Ultrasonic responsive nano-particles based on genetically engineered bacterium outer membrane vesicle-liposome fusion as well as preparation method and application of ultrasonic responsive nano-particles

Abstract

The invention belongs to the technical field of biological medicines, and particularly discloses ultrasonic responsive nanoparticles based on gene engineering bacterium outer membrane vesicle-liposome fusion as well as a preparation method and application of the ultrasonic responsive nanoparticles. The nanoparticle OLatCe6 provided by the invention can break through the bottleneck of tumor immunotherapy through a triple synergistic mechanism: (1) immune targeting enhancement: PAMPs rich in OMVs in a fusion shell can be efficiently recognized by antigen presenting cells in a tumor microenvironment, so that the tumor antigen presentation efficiency is remarkably improved; (2) intelligent immune regulation and control: a core slowly-released GM-CSF strongly recruits DCs to a tumor microenvironment and promotes maturation of the DCs, and a persistent immune response hub is established; and (3) sonodynamic-immune synergy: the sonosensitizer embedded in the lipid bilayer explodes ROS under ultrasonic irradiation, accurately induces tumor cells ICD and releases DAMPs, activates deep infiltration of cytotoxic T lymphocytes, and forms an anti-tumor immune positive feedback cycle.

Description

Technical Field

[0001] This invention belongs to the field of biomedical technology, specifically relating to an ultrasound-responsive nanoparticle based on the fusion of genetically engineered bacterial outer membrane vesicles and liposomes, its preparation method, and the application of the nanoparticle in the preparation of antitumor drugs. Background Technology

[0002] In recent years, cancer immunotherapy, which utilizes the body's own immune system to identify and eliminate cancer cells, represents a revolutionary approach in the field of oncology. Specifically, cancer immunotherapy fundamentally relies on the functional efficacy of immune cells to eliminate malignant tumors, and its efficacy is constrained by the immune landscape within the tumor microenvironment. Various immune components present in the tumor microenvironment, especially dendritic cells (DCs), are major regulators of anti-tumor immunity due to their superior antigen capture, processing, and presentation capabilities, as well as their crucial role in initiating and activating naïve T cells. However, the immunosuppressive properties of the tumor microenvironment impose multiple barriers to effective DC function, including impaired maturation, defective antigen presentation, and recruitment inhibition. Therefore, intratumoral DCs often fail to adequately initiate cytotoxic T cells or maintain their effector functions, leading to T cell anergy or exhaustion. These limitations severely hinder the initiation and spread of adaptive immune responses against cancer. These limitations also highlight the urgent need for innovative therapeutic strategies that can overcome the immunosuppression of the tumor microenvironment and enhance DC-mediated anti-tumor responses.

[0003] The clinical application of granulocyte-macrophage colony-stimulating factor (GM-CSF), while proven effective in recruiting and activating dendritic cells (DCs), faces significant pharmacological challenges, including rapid systemic clearance and limited tumor accumulation. These limitations necessitate frequent, high-dose administration, increasing the risk of systemic toxicities such as cytokine release syndrome and myeloproliferative effects, and failing to guarantee adequate bioactive concentrations in the tumor microenvironment. To address these issues, Gram-negative bacterial-derived vesicles (OMVs) have emerged as a multifunctional delivery platform, inherently combining potent immunostimulatory effects via pathogen-associated molecular patterns (PAMPs) with natural tumor tropism mediated by passively enhanced permeability and retention (EPR) effects and active chemotaxis of inflammatory chemokines in the tumor microenvironment. Furthermore, OMVs also act as self-adjuvant carriers, enabling efficient co-delivery of engineered therapeutic cargoes such as tumor antigens, cytokines, or immunomodulators. Compared to the uncontrolled proliferation of live bacteria and the difficulty in completely clearing them from the body, these non-replicating vesicles offer excellent safety while maintaining the targeting ability of their parent bacteria. Furthermore, its particulate properties enhance stability and bioavailability compared to soluble factors such as GM-CSF, prolonging its interaction with immune cells in lymphoid organs and the tumor microenvironment (TME). The clinical feasibility of OMV-based therapies, such as the FDA-approved Bexsero vaccine for meningococcal disease, has been demonstrated, laying a solid foundation for their application in cancer immunotherapy. Therefore, developing genetically engineered OMV-fused liposome nanoparticles holds significant potential for clinical application. Summary of the Invention

