Percutaneous absorption composite microsphere as well as preparation method and application thereof

Abstract

The invention relates to the technical field of biological materials, and discloses a transdermal absorption composite microsphere as well as a preparation method and application thereof. The preparation method comprises the following steps: adding poly-desoxyribonucleic acid into water, stirring and mixing to obtain a poly-desoxyribonucleic acid aqueous solution; diluting a silk material solution, stirring and mixing the silk material solution with an aqueous solution of polydesoxyribonucleic acid, adding an aqueous solution of polylysine to obtain a composite solution system, and stirring and mixing to obtain an aqueous solution containing the composite microspheres; in the scheme, the composite microsphere with a clear structure and a specific function is prepared through automatic compression by utilizing the supermolecular interaction between the PDRN and the silk material and the property of facilitating folding with the PDRN, the preparation method is simple, and the application method is simpler.

Description

TECHNICAL FIELD

[0001] The application relates to the technical field of biological materials, belongs to the field of A61L, and discloses a transdermal absorption composite microsphere as well as a preparation method and application thereof. BACKGROUND

[0002] Microspheres are an important preparation form, and a microsphere carrier prepared from biodegradable polymer materials can realize efficient encapsulation and controlled release of macromolecular active ingredients. Meanwhile, the microsphere carrier has excellent adhesion and stability on the surface of the skin, can continuously release the active ingredients, enhances the skin barrier repair function, and is suitable for medical dressings and high-end cosmetics and the like.

[0003] Macromolecular components such as hyaluronic acid (HA), various proteins and their derivative materials, and polydeoxyribonucleic acid (PDRN) are difficult to be absorbed transdermally when directly applied to the skin, thereby affecting the exertion of their efficacy. When the transdermal absorption problem is solved through a preparation technology at present, other auxiliary ingredient components are introduced, resulting in problems such as cost increase, large molecular particle size, and influence on safety.

[0004] In the prior art, CN114642606A discloses a composition with skin barrier repair function, which comprises: 0.01-0.5% of high molecular weight hyaluronic acid or a salt thereof, 0.1-1.0% of hydrolyzed hyaluronic acid or a salt thereof, 0.01-10% of silk fibroin, 0.05-1% of polydeoxyribonucleic acid, and 0.1-10% of bovine growth factor. In the preparation, the raw materials are first premixed, and then mixed and emulsified with a solubilizing agent. The high molecular weight hyaluronic acid and the solubilizing agent form a stable emulsion system after homogenization, and do not separate into layers. The finished product prepared has good lipophilicity, and forms a stable hydrogel-liposome. The volume of the hydrogel-liposome obtained in the technology is still large, and other auxiliary ingredient components such as a solubilizing agent are introduced in the formula, so that the safety factor is obviously reduced.

[0005] If the transdermal absorption problem is not solved through a preparation technology, the macromolecular self-assembly microspherization technology can be considered. However, the macromolecule has a large volume and is difficult to compress. For example, CN119978449A discloses a silk fibroin elastic porous microsphere with adjustable particle size as well as a preparation method and application thereof. The diameter of the porous microsphere is 20 μm-1 mm. The microsphere prepared by the invention is a rigid microsphere, has chemical inertness and low biocompatibility, cannot realize controlled release delivery of effective components, and is not conducive to transdermal absorption.

[0006] Further, the microspherization technology of multiple macromolecular components is more complex and more difficult to microsphere than a single macromolecule due to the mutual influence between macromolecules. For example, CN120204480A discloses an injectable sodium hyaluronate-silk fibroin composite hydrogel and its preparation method and application, which is composed of sodium hyaluronate composite gel particles and sodium hyaluronate solution. The sodium hyaluronate composite gel particles are composed of silk fibroin sponge microspheres and sodium hyaluronate gel particles, and the silk fibroin sponge microspheres are loaded on the sodium hyaluronate gel particles. The silk fibroin sponge microspheres are prepared by physical crosslinking method, and the obtained product is also a rigid microsphere with a particle size of D50 of 10-30 μm and D90 of less than 100 μm. It also contains sodium hyaluronate gel particles with a particle size of D50 of 150-300 μm and D90 of less than 800 μm. The particle size can be applied to injection products, but when used for direct application, it is obviously unable to achieve the effect of transdermal absorption.

[0007] In the prior art "Construction of multifunctional composite microparticles and its application in diabetic wound healing" (Li Xiaoming. Construction of multifunctional composite microparticles and its application in diabetic wound healing [D]. Beijing: Beijing University of Chemical Technology, 2023), silk fibroin solution is mixed with polylysine solution, then polylysine is used to modify silk fibroin, and then silk fibroin-polylysine composite microsphere powder is obtained by separation in organic volatile solvent. Then, PDRN is added for treatment by electrostatic adsorption. In fact, the microsphere structure is obtained by simple electrostatic adsorption and layer-by-layer assembly. As can be observed from the electron microscope results, the microsphere structure obtained by electrostatic adsorption is a silk fibroin and polylysine ball, and a layer of PDRN is adsorbed on the surface of the ball. The electron microscope results can directly show that the periphery of the silk fibroin ball is coated with a layer of PDRN structure. Due to the existence of the peripheral adsorption structure, the transdermal absorption performance still needs to be improved. At the same time, the mass concentration ratio of silk fibroin to polylysine in the reference is 3:7-3:42, and alcohol precipitation in ethanol solution is needed to form microspheres. The use of organic solvents is not conducive to simpler and wider range of applications.

[0008] In summary, it is of great significance to research a composite microsphere which does not rely on organic solvents or various preparations, raw materials and preparation processes, has good transdermal absorption and can be directly applied for absorption, and a preparation method thereof. SUMMARY

[0009] The present application aims to provide a silk fibroin composite microsphere for transdermal absorption, a preparation method and application, to solve the problems raised in the background art.

[0010] To solve the above technical problems, the present application provides the following technical solutions: The application discloses a preparation method of a transdermal absorption composite microsphere, and comprises the following steps: under the action of polylysine, silk material and polydeoxyribonucleic acid are mutually penetrated, intertwined and folded and compressed to obtain the composite microsphere. The mass ratio of the silk material to the polylysine is 1:(0.006-0.2), the mass ratio of the silk material to the polydeoxyribonucleic acid is 1:(1-10), and the mass ratio of the polylysine to the polydeoxyribonucleic acid is 1:(5-150).

[0011] Preferably, the particle size of the composite microsphere is 50-500 nm.

[0012] Preferably, the silk material comprises at least one of silk fibroin, hydrolyzed silk fibroin, hydrolyzed silk, and silk amino acids.

[0013] Preferably, the silk material is silk fibroin.

[0014] The silk fibroin in the application is also called silk protein or silk fibroin, and is a main component in natural silk protein fibers; the reason why the silk fibroin is selected to prepare the transdermal absorption silk fibroin composite microsphere together with PDRN is that there are deoxyribose, phosphate groups and various base structures in the PDRN molecules, and the PDRN molecules have negative electricity; and in the amino acid sequence of the silk fibroin, there are a large number of lysine (K), glycine (G), proline (P), histidine (H) and arginine (R) amino acid molecules, and these amino acid molecules have strong intermolecular forces with the PDRN. On this basis, it is obtained through molecular docking calculation simulation that there is a supramolecular interaction between the PDRN and the silk fibroin, and the interaction force between the PDRN and the silk fibroin is-4.21 kcal / mol; from the perspective of molecular docking calculation simulation, it is generally considered that if the value is lower than-0.6 kcal / mol, it is considered that there is an interaction between the two molecules; in the application, the supramolecular interaction between the PDRN and the silk fibroin is utilized, so that the silk fibroin and the polydeoxyribonucleic acid are arranged and combined spontaneously and orderly under the driving of non-covalent interaction through a reversible dynamic process, and finally reach a thermodynamic equilibrium state, to form a flexible microsphere with a clear structure and specific functions, the particle size is small, and the preparation process is simple and does not contain organic solvents.

[0015] Preferably, the polylysine comprises at least one of basic polylysine and modified polylysine.

[0016] Preferably, the polylysine is a basic amino acid.

[0017] The basic polylysine can provide a cationic environment and play a role in triggering the formation of the composite micro-particles.

[0018] Preferably, the polylysine is a basic polylysine and a modified polylysine in a mass ratio of 1:(0.5-0.8).

[0019] The use of modified polylysine to partially replace the basic polylysine further improves the transdermal absorption rate.

[0020] Preferably, the preparation of the modified polylysine comprises the following steps: adding phospholipid polyethylene glycol carboxyl into water and stirring uniformly, adding 1-ethyl-3-(3-dimethylaminopropyl) carbodiimide (EDC, the abbreviation is used in the embodiment content) and N-hydroxysuccinimide (NHS, the abbreviation is used in the embodiment content), stirring at 25-30℃ for 5-10min, dropping into a buffer solution containing the basic polylysine (the buffer solution is a phosphate buffered saline solution, pH 7.4, the abbreviation is PBS solution in the embodiment content), stirring at 25-30℃ for 20-24h, purification, freeze-drying, and obtaining the modified polylysine.

[0021] Preferably, the mass ratio of phospholipid polyethylene glycol carboxyl, 1-ethyl-3-(3-dimethylaminopropyl) carbodiimide, N-hydroxysuccinimide, and basic polylysine is (1-1.5):(0.15-0.2):(0.1-0.15):(4-5).

[0022] The introduction of polyethylene glycol modified modified polylysine further introduces flexible substances into the microspheres, enhances the deformability and reversible recovery characteristics of the flexible microspheres, and realizes more efficient transdermal absorption; the introduction of phospholipid polyethylene glycol replaces part of the crosslinking points, increases the motion space, enhances the overall fluidity, and promotes absorption; however, the introduction should not be too much, because on the one hand, it will affect the cationic environment, and on the other hand, it will cause the microsphere structure to be too loose, the particle size will be affected, and the microspheres will be easy to disintegrate.

