Preferably, the hydrogen bond acceptor of the eutectic solvent is betaine, and the hydrogen bond donor of the eutectic solvent is dipropylene glycol.

[0019] Optionally, the eutectic solvent is prepared as follows: hydrogen bond donors and hydrogen bond acceptors are stirred at 60-80°C in proportion until a clear and transparent eutectic liquid is formed, and then a specified amount of deionized water is added for dilution to obtain a homogeneous and stable supramolecular solvent.

[0020] Optionally, the eutectic solvent is diluted with deionized water to obtain eutectic solvents with different water contents, wherein the water content is a mass percentage.

[0021] Preferably, the weight ratio of the extraction solvent to the crude powder of Ampelopsis lanceolata leaves is (10-30):1; and / or, the temperature of the ultrasonic extraction is 50-70℃; and / or, the time of the ultrasonic extraction is 30-60 min; and / or, the frequency of the ultrasonic extraction is 40-80 kHz; and / or, the number of extractions is 1-3.

[0022] The inventors discovered in their research that the water-insoluble flavonoids in *Ampelopsis grossedentata* leaf extract, such as resveratrol and dihydromyricetin, change when prepared using different extraction methods. Consequently, the efficacy of anti-heat aging skincare compositions varies when *Ampelopsis grossedentata* leaf extracts prepared using different extraction methods are added. When the preparation method described above is selected, adding *Ampelopsis grossedentata* leaf extract extracted using the specific extraction method described above to the composition can improve the transdermal absorption of the composition, thereby achieving better anti-heat aging efficacy, while reducing irritation and improving the safety and stability of the composition.

[0023] In addition, this application provides the use of the aforementioned heat-resistant skin care composition in the preparation of skin products.

[0024] Furthermore, the present invention provides a skin product comprising the aforementioned anti-heat aging skincare composition. Preferably, the skin product comprises any one of a toner, lotion, cream, lotion, mask, serum, or spray.

[0025] Furthermore, this application provides a skin product comprising the aforementioned heat-resistant skincare composition.

[0026] Preferably, the skin care product comprises the following components by weight percentage: 1-5% heat-resistant skin care composition, 2-40% cosmetic matrix, and the balance being water.

[0027] Preferably, the cosmetic base includes at least one of a thickener, a moisturizer, an emulsifier, a preservative, a fragrance, and a pH adjuster.

[0028] Preferably, the skin care product comprises the following components in weight percentage: 0.05-0.3 parts thickener, 0.5-1 parts moisturizer, 0.01-0.3 parts pH adjuster, 0.5-6 parts emulsifier, 0.5-3 parts preservative, 1-5 parts of the heat-resistant skin care composition, and the balance being deionized water.

[0029] Exemplarily, it includes at least one of the following (a)-(e): (a) The thickener comprises at least one of the following: polyacrylate crosspolymer-6, carbomer, carrageenan, gellan gum, xanthan gum, scutellaria baicalensis gum, guar gum, ammonium acryloyl dimethyl taurate / VP copolymer, acrylate copolymer, and sclerotium tsulphureus gum; (b) The moisturizer includes at least one of glycerin, D-panthenol, vitamin B5, 1,3-butanediol, 1,2-hexanediol, 1,3-propanediol, caprylyl glycol, dipropylene glycol, sodium hyaluronate, tremella polysaccharide, trehalose, betaine, allantoin, sodium hyaluronate, and ceramide. (c) The pH adjuster includes at least one of arginine, tromethamine, and disodium EDTA; (d) The emulsifier comprises at least one of the following: caprylic / capric triglyceride, C14-22 alcohol, polyglycerol 10-oleate, C12-20 alkyl glucoside, cetearyl glucoside, isononyl isononanoate, pentaerythritol tetraester, polydimethylsiloxane, stearyl alcohol, hydroxystearic acid, polymethylsilsesquioxane, pentaerythritol distearate, and sucrose stearate; (e) The preservatives include at least one of p-hydroxyacetophenone and polyols.