[0004] The main technical problem solved by this invention is to provide an ultrasound-responsive nanoparticle based on the fusion of genetically engineered bacterial outer membrane vesicles and liposomes. Through GM-CSF loaded with OMVs, it realizes the large-scale recruitment and maturation of dendritic cells (DCs) in the tumor microenvironment, thereby achieving efficient antigen presentation. At the same time, through ultrasound-induced ICD, it releases a large number of DAMPs to activate T cells, thereby enhancing the anti-tumor immune response.

[0005] Secondly, this invention provides a method for preparing ultrasound-responsive nanoparticles based on the fusion of genetically engineered bacterial outer membrane vesicles and liposomes.

[0006] Furthermore, this invention provides the application of nanoparticles in the preparation of antitumor drugs.

[0007] Finally, the present invention provides an anti-tumor drug.

[0008] To solve the above-mentioned technical problems, the present invention provides the following technical solutions:

[0009] An ultrasound-responsive nanoparticle based on the fusion of genetically engineered bacterial outer membrane vesicles and liposomes, wherein the nanoparticles are prepared from OMVs loaded with GM-CSF and liposomes loaded with a sonicating agent.

[0010] The nanoparticles of the present invention are formed by the fusion of OMVs and liposomes, with a sonication agent loaded in the lipid phase of the nanoparticle shell and rich in genetically engineered GM-CSF at the center.

[0011] In a preferred embodiment of the present invention, the mass ratio of the GM-CSF-loaded OMVs to the liposomes loaded with the sonication agent is (1-5):(1-5), preferably 1:1.

[0012] In a preferred embodiment of the present invention, the GM-CSF-loaded OMVs contain plasmids expressing GM-CSF.

[0013] Specifically, the nucleotide sequence of the plasmid expressing GM-CSF is shown in SEQ ID NO: 1. The nucleotide sequence of GM-CSF is shown in SEQ ID NO: 2.

[0014] In a preferred embodiment of the present invention, the raw materials for preparing the liposomes include lipid material and a sound-sensitizing agent, wherein the mass ratio of lipid material to sound-sensitizing agent is (3-15):(1-5), preferably 3:1.

[0015] As a preferred embodiment of the present invention, the lipid material includes, but is not limited to, one or more of phospholipids, cholesterol, DSPE-PEOz (i.e., polyethylene glycol-derived phospholipids, wherein the number average molecular weight of PEOz is 1000-4000).

[0016] Specifically, the lipid material comprises phospholipids, cholesterol, and DSPE-PEOz, with a molar ratio of (1-3):(0.5-1.5):(0.2-0.6), preferably 2:1:0.4. Soybean phospholipids are preferred. The number-average molecular weight of PEOz in DSPE-PEOz is 1000-4000. The liposomes prepared from the above lipid material are acid-sensitive liposomes.

[0017] As a preferred embodiment of the present invention, the sound-sensitive agent includes, but is not limited to, one or more of dihydroporphyrin e6 (Ce6), hematoporphyrin monomethyl ether (HMME), etc.

[0018] In a preferred embodiment of the present invention, the liposomes loaded with the sound-sensing agent have a particle size of 80-110 nm.

[0019] In a preferred embodiment of the present invention, the nanoparticles have a particle size of 120-180 nm.