[0023] Preferably, the specific preparation steps of the composite microspheres are as follows: adding polydeoxyribonucleic acid into water and stirring uniformly to obtain a polydeoxyribonucleic acid aqueous solution (PDRN aqueous solution); diluting a silk material solution, mixing with the polydeoxyribonucleic acid aqueous solution, adding a polylysine aqueous solution, obtaining a composite solution system, and stirring and mixing to obtain an aqueous solution containing the composite microspheres.

[0024] Preferably, the stirring and mixing time is 5-120min, and the stirring speed is 200-12000rpm.

[0025] Preferably, the composite microspheres prepared by the scheme can be applied in the fields of medical dressings or cosmetics; when applied in dressings, the composite microspheres can be used as sustained-release carriers; when applied in cosmetics, the dosage forms include any one of water, emulsion, cream, essence, spray, and any one of smearing face mask or face paste mask.

[0026] Preferably, the composite microspheres prepared by the scheme also include 0.1% to 2% of a preservative by mass fraction when applied.

[0027] Compared with the prior art, the beneficial effects achieved by the application are: in the scheme, the aqueous solution of silk fibroin and PDRN is mixed, and under the action of the polylysine composition, the two are intertwined and folded and compressed, a flexible composite microsphere that does not need organic solvents, does not need to add solubilizers and other auxiliary materials, can pass through the intercellular space, and can improve the transdermal absorption effect, solves the problem of transdermal absorption of macromolecular PDRN and silk fibroin, and maximizes the technical effect of high absorption with a simple process. (1) The molecular weight of silk material and PDRN is large, and it is difficult to be absorbed transdermally. The conventional preparation method cannot obtain a particle size suitable for transdermal absorption, and can only enter the body by injection, and the scope of application is small. If other organic solvents are used to assist in preparing microspheres with smaller particle sizes, there is a safety hazard. In the scheme, the self-assembly microspheres technology of macromolecules is used, and the supramolecular interaction between PDRN and silk fibroin is utilized to rapidly form a composite microsphere in the cationic environment provided by polylysine. Specifically, the two are intertwined and folded and compressed, not simply electrostatically adsorbed. From a microscopic point of view, this structure is similar to silk fibroin and PDRN as a thread, first weaving the "thread" into a "rope", and then winding the "rope" into a "ball". Finally, a flexible silk fibroin composite microsphere with a particle size of 50nm to 500nm is prepared, so that the transdermal absorption effect can be achieved by directly applying it, and after entering the skin, the difference between the internal and external environment of the skin is utilized to trigger dissociation, restore the morphology, and realize the transdermal delivery of the active ingredients. And the scheme does not introduce other auxiliary ingredients, and does not affect safety.

[0028] (2) The process of the application is optimized: first, the silk fibroin and PDRN are mixed, and the two are dispersed in the solution system, and then the polylysine solution providing a cationic environment is added. In the obtained mixed solution system, the silk fibroin and PDRN are intertwined and combined through intermolecular forces, and are automatically folded and compressed to obtain a solution system containing silk fibroin composite microspheres. Compared with the traditional electrostatic adsorption balling, there is no peripheral adsorption structure, so it is easier to penetrate the cell membrane and enter the cell, and it can pass through the intercellular space to improve the transdermal absorption effect. At the same time, the application is directly prepared in an aqueous solution, without the help of organic solvents, and the process and raw materials are simpler.

[0029] (3) The addition amount of each raw material in the composite microspheres needs to be controlled. The addition amount of polylysine needs to be controlled to a high concentration, which leads to a large proportion of cations in the overall solution, and the obtained composite microspheres have a large particle size, and even become hydrogels. A high content of fibroin can lead to precipitation, resulting in an unstable system. Similarly, the order of addition is important. If the order of addition of fibroin, polylysine and PDRN is changed, the composite microspheres required by the present application cannot be formed. In the prior art, the process reported in the reference cannot form microspheres after mixing the solution, and alcohol precipitation in an ethanol solution is required to form microspheres, which is obviously different from the method of directly preparing microspheres in an aqueous solution in the present application.

[0030] (4) Further, the present application introduces modified polylysine, wherein polyethylene glycol phosphate is used to enhance the deformable and reversible recovery characteristics of the flexible microspheres, to achieve more efficient transdermal absorption; the introduction of phospholipid polyethylene glycol replaces part of the crosslinking points, increases the movement space, enhances the overall fluidity, and promotes absorption; however, the introduction should not be too much. On the one hand, excessive introduction will affect the cationic environment, and on the other hand, it will lead to a too loose microsphere structure, affecting the particle size and being prone to disintegration. BRIEF DESCRIPTION OF DRAWINGS

[0031] The accompanying drawings are included to provide a further understanding of the present application, and constitute a part of the specification, together with the embodiments of the present application, to explain the present application, and do not constitute a limitation on the present application. In the drawings: Figure 1 is a molecular model of PDRN; Figure 2 is a molecular model of fibroin; Figure 3 is a combination simulation diagram of PDRN and fibroin; Figure 4 is an electron microscope graph of the compression process of PDRN; Figure 5 is an electron microscope graph of the composite microspheres of Example 1; Figure 6 is a diffusion amount detection result graph of the samples of Example 1 and Comparative Example 1; the red line is the sample of Example 1, and the gray line is the sample of Comparative Example 1 (fibroin); Figure 7 is a stability test result graph of the samples of Example 1 and Comparative Example 1; the left side is the sample of Comparative Example 1, and the right side is the sample of Example 1. DETAILED DESCRIPTION

[0032] The technical solutions in the embodiments of the present application will be described below in a clear and complete manner. Obviously, the described embodiments are only a part of the embodiments of the present application, rather than all the embodiments. Based on the embodiments in the present application, all other embodiments obtained by a person of ordinary skill in the art without creative labor fall within the scope of protection of the present application.

[0033] It should be noted that there is no special restriction on the purchase manufacturer of all raw materials involved in the present application, which exemplarily includes: silk fibroin (Suzhou Suhaobiomaterial Technology Co., Ltd.), PDRN (Ruigeming Biotechnology Co., Ltd., Shanghai Huivin Biotechnology Co., Ltd.), basic polylysine (Shandong Furuida Biotechnology Co., Ltd., Shanghai Maikelin Biochemical Technology Co., Ltd.), phospholipid polyethylene glycol carboxyl (DSPE-PEG2000-COOH); Unless otherwise specified, the following are all mass parts, mass ratio; Verification test: verify whether PDRN and silk fibroin can occur supramolecular self-assembly: step one: cut part of PDRN sequence from salmon genome sequence, construct PDRN model; PDRN sequence A chain (SEQ ID NO. 1) is: CTACTTCCTCTCTAAGGACCAGGGGAAGAGTTGACAACATAGTGT; PDRN sequence B chain (SEQ ID NO. 2) is: ACACTATGTTGTCAACTCTTCCCCTGGTCCTTAGAGAGGAAGTAG; Step two: obtain the silk protein pdb file on the RCSB PDB: Homepage website, the silk protein amino acid sequence is shown as SEQ ID NO. 3; see the sequence listing for details; Step three: open the pdb files of PDRN and silk protein using AutoDockTools-1.5.6, and perform molecular simulation docking experiment; Specifically, Figure 1 PDRN model, Figure 2 silk protein model; the molecular docking calculation result is shown as Figure 3 The interaction force between PDRN and silk protein is-4.21 kcal / mol. From the perspective of molecular docking calculation simulation, it is generally considered that if it is lower than-0.6 kcal / mol, it is considered that there is interaction between the two molecules; in summary, there is strong intermolecular interaction between PDRN and silk fibroin.

[0034] Example 1: 1 part of PDRN was added into 50 parts of water and stirred to obtain a PDRN aqueous solution; silk fibroin solution was diluted with water to a concentration of 1 wt%, to obtain a silk fibroin diluent; 0.05 parts of basic polylysine was added into 25 parts of water and stirred to obtain a polylysine aqueous solution; 100 parts of the silk fibroin diluent and the PDRN aqueous solution were mixed and stirred at 600 rpm for 60 min, and then the polylysine aqueous solution was added and stirred at 600 rpm for 30 min, to obtain a sample containing composite microspheres.

[0035] Example 2: 1 part of PDRN was added into 50 parts of water and stirred to obtain a PDRN aqueous solution; silk fibroin solution was diluted with water to a concentration of 1 wt%, to obtain a silk fibroin diluent; 0.05 parts of basic polylysine was added into 25 parts of water and stirred to obtain a polylysine aqueous solution; 100 parts of the silk fibroin diluent and the PDRN aqueous solution were mixed and stirred at 600 rpm for 60 min, and then the polylysine aqueous solution was added and stirred at 600 rpm for 30 min, 1 part of a preservative, hexylene glycol, was added and stirred to obtain a sample containing composite microspheres.

[0036] Example 3: 1 part of PDRN was added into 50 parts of water and stirred to obtain a PDRN aqueous solution; silk fibroin solution was diluted with water to a concentration of 1 wt%, to obtain a silk fibroin diluent; 0.2 parts of basic polylysine was added into 25 parts of water and stirred to obtain a polylysine aqueous solution; 100 parts of the silk fibroin diluent and the PDRN aqueous solution were mixed and stirred at 600 rpm for 60 min, and then the polylysine aqueous solution was added and stirred at 600 rpm for 30 min, to obtain a sample containing composite microspheres.