[0030] Compared to existing technologies, the beneficial effects of this application are as follows: The three components of this invention—Camellia chrysantha flower extract, Ampelopsis japonica leaf extract, and Andrographis paniculata leaf extract—can directly inhibit heat stress, thereby improving heat aging; β-glucan indirectly improves heat aging by strengthening the skin barrier function and reducing secondary damage and persistent inflammation caused by external heat stimulation. Simultaneously, the four components of this invention work synergistically, acting from multiple dimensions—signal source, catalytic process, inflammation amplification, and barrier protection—significantly downregulating ET-1 / MITF axis signal transduction, thus achieving unexpected skin brightening and anti-dullness effects that cannot be achieved by using any single component alone. Attached Figure Description

[0031] Figure 1 To show the improvement in under-eye wrinkles and facial brightness after 0 days and 14 days for Application Example 1 and Comparison Example 1. Detailed Implementation

[0032] To better illustrate the purpose, technical solution, and advantages of this application, the following description, in conjunction with the accompanying drawings and specific embodiments, will further explain this application. The purpose is to provide a detailed understanding of the content of this application, not to limit it. All other embodiments obtained by those skilled in the art without inventive effort are within the scope of protection of this application. Unless otherwise specified, the experimental reagents and instruments involved in the implementation and comparative examples of this application are all commonly used reagents and instruments, and are commercially available. Unless otherwise specified, the experimental methods used in the implementation and comparative examples are conventional methods; and unless otherwise specified, the raw materials used in parallel experiments are from the same batch.

[0033] The raw materials of this invention will now be further described, but are not limited to the following raw materials: Camellia chrysantha flower extract: purchased from Shenzhen Viki Technology Co., Ltd., trade name Camellia chrysantha flower extract; Andrographis paniculata leaf extract: purchased from Suzhou Nacon Biotechnology Co., Ltd., product name SupraBiome TM AP; β-glucan-1: Oat β-glucan, number average molecular weight 60,000 Da, purchased from Miaosen Co., Ltd., trade name Miaokexiu; β-glucan-2: oat β-glucan, with a number average molecular weight of 200,000 Da, purchased from Shaanxi Zelang Biotechnology Co., Ltd.; β-glucan-3: schizophyllin, with a number average molecular weight of 200,000 Da, purchased from Purui Biomedical Technology Co., Ltd.

[0034] β-glucan-4: Yeast β-glucan, with a number average molecular weight of 300,000 Da, purchased from Angel Yeast Co., Ltd.

[0035] Camellia extract: purchased from Clariant, under the brand name RedSnow TM .

[0036] Green tea extract: Purchased from Xi'an Lvtian Biotechnology Co., Ltd., under the trade name Green Tea Extract.

[0037] Myrtle fruit extract: purchased from GREENETECH, product name:

[0038] Amaryllis Leaf Extract-1: The preparation method is as follows: Take cleaned Amaryllis leaves, dry and pulverize them in a 60℃ oven, and pass them through a 40-mesh sieve to obtain Amaryllis leaf coarse powder. Then, add eutectic solvent-1 for ultrasonic extraction, filter, concentrate and dry the extract to obtain Amaryllis leaf extract; the weight ratio of the eutectic solvent to the Amaryllis leaf coarse powder is 15:1; the ultrasonic extraction time is 30 min, the ultrasonic extraction temperature is 50℃, the ultrasonic extraction frequency is 50 kHz, and the extraction is performed twice.

[0039] Ampelopsis leaf extract-2: prepared in-house, the only difference from Ampelopsis leaf extract-1 is that the extraction solvent is eutectic solvent-2.

[0040] Ampelopsis leaf extract-3: prepared in-house, the only difference from Ampelopsis leaf extract-1 is that the extraction solvent is eutectic solvent-3.

[0041] Ampelopsis leaf extract-4: prepared in-house, the only difference from Ampelopsis leaf extract-1 is that the extraction solvent is eutectic solvent-4.

[0042] Ampelopsis leaf extract-5: prepared in-house, the only difference from Ampelopsis leaf extract-1 is that the extraction solvent is eutectic solvent-5.

[0043] Ampelopsis leaf extract-6: prepared in-house, the only difference from Ampelopsis leaf extract-1 is that the extraction solvent is eutectic solvent-6.

[0044] Ampelopsis leaf extract-7: prepared in-house, the only difference from Ampelopsis leaf extract-1 is that the extraction solvent is eutectic solvent-7.