[0020] A method for preparing ultrasound-responsive nanoparticles based on the fusion of genetically engineered bacterial outer membrane vesicles and liposomes includes the following steps:

[0021] GM-CSF-loaded OMVs are mixed with liposomes loaded with a sound-sensing agent and then co-extruded to obtain nanoparticles. As a preferred embodiment of the present invention, the preparation method of the GM-CSF-loaded OMVs includes:

[0022] The plasmid expressing GM-CSF was transformed into Gram-negative bacteria and cultured. The cultured bacterial solution was then subjected to differential ultracentrifugation to obtain OMVs loaded with GM-CSF.

[0023] Specifically, the nucleotide sequence of the plasmid expressing GM-CSF is shown in SEQ ID NO: 1. The nucleotide sequence of GM-CSF is shown in SEQ ID NO: 2.

[0024] Specifically, the Gram-negative bacteria include, but are not limited to, Escherichia coli, preferably non-pathogenic Escherichia coli DH5α.

[0025] Specifically, the culture is carried out at a constant speed of 12-20 h in a shaker at 35-40℃ and 150-200 rpm.

[0026] Specifically, the specific operations of the differential ultracentrifugation include:

[0027] Collect the bacterial culture and centrifuge at 200-400×g for 5-20 min;

[0028] Centrifuge the supernatant at 1500-3000×g for 5-20 min;

[0029] Centrifuge the supernatant at 8000-12000×g for 20-40 min;

[0030] Centrifuge the supernatant at 100,000-150,000 × g for 50-100 min;

[0031] Discard the supernatant, wash the precipitate and centrifuge at 100,000-150,000×g for 50-100 min;

[0032] The collected precipitate is the OMVs loaded with GM-CSF.

[0033] As a preferred embodiment of the present invention, the method for preparing the liposomes loaded with the sound-sensing agent includes:

[0034] The solution of the dissolved lipid material is mixed with the solution of the dissolved sound-sensing agent, and the solvent is removed to obtain a lipid film; the lipid film is then hydrated to obtain liposomes loaded with the sound-sensing agent.

[0035] Specifically, the solvent removal is performed by rotary evaporation at 45-60°C for 10-30 minutes.

[0036] Specifically, the hydration process involves adding an aqueous buffer (such as PBS buffer) to the lipid membrane and hydrating it at room temperature (20-25°C) for 5-20 minutes.

[0037] In a preferred embodiment of the present invention, the co-extrusion includes passing polycarbonate films at 400 nm, 200 nm, and 100 nm in sequence.

[0038] Applications of ultrasound-responsive nanoparticles based on the fusion of genetically engineered bacterial outer membrane vesicles and liposomes include, but are not limited to, one or more of the following:

[0039] (1) Application in the preparation of antitumor drugs;

[0040] (2) Application in the preparation of drugs or formulations that recruit dendritic cells and promote their maturation;

[0041] (3) Application in the preparation of drugs that enhance T cell-mediated antitumor immune responses;

[0042] (4) Application in the preparation of drugs that inhibit lung metastasis of tumors.

[0043] Specifically, when the tumor is an anti-PD-1 resistant tumor, the nanoparticles in the drug can effectively inhibit the growth of anti-PD-1 resistant tumors and induce long-term immune memory effects.

[0044] Specifically, the preparation can be a simple experimental preparation used to explore the physiological metabolic processes of tumor cells, but not to eliminate the cause or lesion; it is only a research preparation for non-therapeutic purposes.

[0045] Specifically, the inhibition of tumor lung metastasis includes, but is not limited to, promoting the normalization of alveolar structure and reducing lung metastases.

[0046] An antitumor drug comprising, in an effective amount (in the range of 0.01 wt% to 99.99 wt%) of ultrasound-responsive nanoparticles based on genetically engineered bacterial outer membrane vesicle-liposome fusion.

[0047] As a preferred embodiment of the present invention, the antitumor drug further includes other antitumor pharmacological components, including but not limited to anti-PD-1 / PD-L1 antibodies.

[0048] As a preferred embodiment of the present invention, the antitumor drug further includes pharmaceutically acceptable excipients, including but not limited to one or more of the following: carrier, diluent, excipient, filler, binder, wetting agent, disintegrant, emulsifier, solubilizer, osmotic pressure regulator, surfactant, coating material, colorant, pH adjuster, antioxidant, antibacterial agent, buffer.