[0037] Example 4: 1 part of PDRN was added into 50 parts of water and stirred to obtain a PDRN aqueous solution; silk fibroin solution was diluted with water to a concentration of 1 wt%, to obtain a silk fibroin diluent; 0.3 parts of basic polylysine was added into 25 parts of water and stirred to obtain a polylysine aqueous solution; 100 parts of the silk fibroin diluent and the PDRN aqueous solution were mixed and stirred at 600 rpm for 60 min, and then the polylysine aqueous solution was added and stirred at 600 rpm for 30 min, to obtain a sample.

[0038] Example 5: 1 part of PDRN was added into 50 parts of water and stirred to obtain a PDRN aqueous solution; the silk fibroin solution was diluted with water to a concentration of 1 wt%, to obtain a silk fibroin diluent; 0.006 parts of the basic polylysine was added into 25 parts of water and stirred to obtain a polylysine aqueous solution; 100 parts of the silk fibroin diluent was mixed with the PDRN aqueous solution and stirred at 600 rpm for 60 min, and then the polylysine aqueous solution was added and stirred at 600 rpm for 30 min to obtain a sample containing the composite microspheres.

[0039] Example 6: 1 part of PDRN was added into 50 parts of water and stirred to obtain a PDRN aqueous solution; the silk fibroin solution was diluted with water to a concentration of 2 wt%, to obtain a silk fibroin diluent; 0.05 parts of the basic polylysine was added into 25 parts of water and stirred to obtain a polylysine aqueous solution; 100 parts of the silk fibroin diluent was mixed with the PDRN aqueous solution and stirred at 600 rpm for 60 min, and then the polylysine aqueous solution was added and stirred at 600 rpm for 30 min to obtain a sample.

[0040] Example 7: 1 part of phospholipid polyethylene glycol carboxyl was added into 15 parts of water and stirred to obtain a phospholipid polyethylene glycol carboxyl aqueous solution; 0.15 parts of EDC and 0.1 parts of NHS were added and stirred at 25°C for 10 min; a PBS solution of the basic polylysine (containing 5 parts of the basic polylysine and 39 parts of PBS solution with a pH of 7.4) was added dropwise, and stirred at 25°C for 24 h; unreacted substances, solvents and catalysts were removed by purification; and freeze-drying was performed to obtain a modified polylysine. 1 part of PDRN was added into 50 parts of water and stirred to obtain a PDRN aqueous solution; the silk fibroin solution was diluted with water to a concentration of 1 wt%, to obtain a silk fibroin diluent; 0.05 parts of the polylysine (basic polylysine and modified polylysine with a mass ratio of 1:0.5) was added into 25 parts of water and stirred to obtain a polylysine aqueous solution; 100 parts of the silk fibroin diluent was mixed with the PDRN aqueous solution and stirred at 600 rpm for 60 min, and then the polylysine aqueous solution was added and stirred at 600 rpm for 30 min to obtain a sample containing the composite microspheres.

[0041] Comparative Example 1: This comparative example was a silk fibroin aqueous solution: 1 part of silk fibroin was added into 100 parts of water and stirred to obtain a sample.

[0042] Comparative Example 2: This comparative example was a PDRN aqueous solution: 1 part of PDRN was added into 100 parts of water and stirred to obtain a sample.

[0043] Comparative Example 3: 1 part of PDRN was added into 50 parts of water and stirred to obtain a PDRN aqueous solution; the silk fibroin solution was diluted with water to a concentration of 1 wt%, to obtain a silk fibroin diluent; 100 parts of the silk fibroin diluent was mixed with the PDRN aqueous solution, 25 parts of water was added, and stirring was performed at 600 rpm for 60 min to obtain a sample; no composite microspheres were prepared in this comparative example.

[0044] Comparative Example 4: 1 part of PDRN was added into 50 parts of water and stirred to obtain a PDRN aqueous solution; the silk fibroin solution was diluted with water to a concentration of 1 wt%, to obtain a silk fibroin diluent; 0.05 parts of basic polylysine was added into 25 parts of water and stirred to obtain a polylysine aqueous solution; 100 parts of the silk fibroin diluent was mixed with the polylysine aqueous solution, stirring was performed at 600 rpm for 60 min, and then the PDRN aqueous solution was added, stirring was performed at 600 rpm for 30 min to obtain a sample; no composite microspheres were prepared in this comparative example.

[0045] Comparative Example 5: 1 part of PDRN was added into 50 parts of water and stirred to obtain a PDRN aqueous solution; the silk fibroin solution was diluted with water to a concentration of 1 wt%, to obtain a silk fibroin diluent; 0.05 parts of sodium hyaluronate was added into 25 parts of water and stirred to obtain a sodium hyaluronate aqueous solution; 100 parts of the silk fibroin diluent was mixed with the PDRN aqueous solution, stirring was performed at 600 rpm for 60 min, and then the sodium hyaluronate aqueous solution was added, stirring was performed at 600 rpm for 30 min to obtain a sample; no composite microspheres were prepared in this comparative example.

[0046] Comparative Example 6: 1 part of PDRN was added into 50 parts of water and stirred to obtain a PDRN aqueous solution; the silk fibroin solution was diluted with water to a concentration of 1 wt%, to obtain a silk fibroin diluent; 0.03 parts of basic polylysine and 0.02 parts of sodium hyaluronate were added into 25 parts of water and stirred to obtain a mixture aqueous solution; 100 parts of the silk fibroin diluent was mixed with the PDRN aqueous solution, stirring was performed at 600 rpm for 60 min, and then the mixture aqueous solution was added, stirring was performed at 600 rpm for 30 min to obtain a sample containing composite microspheres.

[0047] Performance Test 1: Particle Size Test (1) The particle size of the sample obtained in the examples was tested according to GB / T 19077-2016 Particle Size Distribution Laser Diffraction Method, and the test results are shown in Table 1; (2) The electron microscope photograph of the silk fibroin composite microspheres prepared in Example 1 is shown in FIG. 1. Figure 5 Table 1:

[0048] ​From the examples, it can be seen that the polylysine concentration is relatively large, but does not exceed 0.2%, which leads to a large proportion of cations in the overall solution, and the obtained composite microspheres have a large particle size; in Example 4, the polylysine content is too large, and the final obtained sample is not a composite microsphere aqueous solution, but a hydrogel, but in combination, it can be seen that the presence of polylysine is required in the reaction system; at the same time, from Comparative Example 4, it can be seen that changing the addition order of silk fibroin, polylysine and PDRN will result in the inability to form the composite microspheres required by the present application. In Example 6, the silk fibroin content is relatively high, although the composite microspheres can also be formed, but the excess silk fibroin in the system will precipitate, resulting in unstable system. On the contrary, if the silk fibroin concentration is reduced, it has no obvious effect on the formation of composite microspheres, but from the application point of view, low silk fibroin content will affect the product prepared therefrom. In summary, the ratio of each raw material and the addition order need to be controlled.

[0049] Performance test 2: transdermal absorption amount detection Take the samples prepared in Example 1, Example 7, Comparative Example 1 and Comparative Example 6 to prepare 0.1% (m / m) composite microsphere aqueous solution test sample 1, 0.1% (m / m) composite microsphere aqueous solution test sample 7 and 0.1% (m / m) silk fibroin aqueous solution test sample as the diffusion liquid, and add the diffusion liquid into the in vitro diffusion cell; set the rotation speed to 100 rpm; start the transdermal diffusion tester software, set the diffusion cell temperature to 25℃, and set the test time to 24h (with an interval of 2h); start the test, collect the sample at the set time; use the BCA method to determine the silk fibroin content; after the test is completed, analyze and process the collected sample; the diffusion amount detection results of the samples of Example 1 and Comparative Example 1 are shown in Figure 6 ; the 6h and 12h diffusion amounts of the samples of Example 1, Example 7, Comparative Example 1 and Comparative Example 6 are compared in Table 2; Table 2:

[0050] The diffusion amount of the examples is much larger than that of the comparative examples, and gradually increases with time; it can be seen that the transdermal absorption amount of the composite microsphere sample prepared in the examples is significantly higher than that of Comparative Example 1, which indicates that the composite microspheres prepared in the present application can more easily penetrate the cell membrane and enter the cell; from Comparative Example 6, it can be seen that the addition of a new sodium hyaluronate component will actually lead to a decrease in effect.

[0051] Performance test 3: stability test Place the samples obtained in Examples 1-7, Comparative Examples 1-2 and Comparative Example 6 at room temperature (25℃) under light-proof conditions for 60 days, and observe the sample stability, the specific results are shown in Table 3, Figure 7 ; Table 3:

[0052] Figure 7 The left picture is a 5% silk fibroin aqueous solution sample (comparative example 1) placed under normal temperature (25℃) and light-avoiding condition for 60 days, and the right picture is a 5% silk fibroin composite microsphere solution sample (example 1) placed under normal temperature (25℃) and light-avoiding condition for 60 days; it can be seen that the stability of the microspherized silk fibroin solution is better, and no obvious delamination phenomenon occurs, indicating that the spatial structure of the silk fibroin can be improved after microspherization, the silk fibroin configuration transformation can be avoided, and the aqueous solution stability can be improved.

[0053] In summary, the composite microspheres prepared by the present application are different from the common microspheres in the art, and are not a simple layer-by-layer self-assembly structure, but a supramolecular self-assembly formed by the intermolecular force between the silk fibroin and the PDRN, and also utilizes the nucleic acid substance attribute of the PDRN beneficial to folding to automatically compress into microspheres capable of penetrating the cell membrane and entering the cell, so as to achieve the transdermal absorption effect, which can realize high transdermal absorption effect by using a simple process, and does not use solubilizers and other auxiliary materials or organic solvents. The composite microspheres can be directly sprayed or smeared to be absorbed, without medical and beauty injection.