[0045] Ampelopsis leaf extract-8: prepared in-house, the only difference from Ampelopsis leaf extract-1 is that the extraction solvent is eutectic solvent-8.

[0046] Ampelopsis leaf extract-9: prepared in-house, the only difference from Ampelopsis leaf extract-1 is that the extraction solvent is eutectic solvent-9.

[0047] Ampelopsis leaf extract-10: prepared in-house, the only difference from Ampelopsis leaf extract-1 is that the extraction solvent is a 60% (v / v) aqueous ethanol solution.

[0048] The composition and ratio of the eutectic solvent are selected as shown in Table 1. The preparation method of the eutectic solvent is as follows: the hydrogen bond donor and the hydrogen bond acceptor are stirred at 70°C in proportion until a clear and transparent eutectic liquid is formed. Then, a specified amount of deionized water is added for dilution to obtain a homogeneous and stable eutectic solvent.

[0049] Table 1 Examples and Comparative Examples The present invention provides a skin care composition for anti-heat aging in the embodiments and comparative examples. Among them, the skin care compositions for anti-heat aging prepared in Examples 1-10 differ only in the selection of the type of Aeonium lancifolium leaf extract; Examples 11-12 differ from Example 1 only in the selection of β-glucan; Examples 13-16 differ from Example 1 only in the selection of the weight parts, as shown in Table 2; the components and weight parts of the comparative examples are shown in Table 3, and the comparative examples are compared with Example 1.

[0050] The method for preparing the anti-heat aging skincare composition includes the following steps: mixing each component evenly to obtain the anti-heat aging skincare composition.

[0051] Example 1 This invention provides a skin care composition for resisting heat aging, comprising the following ingredients in parts by weight: 1.5 parts of Camellia chrysantha flower extract, 0.25 parts of Ampelopsis japonica leaf extract-1, 0.25 parts of Andrographis paniculata leaf extract, and 0.8 parts of β-glucan-1.

[0052] Example 2 This invention provides a skin care composition for resisting heat aging. Compared with Example 1, the only difference is the type of Amorphophallus dentata leaf extract selected, which is Amorphophallus dentata leaf extract-2.

[0053] Example 3 This invention provides a skin care composition for resisting heat aging. Compared with Example 1, the only difference is the type of Amorphophallus dentata leaf extract selected, which is Amorphophallus dentata leaf extract-3.

[0054] Example 4 This invention provides a skin care composition for resisting heat aging. Compared with Example 1, the only difference is the selection of the type of Amorphophallus dentata leaf extract, which is Amorphophallus dentata leaf extract-4.

[0055] Example 5 This invention provides a skin care composition for resisting heat aging. Compared with Example 1, the only difference is the type of Amorphophallus dentata leaf extract selected, which is Amorphophallus dentata leaf extract-5.

[0056] Example 6 This invention provides a skin care composition for resisting heat aging. Compared with Example 1, the only difference is the type of Amorphophallus dentata leaf extract selected, which is Amorphophallus dentata leaf extract-6.

[0057] Example 7 This invention provides a skin care composition for resisting heat aging. Compared with Example 1, the only difference is the type of Amorphophallus dentata leaf extract selected, which is Amorphophallus dentata leaf extract-7.

[0058] Example 8 This invention provides a skin care composition for resisting heat aging. Compared with Example 1, the only difference is the type of Amorphophallus dentata leaf extract selected, which is Amorphophallus dentata leaf extract-8.

[0059] Example 9 This invention provides a skin care composition for resisting heat aging. Compared with Example 1, the only difference is the type of Amorphophallus dentata leaf extract selected, which is Amorphophallus dentata leaf extract-9.

[0060] Example 10 This invention provides a skin care composition for resisting heat aging. Compared with Example 1, the only difference is the type of Amorphophallus dentata leaf extract selected, which is Amorphophallus dentata leaf extract-10.

[0061] Example 11 This invention provides a skin care composition for resisting heat aging. Compared with Example 1, the only difference is the choice of β-glucan, which is β-glucan-2.

[0062] Example 12 This invention provides a skin care composition for resisting heat aging. Compared with Example 1, the only difference is the choice of β-glucan, which is β-glucan-3.