[0049] Specifically, the drug can be administered alone or formulated with excipients into a suitable dosage form for administration. The dosage forms of the antitumor drug include, but are not limited to, any one of tablets, powders, suspensions, granules, capsules, solutions, enemas, and emulsions.

[0050] In a preferred embodiment of the present invention, the antitumor drug is a single compound preparation or a combination of preparations of different active ingredients, which can be applied simultaneously, alternately, or sequentially.

[0051] The beneficial effects of this invention are:

[0052] Based on the phospholipid bilayer biomimetic nanoplatform, this invention constructs an ultrasound-responsive nanoparticle with a special structure and function based on the fusion of genetically engineered bacterial outer membrane vesicles and liposomes through co-extrusion technology. It can overcome the bottleneck of tumor immunotherapy through a triple synergistic mechanism: (1) immune targeting enhancement: PAMPs rich in OMVs in the fusion shell can be efficiently recognized by antigen-presenting cells in the tumor microenvironment, significantly improving the tumor antigen presentation efficiency; (2) intelligent immune regulation: GM-CSF released from the core strongly recruits DCs to the tumor microenvironment and promotes their maturation, establishing a continuous immune response hub; (3) sonodynamic-immune synergy: the sonosensitive agent embedded in the lipid bilayer bursts ROS under ultrasound irradiation, precisely inducing tumor cell ICD and releasing DAMPs, activating deep infiltration of cytotoxic T lymphocytes, and forming a positive feedback loop of anti-tumor immunity.

[0053] The nanoparticles provided by this invention have shown significant clinical translation potential: (1) cascade synergy: GM-CSF-mediated DC amplification / maturation and sonodynamically induced ICD form a cascade amplification effect, which greatly enhances the intensity of antigen-specific T cell responses; (2) long-lasting immune memory: by continuously releasing endogenous adjuvants (PAMPs / DAMPs) and cytokines, the immunosuppressive TME is remodeled and systemic immune memory is established; (3) clinical safety: the fusion structure combines the strong immunogenicity of OMVs with the low toxicity of liposomes, and ultrasound irradiation provides spatiotemporally controllable release, which has the advantages of high targeting and low systemic toxicity in the treatment of solid tumors. Attached Figure Description

[0054] Figure 1This is a schematic diagram of the preparation process of the ultrasound-responsive nanoparticles based on the fusion of genetically engineered bacterial outer membrane vesicles and liposomes according to the present invention.

[0055] Figure 2 Transmission electron microscopy image of OL@Ce6 nanoparticles prepared for the example.

[0056] Figure 3 This is a particle size distribution diagram of different nano-formulations in the experimental examples.

[0057] Figure 4 The diagram shows the zeta potentials of different nano-formulations in the experimental examples.

[0058] Figure 5 The figure shows the particle size stability results of the OL@Ce6 nanoparticles in PBS for 7 consecutive days in the experimental example.

[0059] Figure 6 The images show the full wavelength scans of the nanoparticles OL@Ce6, the acoustic sensor Ce6, and the nanocarrier Lip@Ce6 in the experimental example.

[0060] Figure 7 The image shows the cell viability of 4T1 cells after 24 hours of treatment with different drugs, determined by the CCK8 assay in the experimental example (data are expressed as mean ± standard deviation, n = 3).

[0061] Figure 8 The image shows the ROS level results of 4T1 cells in the experimental case.

[0062] Figure 9 The images show the pathological changes in lung tissue and the count of lung metastases in each group of mice in the experimental case.

[0063] Figure 10 This is a statistical chart showing the tumor size and weight of mice in each group after treatment with nanoparticles combined with anti-PD-1 in the experimental case.