[0054] Finally, it should be noted that: the above only describes the preferred embodiments of the present application and is not used to limit the present application, although the present application has been described in detail with reference to the foregoing embodiments, and for those skilled in the art, the technical solutions recorded in the foregoing embodiments can still be modified, or some technical features can be replaced equivalently. Any modification, equivalent replacement, improvement, etc. made within the spirit and principles of the present application shall be included in the protection scope of the present application.

[0055] SEQUENCE LISTING SEQ ID NO.3: <120> A transdermally absorbed composite microsphere, a preparation method and application <160> 1 <170> SIPOSequenceListing 1.0 <210> 1 <211> 4982 <212> PRT <213> Artificial Sequence <400> 1 Met Arg Val Lys Thr Phe Val Ile Leu Cys Cys Ala Leu Gln Tyr Val 1 5 10 15 Ala Tyr Thr Asn Ala Asn lie Asn Asp Phe Asp Glu Asp Tyr Phe Gly 20 25 30 Ser Asp Val Thr Val Gin Ser Ser Asn Thr Thr Asp Glu lie lie Arg 35 40 45 Asp Ala Ser Gly Ala Val lie Glu Glu Gin lie Thr Thr Lys Lys Met 50 55 60 Gln Arg Lys Asn Lys Asn His Gly lie Leu Gly Lys Asn Glu Lys Met 65 70 75 80 lie Lys Thr Phe Val lie Thr Thr Asp Ser Asp Gly Asn Glu Ser lie 85 90 95 Val Glu Glu Asp Val Leu Met Lys Thr Leu Ser Asp Gly Thr Val Ala 100 105 110 Gln Ser Tyr Val Ala Ala Asp Ala Gly Ala Tyr Ser Gin Ser Gly Pro 115 120 125 Tyr Val Ser Asn Ser Gly Tyr Ser Thr His Gin Gly Tyr Thr Ser Asp 130 135 140 Phe Ser Thr Ser Ala Ala Val Gly Ala Gly Ala Gly Ala Gly Ala Ala 145 150 155 160 Ala Gly Ser Gly Ala Gly Ala Gly Ala Gly Tyr Gly Ala Ala Ser Gly 165 170 175 Ala Gly Ala Gly Ala Gly Ala Gly Tyr Gly Ala Gly Ala Gly Ala Gly 180 185 190 Ala Gly Ala Gly Tyr Gly Ala Gly Ala Gly Ala Gly Ala Gly Ala Gly 195 200 205 Ala Gly Ala Gly Tyr Gly Ala Gly Ala Gly Ala Gly Ala Gly Ala Gly 210 215 220 Tyr Gly Ala Gly Ala Gly Ala Gly Ala Gly Ala Gly Tyr Gly Ala Gly 225 230 235 240 Ala Gly Ala Gly Ala Gly Ala Gly Tyr Gly Ala Gly Ala Gly Ala Gly 245 250 255 Ala Gly Ala Gly Tyr Gly Ala Ala Ser Gly Ala Gly Ala Gly Ala Gly 260 265 270 Tyr Gly Gln Gly Val Gly Ser Gly Ala Ala Ser Gly Ala Gly Ala Gly 275 280 285 Ala Gly Ala Gly Ser Ala Ala Gly Ser Gly Ala Gly Ala Gly Ala Gly 290 295 300 Thr Gly Ala Gly Ala Gly Tyr Gly Ala Gly Ala Gly Ala Gly Ala Gly 305 310 315 320 Ala Gly Tyr Gly Ala Ala Ser Gly Thr Gly Ala Gly Tyr Gly Ala Gly 325 330 335 Ala Gly Ala Gly Tyr Gly Gly Ala Ser Gly Ala Gly Ala Gly Ala Gly 340 345 350 Ala Gly Ala Gly Ala Gly Ala Gly Ala Gly Tyr Gly Thr Gly Ala Gly 355 360 365 Tyr Gly Ala Gly Ala Gly Ala Gly Ala Gly Ala Gly Ala Gly Ala Gly 370 375 380 Tyr Gly Ala Gly Ala Gly Ala Gly Tyr Gly Ala Gly Tyr Gly Val Gly 385 390 395 400 Ala Gly Ala Gly Tyr Gly Ala Gly Tyr Gly Ala Gly Ala Gly Ser Gly 405 410 415 Ala Ala Ser Gly Ala Gly Ser Gly Ala Gly Ala Gly Ser Gly Ala Gly 420 425 430 Ala Gly Ser Gly Ala Gly Ala Gly Ser Gly Ala Gly Ala Gly Ser Gly 435 440 445 Ala Gly Ala Gly Ser Gly Ala Gly Ala Gly Ser Gly Ala Gly Ala Gly 450 455 460 Ser Gly Ala Gly Ala Gly Ser Gly Ala Gly Ala Gly Ser Gly Thr Gly 465 470 475 480 Ala Gly Ser Gly Ala Gly Ala Gly Tyr Gly Ala Gly Ala Gly Ala Gly 485 490 495 Tyr Gly Ala Gly Ala Gly Ser Gly Ala Gly Ala Gly 500 505 510 Ser Gly Ala Gly Ala Gly Ser Gly Ala Gly Ala Gly Ser Gly Ala Gly 515 520 525 Ala Gly Ser Gly Ala Gly Ala Gly Ser Gly Ala Gly Ala Gly Tyr Gly 530 535 540 Ala Gly Ala Gly Ala Gly Tyr Gly Ala Gly Ala Gly Ala Gly Tyr Gly 545 550 555 560 Ala Gly Ala Gly Val Gly Tyr Gly Ala Gly Ala Gly Ser Gly Ala Ala 565 570 575 Ser Gly Ala Gly Ala Gly Ser Gly Ala Gly Ala Gly Ser Gly Ala Gly 580 585 590 Ala Gly Ser Gly Ala Gly Ala Gly Ser Gly Ala Gly Ala Gly Ser Gly 595 600 605 Ala Gly Ala Gly Ser Gly Ala Gly Ala Gly Ser Gly Ala Gly Ala Gly 610 615 620 Ser Gly Ala Gly Ala Gly Ser Gly Ala Gly Val Gly Tyr Gly Ala Gly 625 630 635 640 Val Gly Ala Gly Tyr Gly Ala Gly Tyr Gly Ala Gly Ala Gly Ala Gly 645 650 655 Tyr Gly Ala Gly Ala Gly Ser Gly Ala Ala Ser Gly Ala Gly Ala Gly 660 665 670 Ala Gly Ala Gly Ala Gly Thr Gly Ser Ser Gly Phe Gly Pro Tyr Val 675 680 685 Ala Asn Gly Gly Tyr Ser Arg Ser Asp Gly Tyr Glu Tyr Ala Trp Ser 690 695 700 Ser Asp Phe Gly Thr Gly Ser Gly Ala Gly Ala Gly Ser Gly Ala Gly 705 710 715 720 Ala Gly Ser Gly Ala Gly Ala Gly Ser Gly Ala Gly Ala Gly Ser Gly 725 730 735 Ala Gly Ala Gly Ser Gly Ala Gly Ala Gly Tyr Gly Ala Gly Val Gly 740 745 750 Val Gly Tyr Gly Ala Gly Tyr Gly Ala Gly Ala Gly Ala Gly Tyr Gly 755 760 765 Ala Gly Ala Gly Ser Gly Ala Ala Ser Gly Ala Gly Ala Gly Ser Gly 770 775 780 Ala Gly Ala Gly Ser Gly Ala Gly Ala Gly Ser Gly Ala Gly Ala Gly 785 790 795 800 Ser Gly Ala Gly Ala Gly Ser Gly Ala Gly Ala Gly Ser Gly Ala Gly 805 810 815 Ala Gly Ser Gly Ala Gly Ala Gly Ser Gly Ala Gly Ala Gly Ser Gly 820 825 830 Ala Gly Ala Gly Ser Gly Ala Gly Val Gly Ser Gly Ala Gly Ala Gly 835 840 845 Ser Gly Ala Gly Ala Gly Ser Gly Ala Gly Ala Gly Tyr Gly Ala Gly 850 855 860 Ala Gly Ala Gly Tyr Gly Ala Gly Ala Gly Ala Gly Tyr Gly Ala Gly 865 870 875 880 Tyr Gly Val Gly Ala Gly Ala Gly Tyr Gly Ala Gly Ala Gly Ser Gly 885 890 895 Ala Ala Ser Gly Ala Gly Ala Gly Ser Gly Ala Gly Ala Gly Ser Gly 900 905 910 Ala Gly Ala Gly Ser Gly Ala Gly Ala Gly Ser Gly Ala Gly Ala Gly 915 920 925 Ser Gly Ala Gly Ala Gly Ser Gly Ala Gly Ala Gly Ser Gly Ala Gly 930 935 940 Ala Gly Ser Gly Ser Gly Ala Gly Tyr Gly Ala Gly Val Gly Val Gly 945 950 955 960 Tyr Gly Ala Gly Ala Gly Ser Gly Ala Gly Ala Gly Ser Gly Ala Gly 965 970 975 Ser Gly Ala Gly Ala Gly Ser Gly Ala Gly Ala Gly Ser Gly Ala Gly 980 985 990 Ala Gly Ser Gly Ala Gly Ala Gly Ser Gly Ala Gly Ala Gly Ser Gly 995 1000 1005 Ala Gly Ala Gly Ser Gly Ala Gly Ala Gly Ser Gly Ala Gly Ala Gly 1010 1015 1020 Ser Gly Ala Gly Ala Gly Ser Gly Ala Gly Ala Gly Ser Gly Ala Gly 1025 1030 1035 1040 Ala Gly Tyr Gly Ala Gly Val Gly Ala Gly Tyr Gly Ala Gly Tyr Gly 1045 1050 1055 Ala Gly Ala Gly Ala Gly Tyr Gly Ala Gly Ala Gly Ser Gly Ala Ala 1060 1065 1070 Ser Gly Ala Gly Ser Gly Ala Gly Ala Gly Ser Gly Ala Gly Ala Gly 1075 1080 1085 Ser Gly Ala Gly Ala Gly Ser Gly Ala Gly Ala Gly Ser Gly Ala Gly 1090 1095 1100 Ala Gly Ser Gly Ala Gly Ala Gly Ser Gly Ala Gly Ala Gly Ser Gly 1105 1110 1115 1120 Ala Gly Ser Gly Ala Gly Ala Gly Tyr Gly Ala Gly Ile Gly Ala Gly 1125 1130 1135 Tyr Gly Ala Gly Tyr Gly Ala Gly Ala Gly Ala Gly Tyr Gly Ala