[0063] Table 2 Table 3 Application examples and comparative application examples Application Examples 1-18, Comparative Application Examples 1-11, and Blank Application Examples of the present invention provide serums containing anti-heat aging skincare compositions, the components (mass percentage) of which are shown in Table 4. The anti-heat aging skincare compositions used in Application Examples 1-16 are the anti-heat aging skincare compositions prepared in Examples 1-16, and the anti-heat aging skincare compositions used in Comparative Application Examples 1-11 are the anti-heat aging skincare compositions prepared in Comparative Examples 1-11. For example, the anti-heat aging skincare composition used in Application Example 1 is the anti-heat aging skincare composition prepared in Example 1; the anti-heat aging skincare composition used in Application Example 2 is the anti-heat aging skincare composition prepared in Example 2; the anti-heat aging skincare composition used in Comparative Application Example 1 is the anti-heat aging skincare composition prepared in Comparative Example 1, and so on.

[0064] The anti-heat aging skincare composition used in Application Examples 17-18 is the anti-heat aging skincare composition prepared in Example 1.

[0065] Table 4 The preparation method of the serum provided in Application Example 1 is as follows: (1) Mix the humectant, thickener and part of the pH adjuster (EDTA-disodium) with water and stir. Heat to 85°C and homogenize at 1300 rpm for 4 min. After homogenization, keep warm for later use to obtain pre-prepared component A. (2) Mix the emulsifier, heat to 75°C, and homogenize at 1300 rpm for 4 min. After homogenization, keep warm for later use to obtain the pre-prepared component B. (3) Mix the preservatives and heat to 60°C to melt them to obtain pre-prepared component C; (4) Heat the pre-prepared component A to 80°C, add the pre-prepared component B at 300 rpm and stir to mix. Then cool down to 60°C and add the pre-prepared component C at 300 rpm and stir to mix. Then cool down to below 45°C and add the anti-heat aging skin care composition and continue stirring for 8 minutes. Finally, add the remaining pH adjuster (arginine) to adjust the pH to 5.5-7.0, then stop stirring, discharge the product, and obtain the essence.

[0066] The preparation methods for the serums provided in the other application examples, comparative application examples, and blank application examples are consistent with those in application example 1. If the relevant components are not available, they can be omitted.

[0067] Performance Test - 1: The composition inhibits high-temperature-induced neuroinflammation and dullness in keratinocytes. High temperatures induce the activation of the keratinocyte stimulation signal TRPV1 and the production of the melanin-stimulating factor endothelin-1 (ET-1). Therefore, after sample treatment, lower TRPV1 expression and lower ET-1 levels indicate stronger resistance to heat stress.

[0068] Test substance preparation: The composition (Examples 1-16, Comparative Examples 1-11) was diluted with cell culture medium to a concentration of 0.01% by mass, and recorded as the sample solution, and refrigerated; The cell line used in this invention is human keratinocyte HaCaT (provided by Guangzhou Customs Testing Center). Cells were cultured and treated according to groupings, and then the expression of TRPV1 and the content of ET-1 were detected. The testing methods are as follows: (1) Inoculate the cell suspension into culture flasks at a density of 1×10⁶ cells / year. 6Cells / mL, using DMEM high glucose culture medium (Gibco) containing 10% fetal bovine serum, incubated at 37±1℃, saturated humidity, and 5±1% carbon dioxide for 24h; (2) Control group cells contained DMEM high glucose culture medium containing 10% fetal bovine serum, and sample groups were added with sample solution prepared by the example or comparative example and DMEM high glucose culture medium containing 10% fetal bovine serum, respectively, incubated at 42±1℃, saturated humidity, and 5±1% carbon dioxide for 48h and then the cells were collected; (3) TRPV1 expression assay: Total RNA was extracted from HaCaT cells in each group using the TRIzol method; cDNA was synthesized via reverse transcription using the TaKaRa reverse transcription kit (total reaction volume: 20 μL); real-time RT-PCR was performed on a CFX96 microarray. TM The PCR was performed on a real-time system (Bio-Rad, USA); the PCR conditions were as follows: 95°C pre-denaturation for 30 seconds, followed by 40 cycles, each cycle consisting of 95°C denaturation for 5 seconds, 60°C annealing for 30 seconds, and 72°C extension for 45 seconds; GAPDH was used as an internal control gene, and the relative expression level of each gene was calculated using 2... -ΔΔCT The method was used to calculate the primer sequences, which are shown in Table 5. Table 5 Primer sequences Gene Primer sequence (5'→3') TRPV1-F CTGGACCTGGTCAACCTCAT TRPV1-R GATGGGGATCTTGGTGTCAG GAPDH-F GAGTCAACGGATTTGGTCGT GAPDH-R TTGATTTTGGAGGGATCTCG (4) Endothelin ET-1 content determination: Human endothelin (ET-1) ELISA kit (Jianglai Biotechnology, catalog number JL11995) was used for detection.