[0064] To more clearly illustrate the technical solutions of the embodiments of the present invention, the accompanying drawings obtained in the experimental examples have been briefly described above. It should be understood that the above drawings only show some experimental examples of the present invention and should not be considered as any limitation on the scope of protection of the claims. For those skilled in the art, other related drawings can be obtained based on these drawings without any creative effort. Detailed Implementation

[0065] The technical solution of the present invention will be clearly and completely described below with reference to specific embodiments and experimental examples. However, those skilled in the art should understand that the embodiments are only used to illustrate the technical solution of the present invention and should not be regarded as limiting the scope of protection of the present invention. Based on the following embodiments, all other implementation schemes obtained by those skilled in the art without creative effort, such as implementation schemes obtained by modification, variation or simple substitution, should fall within the scope of protection of the present invention.

[0066] Unless otherwise specified, the experimental methods used in the following examples and experimental cases are conventional methods; the raw materials (including biological materials), reagents, culture media, instruments, etc. used are all commonly used in the field and commercially available to the public unless otherwise specified; the terms and abbreviations used have their conventional meanings in the field, such as PBS buffer being phosphate buffer.

[0067] Example

[0068] This embodiment provides an ultrasound-responsive nanoparticle based on the fusion of genetically engineered bacterial outer membrane vesicles and liposomes, which is obtained by co-extrusion of OMVs loaded with GM-CSF and liposomes loaded with the sonication agent Ce6, with a mass ratio of 1:1. The OMVs contain a plasmid expressing GM-CSF, the nucleotide sequence of which is shown in SEQ ID NO: 1, and the nucleotide sequence of GM-CSF is shown in SEQ ID NO: 2. The raw materials for the preparation of liposomes include lipid material and sonication agent, with a mass ratio of lipid material to sonication agent Ce6 of 3:1. The lipid material is composed of soybean lecithin, cholesterol, and DSPE-PEOz (the number average molecular weight of PEOz is 2000), with a molar ratio of 2:1:0.4.

[0069] This embodiment also provides a method for preparing ultrasound-responsive nanoparticles based on the fusion of genetically engineered bacterial outer membrane vesicles and liposomes (process flow diagram shown in Figure 1). Figure 1 (As shown), including the following steps:

[0070] (1) Extraction of OMVs from GM-CSF load:

[0071] (1.1) The plasmid expressing GM-CSF was transformed into non-pathogenic Escherichia coli DH5α and cultured at 37℃ and 180 rpm for 16 h.

[0072] (1.2) Collect the bacterial culture and centrifuge at 300×g for 10min.

[0073] (1.3) Take the supernatant and centrifuge at 2000×g for 10min.

[0074] (1.4) Take the supernatant and centrifuge at 10000×g for 30min.

[0075] (1.5) Take the supernatant and centrifuge at 120000×g for 70min.

[0076] (1.6) Discard the supernatant, wash the precipitate with PBS and centrifuge at 120000×g for 70min.

[0077] (1.7) Collect the precipitate, which is the OMVs loaded with GM-CSF, and store it at -80℃ for later use.

[0078] (2.1) Preparation of Lip@Ce6:

[0079] (2.1.1) Dissolve 1 mg of the sound-sensitive agent Ce6 in 2 mL of methanol to obtain solution A; dissolve soybean lecithin, cholesterol and DSPE-PEOz in dichloromethane at a molar ratio of 2:1:0.4 to obtain solution B; then mix solution A and solution B in a round-bottom flask in proportion and perform rotary evaporation (45℃ for 15 min). The organic solvent evaporates in the rotary evaporator, forming a lipid film at the bottom of the flask.

[0080] (2.1.2) Add 1 mL of PBS buffer to the lipid membrane and hydrate at room temperature for 10 min to obtain liposomes Lip@Ce6 loaded with sonosensitive agent.

[0081] (2.2) Preparation of OL@Ce6:

[0082] Liposomes Lip@Ce6 loaded with a sonic agent were mixed with OMVs loaded with GM-CSF in a certain proportion, and then co-extruded sequentially through polycarbonate membranes of 400 nm, 200 nm, and 100 nm using a liposome extruder to obtain ultrasonically responsive nanoparticles based on the fusion of genetically engineered bacterial outer membrane vesicles and liposomes.