Gly 1140 1145 1150 Ala Gly Ser Gly Ala Ala Ser Gly Ala Gly Ala Gly Ser Gly Ala Gly 1155 1160 1165 Ala Gly Ser Gly Ala Gly Ala Gly Ser Gly Ala Gly Ala Gly Ser Gly 1170 1175 1180 Ala Gly Ala Gly Ser Gly Ala Gly Ala Gly Ser Gly Ala Gly Ala Gly 1185 1190 1195 1200 Ser Gly Ala Gly Val Gly Tyr Gly Ala Gly Tyr Gly Ala Gly Ala Gly 1205 1210 1215 Ala Gly Tyr Gly Ala Gly Ala Gly Ser Gly Ala Ala Ser Gly Ala Gly 1220 1225 1230 Ala Gly Ala Gly Ala Gly Ala Gly Thr Gly Ser Ser Gly Phe Gly Pro 1235 1240 1245 Tyr Val Ala His Gly Gly Tyr Ser Gly Tyr Glu Tyr Ala Trp Ser Ser 1250 1255 1260 Glu Ser Asp Phe Gly Thr Gly Ser Gly Ala Gly Ala Gly Ser Gly Ala 1265 1270 1275 1280 Gly Ala Gly Ser Gly Ala Gly Ala Gly Ser Gly Ala Gly Ala Gly Ser 1285 1290 1295 Gly Ala Gly Tyr Gly Ala Gly Val Gly Ala Gly Tyr Gly Ala Gly Tyr 1300 1305 1310 Gly Ala Gly Ala Gly Ala Gly Tyr Gly Ala Gly Ala Gly Ser Gly Ala 1315 1320 1325 Gly Ser Gly Ala Gly Ala Gly Ser Gly Ala Gly Ala Gly Ser Gly Ala 1330 1335 1340 Gly Ala Gly Ser Gly Ala Gly Ala Gly Ser Gly Ala Gly Ala Gly Ser 1345 1350 1355 1360 Gly Ala Gly Ala Gly Ser Gly Ala Gly Ala Gly Ser Gly Ala Gly Ala 1365 1370 1375 Gly Ser Gly Ala Gly Ala Gly Tyr Gly Ala Gly Tyr Gly Ala Gly Ala 1380 1385 1390 Gly Ala Gly Tyr Gly Ala Gly Ala Gly Ser Gly Ala Gly Ser Gly Ala 1395 1400 1405 Gly Ala Gly Ser Gly Ala Gly Ala Gly Ser Gly Ala Gly Ala Gly Ser 1410 1415 1420 Gly Ala Gly Ala Gly Ser Gly Ala Gly Ala Gly Ser Gly Ala Gly Ala 1425 1430 1435 1440 Gly Ser Gly Ala Gly Ala Gly Ser Gly Ala Gly Ala Gly Ser Gly Ala 1445 1450 1455 Gly Ala Gly Ser Gly Ala Gly Ala Gly Ser Gly Ala Gly Val Gly Ser 1460 1465 1470 Gly Ala Gly Ala Gly Ser Gly Ala Gly Ala Gly Ser Gly Ala Gly Ala 1475 1480 1485 Gly Tyr Gly Ala Gly Tyr Gly Ala Gly Val Gly Ala Gly Tyr Gly Ala 1490 1495 1500 Gly Tyr Gly Ala Gly Ala Gly Ala Gly Tyr Gly Ala Gly Ala Gly Ser 1505 1510 1515 1520 Gly Ala Gly Ser Gly Ala Gly Ala Gly Ser Gly Ala Gly Ala Gly Ser 1525 1530 1535 Gly Ala Gly Ala Gly Ser Gly Ala Gly Ala Gly Ser Gly Ala Gly Val 1540 1545 1550 Gly Ser Gly Ala Gly Ala Gly Ser Gly Ala Gly Ala Gly Ser Gly Ala 1555 1560 1565 Gly Ala Gly Ser Gly Ala Gly Ala Gly Tyr Gly Ala Gly Tyr Gly Ala 1570 1575 1580 Gly Ala Gly Ala Gly Tyr Gly Ala Gly Ala Gly Ser Gly Ala Gly Ala 1585 1590 1595 1600 Gly Ser Gly Ala Gly Ala Gly Ser Gly Ala Gly Ala Gly Ser Gly Ala 1605 1610 1615 Gly Ala Gly Tyr Gly Ala Gly Ala Gly Ala Gly Tyr Gly Ala Gly Ala 1620 1625 1630 Gly Ser Gly Ala Gly Ser Gly Ala Gly Ala Gly Ser Gly Ala Gly Ala 1635 1640 1645 Gly Ser Gly Ala Gly Ala Gly Ser Gly Ala Gly Ala Gly Ser Gly Ala 1650 1655 1660 Gly Ala Gly Ser Gly Ala Gly Ser Gly Ser Gly Ala Gly Ala Gly Ser 1665 1670 1675 1680 Gly Ala Gly Ala Gly Ser Gly Ala Gly Ala Gly Tyr Gly Ala Gly Val 1685 1690 1695 Gly Ala Gly Tyr Gly Ala Gly Tyr Gly Ala Gly Ala Gly Ala Gly Tyr 1700 1705 1710 Gly Ala Gly Ala Gly Ser Gly Ala Gly Ser Gly Ala Gly Ala Gly Ser 1715 1720 1725 Gly Ala Gly Ala Gly Tyr Gly Ala Gly Ala Gly Ala Gly Tyr Gly Ala 1730 1735 1740 Gly Ala Gly Ser Gly Ala Gly Ala Gly Ala Gly Ser Gly Ala Gly Ala 1745 1750 1755 1760 Gly Ala Gly Ser Gly Ala Gly Ala Gly Ser Gly Ala Gly Ala Gly Ser 1765 1770 1775 Gly Ala Gly Ala Gly Ser Gly Ala Gly Ala Gly Ser Gly Ala Gly Ala 1780 1785 1790 Gly Ser Gly Ala Gly Ser Gly Ser Gly Ala Gly Ala Gly Ser Gly Ala 1795 1800 1805 Gly Ala Gly Ser Gly Ala Gly Ala Gly Ser Gly Ala Gly Ala Gly Ser 1810 1815 1820 Gly Ala Gly Ala Gly Tyr Gly Ala Gly Val Gly Ala Gly Tyr Gly Val 1825 1830 1835 1840 Gly Tyr Gly Ala Gly Ala Gly Ala Gly Tyr Gly Ala Gly Ala Gly Ser 1845 1850 1855 Gly Ala Ala Ser Gly Ala Gly Ala Gly Ala Gly Ala Gly Ala Gly Thr 1860 1865 1870 Gly Ser Ser Gly Phe Gly Pro Tyr Val Ala His Gly Gly Tyr Ser Gly 1875 1880 1885 Tyr Glu Tyr Ala Trp Ser Ser Glu Ser Asp Phe Gly Thr Gly Ser Gly 1890 1895 1900 Ala Gly Ala Gly Ser Gly Ala Gly Ala Gly Ser Gly Ala Gly Ala Gly 1905 1910 1915 1920 Ser Gly Ala Gly Ala Gly Ser Gly Ala Gly Ala Gly Ser Gly Ala Gly 1925 1930 1935 Ala Gly Ser Gly Ala Gly Ala Gly Tyr Gly Ala Gly Val Gly Ala Gly 1940 1945 1950 Tyr Gly Ala Gly Tyr Gly Ala Gly Ala Gly Ala Gly Tyr Gly Ala Gly 1955 1960 1965 Ala Gly Ser Gly Ala Ala Ser Gly Ala Gly Ala Gly Ser Gly Ala Gly 1970 1975 1980 Ala Gly Ser Gly Ala Gly Ala Gly Ser Gly Ala Gly Ala Gly Ser Gly 1985 1990 1995 2000 Ala Gly Ala Gly Ser Gly Ala Gly Ala Gly Ser Gly Ala Gly Ala Gly 2005 2010 2015 Ser Gly Ala Gly Ala Gly Ser Gly Ala Gly Ala Gly Ser Gly Ala Gly 2020 2025 2030 Ala Gly Ser Gly Ala Gly Ala Gly Tyr Gly Ala Gly Ala Gly 2035 2040 2045 Tyr Gly Ala Gly Val Gly Ala Gly Tyr Gly Ala Gly Tyr Gly Ala Gly 2050 2055 2060 Ala Gly Ala Gly Tyr Gly Ala Gly Ala Gly Ser Gly Ala Gly Ser Gly 2065 2070 2075 2080 Ala Gly Ala Gly Ser Gly Ala Gly Ala Gly Tyr Gly Ala Gly Ala Gly 2085 2090 2095 Ala Gly Tyr Gly Ala Gly Ala Gly Ser Gly Ala Gly Ser Gly Ala Gly 2100 2105 2110 Ala Gly Ser Gly Ala Gly Ala Gly Ser Gly Ala Gly Ala Gly Ser Gly 2115 2120 2125 Ala Gly Ala Gly Ser Gly Ala Gly Ala Gly Ser Gly Ala Gly Ala Gly 2130 2135 2140 Ser Gly Ala Gly Ala Gly Ser Gly Ala Gly Ser Gly Ser Gly Ala Gly 2145 2150 2155 2160 Ala Gly Ser Gly Ala Gly Ala Gly Ser Gly Ala Gly Ala Gly Tyr Gly 2165 2170 2175 Ala Gly Val Gly Ala Gly Tyr Gly Val Gly Tyr Gly Ala Gly Ala Gly 2180 2185 2190 Ala Gly Tyr Gly Ala Gly Ala Gly Ser Gly Ala Ala Ser Gly Ala Gly 2195 2200 2205 Ala Gly Ala Gly Ala Gly Ala Gly Thr Gly Ser Ser Gly Phe Gly Pro 2210 2215 2220 Tyr Val Ala His Gly Gly Tyr Ser Gly Tyr Glu Tyr Ala Trp Ser Ser 2225 2230 2235 2240 Glu Ser Asp Phe Gly Thr Gly Ser Gly Ala Gly Ala Gly Ser Gly Ala 2245 2250 2255 Gly Ala Gly Ala Gly Ala Gly Ala Gly Ser Gly Ala Gly Ala Gly Tyr 2260 2265 2270 Gly Ala Gly Val Gly Ala Gly Tyr Gly Ala Gly Tyr Gly Ala Gly Ala 2275 2280 2285 Gly Ala Gly Tyr Gly Ala Gly Ala Gly Ser Gly Thr Gly Ser Gly Ala 2290 2295 2300 Gly Ala Gly Ser Gly Ala Gly Ala Gly Ser Gly Ala Gly Ala Gly Ser 2305 2310 2315 2320 Gly Ala Gly Ala Gly Ser Gly Ala Gly Ala Gly Ser Gly Ala Gly Ala 2325 2330 2335 Gly Ser Gly Ala Gly Ser Gly Ala Gly Ala Gly Ser Gly Ala Gly Ala 2340 2345 2350 Gly Tyr Gly Ala Gly Val Gly Ala Gly Tyr Gly Ala Gly Tyr Gly Ala 2355 2360 2365 Gly Ala Gly Ala Gly Tyr Gly Ala Gly Ala Gly Ser Gly Ala Gly Ser 2370 2375 2380 Gly Ala Gly Ala Gly Ser Gly Ala Gly Ala Gly Tyr Gly Ala Gly Val 2385 2390 2395 2400 Gly Ala Gly Tyr Gly Ala Gly Tyr Gly Ala Gly Ala Gly Ala Gly Tyr 2405 2410 2415 Gly Ala Gly Ala Gly Ser Gly Ala Gly Ser Gly Ala Gly