[0069] TRPV1 inhibition rate (%) = (1 - TRPV1 sample group / TRPV1 control group) × 100%; ET-1 inhibition rate (%) = (1 - ET-1 sample group / ET-1 control group) × 100%.

[0070] The results are shown in Table 6: Table 6 Group TRPV1 inhibition rate / % ET-1 inhibition rate / % Example 1 72.3 53.9 Example 2 58.3 29.4 Example 3 56.1 30.7 Example 4 65.1 48.2 Example 5 64.5 48.5 Example 6 71.6 52.8 Example 7 68.1 49.9 Example 8 60.3 38.5 Example 9 58.2 37.1 Example 10 48.6 21.1 Example 11 72.1 53.6 Example 12 71.9 52.9 Example 13 71.6 53.7 Example 14 55.7 28.0 Example 15 54.6 27.5 Example 16 65.4 41.3 Comparative Example 1 21.3 1.4 Comparative Example 2 29.1 5.3 Comparative Example 3 28.6 4.2 Comparative Example 4 32.1 8.9 Comparative Example 5 40.8 13.7 Comparative Example 6 41.0 13.3 Comparative Example 7 42.2 14.2 Comparative Example 8 35.2 7.5 Comparative Example 9 38.4 10.5 Comparative Example 10 36.8 9.7 Comparative Example 11 39.3 12.1 As shown in the table above, the anti-heat aging skincare compositions prepared in the embodiments of the present invention have an inhibition rate of ≥45% against TRPV1 and an inhibition rate of ≥20% against ET-1. The anti-heat aging skincare compositions prepared in this embodiment all have strong resistance to heat stress.

[0071] As can be seen from the comparison of Examples 1-10, when different extraction methods are used to prepare the extract of Ampelopsis lanceolata leaf and it is added to the anti-heat aging skin care composition, the efficacy of the resulting anti-heat aging skin care composition will vary. In particular, the choice of extraction solvent and the water content during the extraction process have a significant impact. When a eutectic solvent with betaine as the hydrogen bond acceptor and dipropylene glycol as the hydrogen bond donor is used, and / or the water content of the eutectic solvent is 30-60%, the anti-heat stress effect is better.

[0072] As can be seen from the comparison between Examples 1 and Examples 11-12, when the β-glucan is at least one of oat β-glucan and schizophyllin, the molecular weight has little effect on the effect of resisting heat stress.

[0073] As can be seen from the comparison of Examples 1 and 13-16, the components and their weight parts in the composition have a significant impact on the heat stress resistance of the product. When the content of Camellia chrysantha flower extract 1-3 parts, Alopecurus aureus leaf extract 0.1-0.3 parts, Andrographis paniculata leaf extract 0.1-0.3 parts, and β-glucan 0.5-1 parts is met, the heat stress resistance effect is better.

[0074] As can be seen from the comparison of Example 1 and Comparative Examples 1-11, the heat stress resistance effect of the present invention cannot be achieved when one of them is not added, or when the mass fraction of one component is added to another component without adding one component, or when other components are used to replace specific components in the present invention.

[0075] The total weight of the compositions in Comparative Examples 5-7 remained unchanged. The absence of one of the components resulted in a lower inhibition rate of ET-1, although the inhibition rate of TRPV1 was ≥40%. The specific four components of this invention exhibit a special effect of inhibiting ET-1 in a specific ratio. The components work synergistically with each other and none of them can be omitted.