Ala Gly Ser 2420 2425 2430 Gly Ala Gly Ala Gly Tyr Gly Ala Gly Val Gly Ala Gly Tyr Gly Ala 2435 2440 2445 Gly Ala Gly Ser Gly Ala Ala Phe Gly Ala Gly Ala Gly Ser Gly Ala 2450 2455 2460 Gly Ala Gly Ala Gly Ser Gly Ala Gly Ala Gly Ser Gly Ala Gly Ala 2465 2470 2475 2480 Gly Ser Gly Ala Gly Ala Gly Ser Gly Ala Gly Ala Gly Ser Gly Ala 2485 2490 2495 Gly Ala Gly Tyr Gly Ala Gly Tyr Gly Ala Gly Val Gly Ala Gly Tyr 2500 2505 2510 Gly Ala Gly Ala Gly Ser Gly Ala Ala Ser Gly Ala Gly Ala Gly Ser 2515 2520 2525 Gly Ala Gly Ala Gly Ser Gly Ala Gly Ala Gly Ser Gly Ala Gly Ala 2530 2535 2540 Gly Ser Gly Ala Gly Ala Gly Ser Gly Ala Gly Ala Gly Tyr Gly Ala 2545 2550 2555 2560 Gly Val Gly Ala Gly Tyr Gly Ala Gly Tyr Gly Ala Gly Ala Gly Ala 2565 2570 2575 Gly Tyr Gly Ala Gly Ala Gly Ser Gly Ala Ala Ser Gly Ala Gly Ala 2580 2585 2590 Gly Ser Gly Ala Gly Ala Gly Ala Gly Ser Gly Ala Gly Ala Gly Ser 2595 2600 2605 Gly Ala Gly Ala Gly Ser Gly Ala Gly Ala Gly Ser Gly Ala Gly Ala 2610 2615 2620 Gly Ser Gly Ala Gly Ala Gly Ser Gly Ala Gly Ala Gly Tyr Gly Ala 2625 2630 2635 2640 Gly Ala Gly Ser Gly Ala Ala Ser Gly Ala Gly Ala Gly Ala Gly Ala 2645 2650 2655 Gly Ala Gly Thr Gly Ser Ser Gly Phe Gly Pro Tyr Val Ala Asn Gly 2660 2665 2670 Gly Tyr Ser Gly Tyr Glu Tyr Ala Trp Ser Ser Glu Ser Asp Phe Gly 2675 2680 2685 Thr Gly Ser Gly Ala Gly Ala Gly Ser Gly Ala Gly Ala Gly Ser Gly 2690 2695 2700 Ala Gly Ala Gly Ser Gly Ala Gly Ala Gly Ser Gly Ala Gly Ala Gly 2705 2710 2715 2720 Tyr Gly Ala Gly Val Gly Ala Gly Tyr Gly Ala Gly Tyr Gly Ala Gly 2725 2730 2735 Ala Gly Ala Gly Tyr Gly Ala Gly Ala Gly Ser Gly Ala Gly Ser Gly 2740 2745 2750 Ala Gly Ala Gly Ser Gly Ala Gly Ala Gly Ser Gly Ala Gly Ala Gly 2755 2760 2765 Ser Gly Ala Gly Ala Gly Ser Gly Ala Gly Ala Gly Ser Gly Ala Gly 2770 2775 2780 Ala Gly Ser Gly Ala Gly Ala Gly Tyr Gly Ala Gly Ala Gly Ser Gly 2785 2790 2795 2800 Ala Ala Ser Gly Ala Gly Ala Gly Ser Gly Ala Gly Ala Gly Ser Gly 2805 2810 2815 Ala Gly Ala Gly Ser Gly Ala Gly Ala Gly Ser Gly Ala Gly Ala Gly 2820 2825 2830 Ser Gly Ala Gly Ala Gly Tyr Gly Ala Gly Val Gly Ala Gly Tyr Gly 2835 2840 2845 Ala Gly Tyr Gly Ala Gly Ala Gly Ala Gly Tyr Gly Ala Gly Ala Gly 2850 2855 2860 Ser Gly Ala Ala Ser Gly Ala Gly Ala Gly Ser Gly Ala Gly Ala Gly 2865 2870 2875 2880 Ala Gly Ser Gly Ala Gly Ala Gly Ser Gly Ala Gly Ala Gly Ser Gly 2885 2890 2895 Ala Gly Ala Gly Ser Gly Ala Gly Ala Gly Tyr Gly Ala Gly Ala Gly 2900 2905 2910 Ser Gly Ala Ala Ser Gly Ala Gly Ala Gly Ala Gly Ala Gly Ala Gly 2915 2920 2925 Thr Gly Ser Ser Gly Phe Gly Pro Tyr Val Ala Asn Gly Gly Tyr Ser 2930 2935 2940 Gly Tyr Glu Tyr Ala Trp Ser Ser Glu Ser Asp Phe Gly Thr Gly Ser 2945 2950 2955 2960 Gly Ala Gly Ala Gly Ser Gly Ala Gly Ala Gly Ser Gly Ala Gly Ala 2965 2970 2975 Gly Ser Gly Ala Gly Ala Gly Tyr Gly Ala Gly Ile Gly Ala Gly Tyr 2980 2985 2990 Gly Ala Gly Val Gly Ala Gly Tyr Gly Ala Gly Val Gly Ala Gly Tyr 2995 3000 3005 Gly Ala Gly Tyr Gly Ala Gly Ala Gly Ala Gly Tyr Gly Ala Gly Ala 3010 3015 3020 Gly Ser Gly Ala Gly Ser Gly Ala Gly Ala Gly Ser Gly Ala Gly Ala 3025 3030 3035 3040 Gly Ser Gly Ala Gly Ala Gly Ser Gly Ala Gly Ala Gly Ser Gly Ala 3045 3050 3055 Gly Ala Gly Ser Gly Ala Gly Ala Gly Ser Gly Ala Gly Ala Gly Ser 3060 3065 3070 Gly Ala Gly Ala Gly Ser Gly Ala Gly Ala Gly Ser Gly Ala Gly Ser 3075 3080 3085 Gly Ala Gly Ala Gly Ser Gly Ala Gly Ala Gly Ser Gly Ala Gly Ala 3090 3095 3100 Gly Ser Gly Ala Gly Ala Gly Tyr Gly Ala Gly Val Gly Ala Gly Tyr 3105 3110 3115 3120 Gly Val Gly Tyr Gly Ala Gly Val Gly Ala Gly Tyr Gly Ala Gly Val 3125 3130 3135 Gly Ala Gly Tyr Gly Ala Gly Ala Gly Ala Gly Tyr Gly Ala Gly Ala 3140 3145 3150 Gly Ser Gly Ala Gly Ser Gly Ala Gly Ala Gly Ser Gly Ala Gly Ala 3155 3160 3165 Gly Ser Gly Ala Gly Ala Gly Ser Gly Ala Gly Ala Gly Ser Gly Ala 3170 3175 3180 Gly Ala Gly Ser Gly Ala Gly Ala Gly Ser Gly Ala Gly Ala Gly Ser 3185 3190 3195 3200 Gly Ala Gly Ala Gly Ser Gly Ala Gly Ala Gly Ser Gly Ala Gly Ser 3205 3210 3215 Gly Ala Gly Ala Gly Ser Gly Ala Gly Ala Gly Ser Gly Ala Gly Ala 3220 3225 3230 Gly Ser Gly Ala Gly Ala Gly Tyr Gly Ala Gly Val Gly Ala Gly Tyr 3235 3240 3245 Gly Val Gly Tyr Gly Ala Gly Val Gly Ala Gly Tyr Gly Ala Gly Ala 3250 3255 3260 Gly Ser Gly Ala Gly Ala Gly Tyr Gly Ala Gly Tyr Gly Ala Gly Val 3265 3270 3275 3280 Gly Ala Gly Ser Gly Ala Gly Ala Gly Ser Gly Ala Gly Ala Gly Ser 3285 3290 3295 Gly Ala Gly Ala Gly Ser Gly Ala Gly Ala Gly Ser Gly Ala Gly Ala 3300 3305 3310 Gly Ser Gly Ala Gly Ala Gly Tyr Gly Ala Gly Tyr Gly Ala Gly Val 3315 3320 3325 Gly Ala Gly Tyr Gly Ala Gly Ala Gly Val Gly Tyr Gly Ala Gly Ala 3330 3335 3340 Gly Ala Gly Tyr Gly Ala Gly Ala Gly Ser Gly Ala Ala Ser Gly Ala 3345 3350 3355 3360 Gly Ala Gly Ala Gly Ser Gly Ala Gly Ala Gly Ser Gly Ala Gly Ala 3365 3370 3375 Gly Ser Gly Ala Gly Ala Gly Tyr Gly Ala Gly Ala Gly Ser Gly Ala 3380 3385 3390 Ala Ser Gly Ala Gly Ala Gly Ala Gly Ala Gly Ala Gly Thr Gly Ser 3395 3400 3405 Ser Gly Phe Gly Pro Tyr Val Ala Asn Gly Gly Tyr Ser Gly Tyr Glu 3410 3415 3420 Tyr Ala Trp Ser Ser Glu Ser Asp Phe Gly Thr Gly Ser Gly Ala Gly 3425 3430 3435 3440 Ala Gly Ser Gly Ala Gly Ala Gly Ser Gly Ala Gly Ala Gly Ser Gly 3445 3450 3455 Ala Gly Ala Gly Ser Gly Ala Gly Ala Gly Tyr Gly Ala Gly Val Gly 3460 3465 3470 Ala Gly Tyr Gly Val Gly Tyr Gly Ala Gly Ala Gly Ala Gly Tyr Gly 3475 3480 3485 Ala Gly Ala Gly Ser Gly Ala Gly Ser Gly Ala Gly Ala Gly Ser Gly 3490 3495 3500 Ala Gly Ala Gly Ser Gly Ala Gly Ala Gly Ser Gly Ala Gly Ala Gly 3505 3510 3515 3520 Ser Gly Val Gly Ala Gly Ser Gly Ala Gly Ala Gly Ser Gly Ala Gly 3525 3530 3535 Ala Gly Tyr Gly Ala Gly Val Gly Ala Gly Tyr Gly Val Gly Tyr Gly 3540 3545 3550 Ala Gly Ala Gly Ala Gly Tyr Gly Ala Gly Ala Gly Ser Gly Ala Gly 3555 3560 3565 Ser Gly Ala Gly Ala Gly Ser Gly Ala Gly Ala Gly Ser Gly Ala Gly 3570 3575 3580 Ala Gly Ser Gly Ala Gly Ala Gly Ser Gly Ala Gly Ser Gly Ala Gly 3585 3590 3595 3600 Ala Gly Ser Gly Ala Gly Ala Gly Ser Gly Ala Gly Ala Gly Ser Gly 3605 3610 3615 Ala Gly Ser Gly Ala Gly Ala Gly Ser Gly Ala Gly Ala Gly Tyr Gly 3620 3625 3630 Val Gly Tyr Gly Ala Gly Ala Gly Ala Gly Tyr Gly Ala Gly Ala Gly 3635 3640 3645 Ser Gly Ala Gly Ser Gly Ala Gly Ala Gly Ser Gly Ala Gly Ala Gly 3650 3655 3660 Ser Gly Ala Gly Ala Gly Ser Gly Ala Gly Ser Gly Ala Gly Ala Gly 3665 3670 3675 3680 Ser Gly Ala Gly Ala Gly Ser Gly Ala Gly Ala Gly Ser Gly Ala Gly 3685 3690 3695 Ala Gly Tyr Gly Ala Gly Val Gly Ala Gly Tyr Gly Val Gly Tyr Gly 3700 3705 3710 Ala Gly Ala Gly Ala Gly Tyr Gly Ala Gly Ala Gly Ser Gly Ala Gly 3715 3720 3725 Ser Gly Ala Gly Ala Gly Ser Gly Ala Gly Ala Gly Ser Gly Ala Gly 3730 3735 3740 Ala Gly Ser Gly Ala Gly Ala Gly Ser Gly Ala Gly Ala Gly Ser Gly 3745 3750 3755 3760 Ala Gly Ala Gly Ser Gly Ala Gly Ala Gly Ser Gly Ala Gly Ser Gly 3765 3770 3775 Ala Gly Ala Gly Ser Gly Ala Gly Ala Gly Ser Gly Ala Gly Ala Gly 3780 3785 3790 Ser Gly Ala Gly Ala Gly Tyr Gly Ala Gly Val Gly Ala Gly Tyr Gly 3795 3800 3805 Val Gly Tyr Gly Ala Gly Ala Gly Ala Gly Tyr Gly Ala Gly Ala Gly 3810 3815 3820 Ser Gly Ala Ala Ser Gly Ala Gly Ala Gly Ala Gly Ala Gly Ala Gly 3825 3830 3835 3840 Thr Gly Ser Ser Gly Phe Gly Pro Tyr Val Ala Asn Gly Gly Tyr Ser 3845 3850 3855 Gly Tyr Glu Tyr Ala Trp Ser Ser Glu Ser Asp Phe Gly Thr Gly Ser 3860 3865 3870 Gly Ala Gly Ala Gly Ser Gly Ala Gly Ala Gly Ser Gly Ala Gly Ala 3875 3880 3885 Gly Ser Gly Ala Gly Ala Gly Tyr Gly Ala Gly Ala Gly Ser Gly Ala 3890 3895 3900 Ala Ser Gly Ala Gly Ala Gly Ala Gly Ser Gly Ala Gly Ala Gly Ser 3905 3910 3915 3920 Gly Ala Gly Ala Gly Ser Gly Ala Gly Ala Gly Ser Gly Ala Gly Ala 3925 3930 3935 Gly Ser Gly Ala Gly Ala Gly Ser Gly Ala Gly Ala Gly Ala Gly Ser 3940 3945 3950 Gly Ala Gly Ala Gly Tyr Gly Ala Gly Tyr Gly Ile Gly Val Gly Ala 3955 3960 3965 Gly Tyr Gly Ala Gly Ala Gly Val Gly Tyr Gly Ala Gly Ala Gly Ala 3970 3975 3980 Gly Tyr Gly Ala Gly Ala Gly Ser Gly Ala Ala Ser Gly Ala Gly Ala 3985 3990 3995 4000 Gly Ser Gly Ala Gly Ala Gly Ser Gly Ala Gly Ala Gly Ser Gly Ala 4005 4010 4015 Gly Ala Gly Ser Gly Ala Gly Ala Gly Ser Gly Ala Gly Ala Gly Ser 4020 4025 4030 Gly Ala Gly Ala Gly Tyr Gly Ala Gly Tyr Gly Ala Gly Val Gly Ala 4035 4040 4045 Gly Tyr Gly Ala Gly Ala Gly Val Gly Tyr Gly Ala Gly Ala Gly Ala 4050 4055 4060 Gly Tyr Gly Ala Gly Ala Gly Ser Gly Ala Ala Ser Gly Ala Gly Ala 4065 4070 4075 4080 Gly Ala Gly Ala Gly Ala Gly Ser Gly Ala Gly Ala Gly Ser Gly Ala 4085 4090 4095 Gly Ala Gly Ser Gly Ala Gly Ala Gly Ser Gly Ala Gly Ala Gly Ser 4100 4105 4110 Gly Ala Gly Ala Gly Ser Gly Ala Gly Ala Gly Ser Gly Ala Gly Ala 4115 4120 4125 Gly Ser Gly Ala Gly Ala Gly Ser Gly Ala Gly Ala Gly Ser Gly Ala 4130 4135 4140 Gly Ser Gly Ala Gly Ala Gly Ser Gly Ala Gly Ala Gly Tyr Gly Val 4145 4150 4155 4160 Gly Tyr Gly Ala Gly Ala Gly Ala Gly Tyr Gly Ala Gly Ala Gly Ser 4165 4170 4175 Gly Ala Gly Ser Gly Ala Gly Ala Gly Ser Gly Ala Gly Ala Gly Ser 4180 4185 4190 Gly Ala Gly Ala Gly Ser Gly Ala Gly Ser Gly Ala Gly Ala Gly Ser 4195 4200 4205 Gly Ala Gly Ala Gly Ser Gly Ala Gly Ala Gly Ser Gly Ala Gly Ala 4210 4215 4220 Gly Tyr Gly Ala Gly Val Gly Ala Gly Tyr Gly Val Gly Tyr Gly Ala 4225 4230 4235 4240 Gly Ala Gly Ala Gly Tyr Gly Ala Gly Ala Gly Ser Gly Ala Ala Ser 4245 4250 4255 Gly Ala Gly Ala Gly Ala Gly Ala Gly Ser Gly Ser Gly Ala Gly Ser 4260 4265 4270 Gly Ser Gly Ala Gly Ser Gly Ser Gly Ala Gly Ser Gly Ser Gly Ala 4275 4280 4285 Gly Ser Gly Ala Gly Ala Gly Ser Gly Ala Gly Ala Gly Ser Gly Ala 4290 4295 4300 Gly Ala Gly Ser Gly Ala Gly Ala Gly Ser Gly Ala Gly Ala Gly Ser 4305 4310 4315 4320 Gly Ala Gly Tyr Gly Ala Gly Ala Gly Ser Gly Ala Ala Ser 4325 4330 4335 Gly Ala Gly Ala Gly Ala Gly Ala Gly Ala Gly Thr Gly Ser Ser Gly 4340 4345 4350 Phe Gly Pro Tyr Val Ala Asn Gly Gly Tyr Ser Gly Tyr Glu Tyr Ala 4355 4360 4365 Trp Ser Ser Glu Ser Asp Phe Gly Thr Gly Ser Gly Ala Gly Ala Gly 4370 4375 4380 Ser Gly Ala Gly Ala Gly Ser Gly Ala Gly Ala Gly Tyr Gly Ala Gly 4385 4390 4395 4400 Val Gly Ala Gly Tyr Gly Ala Gly Tyr Gly Ala Gly Ala Gly Ala Gly 4405 4410 4415 Tyr Gly Ala Gly Ala Gly Ser Gly Val Ala Ser Gly Ala Gly Ala Gly 4420 4425 4430 Ala Gly Ser Gly Ala Gly Ala Gly Ser Gly Ala Gly Ala Gly Ser Gly 4435 4440 4445 Ala Gly Ala Gly Ser Gly Ala Gly Ala Gly Ser Gly Ala Gly Ala Gly 4450 4455 4460 Ser Gly Ala Gly Ala Gly Tyr Gly Ala Gly Tyr Gly Ile Gly Val Gly 4465 4470 4475 4480 Ala Gly Tyr Gly Ala Gly Ala Gly Val Gly Tyr Gly Ala Gly Ala Gly 4485 4490 4495 Ala Gly Tyr Gly Ala Gly Ala Gly Ser Gly Ala Ala Ser Gly Ala Gly 4500 4505 4510 Ala Gly Ser Gly Ala Gly Ala Gly Ser Gly Ala Gly Ala Gly Ser Gly 4515 4520 4525 Ala Gly Ala Gly Ser Gly Ala Gly Ala Gly Ser Gly Ala Gly Ala Gly 4530 4535 4540 Ser Gly Ala Gly Ala Gly Ser Gly Ala Gly Ala Gly Ser Gly Ala Gly 4545 4550 4555 4560 Ala Gly Tyr Gly Ala Gly Ala Gly Val Gly Tyr Gly Ala Gly Ala Gly 4565 4570 4575 Ser Gly Ala Ala Ser Gly Ala Gly Ala Gly Ser Gly Ala Gly Ala Gly 4580 4585 4590 Ser Gly Ala Gly Ala Gly Ser Gly Ala Gly Ala Gly Ser Gly Ala Gly 4595 4600 4605 Ala Gly Ser Gly Ala Gly Ala Gly Ser Gly Ala Gly Ala Gly Ser Gly 4610 4615 4620 Ala Gly Ala Gly Ser Gly Ala Gly Ser Gly Ala Gly Ala Gly Ser Gly 4625 4630 4635 4640 Ala Gly Ala Gly Tyr Gly Ala Gly Tyr Gly Ala Gly Val Gly Ala Gly 4645 4650 4655 Tyr Gly Ala Gly Ala Gly Val Gly Tyr Gly Ala Gly Tyr Gly Val Gly 4660 4665 4670 Ala Gly Ala Gly Tyr Gly Ala Gly Ala Gly Ser Gly Ala Ala Ser Gly 4675 4680 4685 Ala Gly Ala Gly Ser Gly Ala Gly Ala Gly Ser Gly Ala Gly Ala Gly 4690 4695 4700 Ser Gly Ala Gly Ala Gly Ser Gly Ala Gly Ala Gly Ser Gly Ala Gly 4705 4710 4715 4720 Ser Gly Ala Gly Ala Gly Tyr Gly Ala Gly Ala Gly Val Gly Tyr Gly 4725 4730 4735 Ala Gly Ala Gly Ala Gly Tyr Gly Ala Gly Ala Gly Ser Gly Ala Ala 4740 4745 4750 Ser Gly Ala Gly Ala Gly Ala Gly Ala Gly Ser Gly Ala Gly Ala Gly 4755 4760 4765 Ser Gly Ala Gly Ala Gly Tyr Gly Ala Gly Ala Gly Ser Gly Ala Ala 4770 4775 4780 Ser Gly Ala Gly Ala Gly Tyr Gly Ala Gly Ala Gly Ser Gly Ala Ala 4785 4790 4795 4800 Ser Gly Ala Gly Ala Gly Ser Gly Ala Gly Ala Gly Ala Gly Ala Gly 4805 4810 4815 Ala Gly Ala Gly Ser Gly Ala Gly Ala Gly Ser Gly Ala Gly Ala Gly 4820 4825 4830 Tyr Gly Ala Gly Ala Gly Ser Gly Ala Ala Ser Gly Ala Gly Ala Gly 4835 4840 4845 Ala Gly Ala Gly Thr Gly Ser Ser Gly Phe Gly Pro Tyr Val Ala Asn 4850 4855 4860 Gly Gly Tyr Ser Arg Arg Glu Gly Tyr Glu Tyr Ala Trp Ser Ser Lys 4865 4870 4875 4880 Ser Asp Phe Glu Thr Gly Ser Gly Ala Ala Ser Gly Ala Gly Ala Gly 4885 4890 4895 Ala Gly Ser Gly Ala Gly Ala Gly Ser Gly Ala Gly Ala Gly Ser Gly 4900 4905 4910 Ala Gly Ala Gly Ser Gly Ala Gly Ala Gly Gly Ser Val Ser Tyr Gly 4915 4920 4925 Ala Gly Arg Gly Tyr Gly Gin Gly Ala Gly Ser Ala Ala Ser Ser Val 4930 4935 4940 Ser Ser Ala Ser Ser Arg Ser Tyr Asp Tyr Ser Arg Arg Asn Val Arg 4945 4950 4955 4960 Lys Asn Cys Gly He Pro Arg Arg Gin Leu Val Val Lys Phe Arg Ala 4965 4970 4975 Leu Pro Cys Val Asn Cys 4980