[0076] Performance Test-2: The composition inhibits heat-induced collagen loss in dermal cells. When skin temperature exceeds 40°C, the activity of matrix metalloproteinases (MMPs) surges, directly breaking down type I and type III collagen and elastin fibers in the dermis, causing the skin to lose its support and form wrinkles. Therefore, after sample treatment, a lower MMP-1 content indicates a stronger resistance to thermal aging.

[0077] Test substance preparation: The compositions (Examples 1-16, Comparative Examples 1-11) were diluted with cell culture medium to a concentration of 0.1% by mass, and this was recorded as the sample solution. The solution was then refrigerated. The cells used in this invention are human skin fibroblasts (HSF) (provided by Guangzhou Customs Testing Center). Cells were cultured and processed according to groupings, and then the MMP-1 content was detected using the following methods: (1) Inoculate the cell suspension into culture flasks at a density of 1×10⁶ cells / year. 6 Cells / mL, using DMEM high glucose culture medium (Gibco) containing 10% fetal bovine serum, incubated at 37±1℃, saturated humidity, and 5±1% carbon dioxide for 24h; (2) Control group cells contained DMEM high glucose culture medium containing 10% fetal bovine serum, and the sample groups were added with 200μL of sample solution containing 0.1% of the example or comparative example and DMEM high glucose culture medium containing 10% fetal bovine serum, respectively, incubated at 42±1℃, saturated humidity, and 5±1% carbon dioxide for 48h and then the cells were collected; (3) MMP-1 content determination: Cells were lysed according to the kit instructions (Shanghai Enzyme-Linked Biotechnology, catalog number: ml038199), and the supernatant was collected. The absorbance at 450 nm was measured by ELISA, and the MMP-1 concentration (pg / mL) was calculated.

[0078] MMP-1 inhibition rate (%) = (1 - MMP-1 sample group / MMP-1 control group) × 100%.

[0079] The results are shown in Table 7. Table 7 Group MMP-1 inhibition rate / % Example 1 83.8 Example 2 67.1 Example 3 65.9 Example 4 79.8 Example 5 78.6 Example 6 83.9 Example 7 80.7 Example 8 70.3 Example 9 68.1 Example 10 58.9 Example 11 83.8 Example 12 82.9 Example 13 83.6 Example 14 62.7 Example 15 60.6 Example 16 73.6 Comparative Example 1 21.0 Comparative Example 2 17.9 Comparative Example 3 24.0 Comparative Example 4 27.1 Comparative Example 5 38.4 Comparative Example 6 37.3 Comparative Example 7 39.2 Comparative Example 8 33.2 Comparative Example 9 30.1 Comparative Example 10 34.2 Comparative Example 11 36.3 As shown in the table above, the anti-heat aging skincare composition prepared in the embodiments of the present invention has an inhibition rate of ≥50% against MMP-1. All the anti-heat aging skincare compositions prepared in this embodiment have the ability to inhibit the reduction of collagen in dermal cells induced by high temperature and have the ability to resist heat aging.

[0081] As can be seen from the comparison of Examples 1-10, when different extraction methods are used to prepare the extract of *Ampelopsis grossedentata* leaf and it is added to the anti-heat aging skin care composition, the efficacy of the resulting anti-heat aging skin care composition will vary. In particular, the choice of extraction solvent and the water content during the extraction process have a significant impact. When a eutectic solvent with betaine as the hydrogen bond acceptor and dipropylene glycol as the hydrogen bond donor is used, and / or the water content of the eutectic solvent is 30-60%, the ability to inhibit high temperature-induced collagen loss in dermal cells is stronger, and the ability to resist heat aging is better.

[0082] As can be seen from the comparison of Examples 1 and 11-12, when the β-glucan is at least one of oat β-glucan and schizophyllin, the molecular weight has little effect on the ability to inhibit the reduction of collagen in dermal cells induced by high temperature.

[0083] As can be seen from the comparison of Examples 1 and 13-16, the components and weight parts of the composition have a significant impact on the ability to inhibit the reduction of collagen in dermal cells induced by high temperature. When the content of Camellia chrysantha flower extract 1-3 parts, Alopecurus aureus leaf extract 0.1-0.3 parts, Andrographis paniculata leaf extract 0.1-0.3 parts, and β-glucan 0.5-1 parts is met, the anti-heat stress effect is better.