Claims

1. A method for preparing a transdermally absorbable composite microsphere, characterized by: The preparation method comprises the following steps: The silk material and the polydeoxyribonucleic acid are intertwined and knotted under the action of the polylysine, and are folded and compressed to obtain the composite microspheres.

2. The method for preparing a transdermal absorption composite microsphere according to claim 1, characterized in that: The particle size of the composite microspheres is 50nm-500nm; in the raw material of the composite microspheres, the mass ratio of the silk material to the polylysine is 1:(0.006-0.2), the mass ratio of the silk material to the polydeoxyribonucleic acid is 1:(1-10), and the mass ratio of the polylysine to the polydeoxyribonucleic acid is 1:(5-150).

3. The method for preparing a transdermal absorption composite microsphere according to claim 1, characterized in that: The silk material comprises at least one of silk fibroin, hydrolyzed silk fibroin, hydrolyzed silk, and silk amino acids.

4. The method for preparing a transdermal absorption composite microsphere according to claim 1, characterized in that: The polylysine comprises at least one of basic polylysine and modified polylysine.

5. The method for preparing a transdermal absorption composite microsphere according to claim 4, characterized in that: The polylysine is basic polylysine.

6. The method for preparing a transdermal absorption composite microsphere according to claim 4, characterized in that: The polylysine is basic polylysine and modified polylysine with a mass ratio of 1:(0.5-0.8).

7. The method for preparing a transdermal absorption composite microsphere according to claim 6, characterized in that: The preparation of the modified polylysine comprises the following steps: The phospholipid polyethylene glycol carboxyl is uniformly stirred in water, 1-ethyl-3-(3-dimethylaminopropyl) carbodiimide and N-hydroxysuccinimide are added, stirring is performed at 25-30℃ for 5-10min, the buffer solution containing the basic polylysine is added dropwise, stirring is performed at 25-30℃ for 20-24h, purification is performed, freeze-drying is performed, and the modified polylysine is obtained; the mass ratio of the phospholipid polyethylene glycol carboxyl, 1-ethyl-3-(3-dimethylaminopropyl) carbodiimide, N-hydroxysuccinimide and basic polylysine is (1-1.5):(0.15-0.2):(0.1-0.15):(4-5).

8. The method for preparing a transdermal absorption composite microsphere according to claim 1, characterized in that: The specific preparation steps of the composite microspheres are as follows: the polydeoxyribonucleic acid is uniformly stirred in water to obtain a polydeoxyribonucleic acid aqueous solution; the silk material solution is diluted, mixed with the polydeoxyribonucleic acid aqueous solution, and the polylysine aqueous solution is added to obtain a composite solution system, and stirring is performed to obtain a water solution containing the composite microspheres.

9. The composite microspheres prepared by the preparation method of the composite microspheres for transdermal absorption according to claim 1.

10. Use of a transdermally absorbable composite microsphere, characterized by: The composite microspheres can be used as sustained-release materials in the field of medical dressings or cosmetic materials.

Images