[0084] As can be seen from the comparison of Example 1 and Comparative Examples 1-11, when one of them is not added, or when the mass fraction of one component is added to another component without adding one component, or when other components are used to replace the specific components in this invention, the effect of this invention in inhibiting the reduction of dermal cell collagen induced by high temperature cannot be achieved, and it cannot resist heat aging.

[0085] Performance Testing - 3 Application Experiments 1. Experimental basis The human efficacy evaluation test method shall be followed in accordance with the "Cosmetic Safety Technical Specifications" (2015 edition).

[0086] 2. Subject selection and inclusion criteria: Asian adult volunteers aged 25-40 years are recruited, with a facial nasolabial fold lactate test score ≥3 and self-reported as having sensitive skin, and no history of serious systemic diseases or skin diseases. Excluded are pregnant / lactating women, those with severe allergies, and those who have participated in other clinical trials within the past 3 months. The test will be conducted in Guangzhou in July.

[0087] Number of participants: A total of 90 qualified volunteers were included and randomly divided into 30 groups of 3 people each.

[0088] 3. Sample application method Test samples: serums prepared from application examples 1-18, comparative application examples 1-11, and blank application examples.

[0089] How to use: After cleansing in the morning and evening, volunteers should take 1mL of the sample and apply it evenly to the entire face, gently massaging until fully absorbed.

[0090] 4. Testing Cycle and Process Test period: 14 days (D0 to D14).

[0091] Visit time points: Instrument testing was conducted at D0 (baseline period) and D14 (end of the test).

[0092] Preparation before testing: a) After the participants arrived, they used a uniform, non-irritating facial cleanser to clean their faces; b) Rest for 30 minutes in a constant temperature and humidity environment (temperature 21±1℃, humidity 50±10%); c) Keep your eyes closed and relax during the test to avoid facial expressions and movements that may interfere with the process.

[0093] 5. Testing Instruments and Detection Indicators Before testing, the instruments were calibrated to standard parameters. Researchers used the CK GL200 skin gloss test probe to measure the gloss of the cheekbones; and used the Tewameter™ Hex transepidermal water loss meter to measure the transepidermal water loss (TEWL) value at the cheekbone location. VISIA-CR was used to photograph and analyze the volunteers' under-eye wrinkles and facial redness. During the test, probe pressure and measurement time were kept constant, and measurements were repeated three times at the same location, with the average value taken.

[0094] The brightening effect of the samples is represented by the improvement in radiance; the skin barrier effect is represented by the improvement in TEWL value; the fine line reduction effect is represented by the improvement in the number of fine lines under the eyes; and the soothing effect is represented by the improvement in the area of ​​facial redness. The formulas are as follows: Facial improvement rate (%) = |(D14 value - D0 value) / D0 value| × 100%; The results are shown in Table 8.

[0095] Table 8 As shown in the table above, the anti-heat aging skincare composition prepared in the embodiments of the present invention, after being prepared into an essence, achieved unexpected skin brightening and anti-dullness effects. At the same time, the skincare composition prepared in the present invention, after being prepared into an essence, also has excellent anti-wrinkle and skin barrier repair effects. The skincare composition prepared in the present invention, after being prepared into an essence, has the ability to resist heat aging. Figure 1 To show the improvement in under-eye wrinkles and facial brightness after 0 days and 14 days for Application Example 1 and Comparison Example 1.

[0096] As can be seen from the comparison of Application Examples 1-10, when different extraction methods are used to prepare the extract of Ampelopsis thunbergii leaf and it is added to the anti-heat aging skin care composition, the efficacy of the resulting anti-heat aging skin care composition after being prepared into an essence will vary. In particular, the choice of extraction solvent and the water content during the extraction process have a significant impact. When a eutectic solvent with betaine as the hydrogen bond acceptor and dipropylene glycol as the hydrogen bond donor is used, and / or the water content of the eutectic solvent is 30-60%, the skin brightening and anti-dullness effects are better.

[0097] As can be seen from the comparison of Application Example 1 and Application Examples 11-12, when the β-glucan is at least one of oat β-glucan and schizophyllin, the molecular weight has little effect on the skin brightening and anti-dullness effects, but will affect the skin barrier improvement effect.

[0098] As can be seen from the comparison of Application Examples 1 and 13-16, the components and weight parts of the composition have a significant impact on the ability to inhibit high temperature-induced collagen loss in dermal cells. When the content of 1-3 parts of Camellia chrysantha flower extract, 0.1-0.3 parts of Ampelopsis japonica leaf extract, 0.1-0.3 parts of Andrographis paniculata leaf extract, and 0.5-1 parts of β-glucan is met, the skin brightening, anti-dullness effect and skin barrier repair effect are better, and the ability to resist heat aging is also improved.

[0099] As can be seen from the comparison of Application Example 1 and Comparative Application Examples 1-11, when one of them is not added, or when the mass fraction of one component is added to another component without adding one component, or when other components are used to replace the specific components in this invention, the skin brightening, anti-dullness and skin barrier repair effects of this invention cannot be achieved, and the heat aging resistance cannot be resisted.

[0100] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of this application and are not intended to limit the scope of protection of this application. Although this application has been described in detail with reference to preferred embodiments, those skilled in the art should understand that modifications or equivalent substitutions can be made to the technical solutions of this application without departing from the substance and scope of the technical solutions of this application.

Claims

1. A skincare composition for resisting heat aging, characterized in that, It includes the following ingredients in parts by weight: Camellia chrysantha flower extract 0.1-5 parts, Amorphophallus dentata leaf extract 0.05-1 part, Andrographis paniculata leaf extract 0.01-1 part, and β-glucan 0.1-3 parts.

2. The skincare composition for resisting heat aging as described in claim 1, characterized in that, It includes the following ingredients in parts by weight: 1-3 parts Camellia chrysantha flower extract, 0.1-0.3 parts Ampelopsis japonica leaf extract, 0.1-0.3 parts Andrographis paniculata leaf extract, and 0.5-1 parts β-glucan.

3. The skincare composition for resisting heat aging as described in claim 1, characterized in that, The mass percentage of the *Ampelopsis grossedentata* leaf extract is 4-10% based on the total mass of the anti-heat aging skincare composition.

4. The anti-heat aging skincare composition as described in claim 1, characterized in that, The β-glucan content is 15-30% by weight of the total mass of the anti-heat aging skin care composition.

5. The skincare composition for resisting heat aging as described in claim 1, characterized in that, The preparation method of the Amaranthus macranthum leaf extract includes the following steps: taking Amaranthus macranthum leaves, drying and pulverizing them, and sieving them to obtain Amaranthus macranthum leaf coarse powder; then adding a eutectic solvent for ultrasonic extraction, filtering, concentrating and drying the extract to obtain Amaranthus macranthum leaf extract.

6. The anti-heat aging skincare composition as described in claim 5, characterized in that, The hydrogen bond acceptor of the eutectic solvent is at least one of betaine, sodium PCA, and panthenol; the hydrogen bond donor of the eutectic solvent is at least one of dipropylene glycol, 1,3-propanediol, and glycerol polyether-26; the weight ratio of the hydrogen bond acceptor to the hydrogen bond donor is 1:(1-3). And / or, the water content of the eutectic solvent is 30-60%.

7. The anti-heat aging skincare composition as described in claim 5, characterized in that, The weight ratio of the eutectic solvent to the crude powder of *Ampelopsis grossedentata* leaves is (10-30):1; And / or, the ultrasonic extraction temperature is 50-70℃; and / or, the ultrasonic extraction time is 30-60 min; And / or, the frequency of the ultrasonic extraction is 40-80 kHz; And / or, the number of extractions is 1-3 times.

8. The use of an anti-heat aging skincare composition as described in any one of claims 1-7 in the preparation of skin products.

9. A skin care product, characterized in that, The skin products include the anti-heat aging skin care compositions as described in any one of claims 1-7.

10. The skin product as described in claim 9, characterized in that, The skin care product comprises the following components by weight percentage: 1-5% heat-resistant skin care composition, 2-40% cosmetic base, and the balance being water.

Images