[0083] This embodiment also provides an application of ultrasound-responsive nanoparticles based on the fusion of genetically engineered bacterial outer membrane vesicles and liposomes, including but not limited to one or more of the following aspects:

[0084] (1) Application in the preparation of antitumor drugs;

[0085] (2) Application in the preparation of drugs or formulations that recruit dendritic cells and promote their maturation;

[0086] (3) Application in the preparation of drugs that enhance T cell-mediated antitumor immune responses;

[0087] (4) Application in the preparation of drugs that inhibit lung metastasis of tumors (including promoting alveolar structure to normal and reducing lung metastases).

[0088] When the tumor is resistant to anti-PD-1 drugs, the nanoparticles in the drug can effectively inhibit the growth of anti-PD-1 resistant tumors and induce long-term immune memory effects.

[0089] This embodiment also provides an antitumor drug comprising a pharmacodynamic amount of ultrasound-responsive nanoparticles based on the fusion of genetically engineered bacterial outer membrane vesicles and liposomes, and an appropriate amount of pharmaceutically acceptable excipients.

[0090] In the OL@Ce6 nanoparticles provided in this embodiment, OMVs are rich in pathogen-associated molecular patterns, which can be efficiently taken up and presented by antigen-presenting cells, inducing specific immune responses. Granulocyte-macrophage colony-stimulating factor (GM-CSF) loaded onto the OMVs through genetic engineering can effectively recruit and promote the maturation of dendritic cells in the tumor microenvironment. Under ultrasound irradiation, the nanoparticles can responsively decompose and release a sonosensitive agent, generating a large amount of reactive oxygen species, inducing immunogenic death of tumor cells, thereby promoting the infiltration of more cytotoxic T lymphocytes into the tumor microenvironment and restoring T cell-mediated anti-tumor immune responses. The sonosensitive agent and cytokines work synergistically to significantly inhibit tumor growth, induce long-term immune memory effects, and effectively prevent tumor metastasis.

[0091] In this embodiment, the nucleotide sequence of the plasmid expressing GM-CSF is as follows:

[0092] GAATTCATGTGGCTGCAGAATTTACTTTTCCTGGGCATTGTGGTCTACAGCCTCTCAGCACCCACCCGCTC

[0093] ACCCATCACTGTCACCCGGCCTTGGAAGCATGTAGAGGCCATCAAAGAAGCCCTGAACCTCCTGGATGACATGCC

[0094] TGTCACGTTGAATGAAGAGGTAGAAGTCGTCTCTAACGAGTTCTCCTTCAAGAAGCTAACATGTGTGCAGACCCG

[0095] CCTGAAGATATTCGAGCAGGGTCTACGGGGCAATTTCACCAAACTCAAGGGCGCCTTGAACATGACAGCCAGCTA

[0096] CTACCAGACATACTGCCCCCCAACTCCGGAAACGGACTGTGAAACACAAGTTACCACCTATGCGGATTTCATAGA

[0097] CAGCCTTAAAACCTTTCTGACTGATATCCCCTTTGAATGCAAAAAACCAGGCCAAAAATGAGGATCCGTCGACCT

[0098] GCAGCCAAGCTTGGCTGTTTTGGCGGATGAGAGAAGATTTTCAGCCTGATACAGATTAAATCAGAACGCAGAAGC

[0099] GGTCTGATAAAACAGAATTTGCCTGGCGGCAGTAGCGCGGTGGTCCCACCTGACCCCATGCCGAACTCAGAAGTG

[0100] AAACGCCGTAGCGCCGATGGTAGTGTGGGGTCTCCCCATGCGAGAGTAGGGAACTGCCAGGCATCAAATAAAACG

[0101] AAAGGCTCAGTCGAAAGACTGGGCCTTTCGTTTTATCTGTTGTTTGTCGGTGAACGCTCTCCTGAGTAGGACAAA

[0102] TCCGCCGGGAGCGGATTTGAACGTTGCGAAGCAACGGCCCGGAGGGTGGCGGGCAGGACGCCCGCCATAAACTGC

[0103] CAGGCATCAAATTAAGCAGAAGGCCATCCTGACGGATGGCCTTTTTGCGTTTCTACAAACTCTTTTGTTTATTTT

[0104] TCTAAATACATTCAAATATGTATCCGCTCATGAGACAATAACCCTGATAAATGCTTCAATAATATTGAAAAAGGA

[0105] AGAGTATGAGTATTCAACATTTCCGTGTCGCCCTTATTCCCTTTTTTGCGGCATTTTGCCTTCCTGTTTTTGCTC

[0106] ACCCAGAAACGCTGGTGAAAGTAAAAGATGCTGAAGATCAGTTGGGTGCACGAGTGGGTTACATCGAACTGGATC

[0107] TCAACAGCGGTAAGATCCTTGAGAGTTTTCGCCCCGAAGAACGTTTTCCAATGATGAGCACTTTTAAAGTTCTGC

[0108] TATGTGGCGCGGTATTATCCCGTGTTGACGCCGGGCAAGAGCAACTCGGTCGCCGCATACACTATTCTCAGAATG

[0109] ACTTGGTTGAGTACTCACCAGTCACAGAAAAGCATCTTACGGATGGCATGACAGTAAGAGAATTATGCAGTGCTG

[0110] CCATAACCATGAGTGATAACACTGCGGCCAACTTACTTCTGACAACGATCGGAGGACCGAAGGAGCTAACCGCTT

[0111] TTTTGCACAACATGGGGGATCATGTAACTCGCCTTGATCGTTGGGAACCGGAGCTGAATGAAGCCATACCAAACG

[0112] ACGAGCGTGACACCACGATGCCTGTAGCAATGGCAACAACGTTGCGCAAACTATTAACTGGCGAACTACTTACTC

[0113] TAGCTTCCCGGCAACAATTAATAGACTGGATGGAGGCGGATAAAGTTGCAGGACCACTTCTGCGCTCGGCCCTTC

[0114] CGGCTGGCTGGTTTATTGCTGATAAATCTGGAGCCGGTGAGCGTGGGTCTCGCGGTATCATTGCAGCACTGGGGC

[0115] CAGATGGTAAGCCCTCCCGTATCGTAGTTATCTACACGACGGGGAGTCAGGCAACTATGGATGAACGAAATAGAC

[0116] AGATCGCTGAGATAGGTGCCTCACTGATTAAGCATTGGTAACTGTCAGACCAAGTTTACTCATATATACTTTAGA

[0117] TTGATTTAAAACTTCATTTTTAATTTAAAAGGATCTAGGTGAAGATCCTTTTTGATAATCTCATGACCAAAATCC

[0118] CTTAACGTGAGTTTTCGTTCCACTGAGCGTCAGACCCCGTAGAAAAGATCAAAGGATCTTCTTGAGATCCTTTTT

[0119] TTCTGCGCGTAATCTGCTGCTTGCAAACAAAAAAACCACCGCTACCAGCGGTGGTTTGTTTGCCGGATCAAGAGC

[0120] TACCAACTCTTTTTCCGAAGGTAACTGGCTTCAGCAGAGCGCAGATACCAAATACTGTTCTTCTAGTGTAGCCGT

[0121] AGTTAGGCCACCACTTCAAGAACTCTGTAGCACCGCCTACATACCTCGCTCTGCTAATCCTGTTACCAGTGGCTG

[0122] CTGCCAGTGGCGATAAGTCGTGTCTTACCGGGTTGGACTCAAGACGATAGTTACCGGATAAGGCGCAGCGGTCGG

[0123] GCTGAACGGGGGGTTCGTGCACACAGCCCAGCTTGGAGCGAACGACCTACACCGAACTGAGATACCTACAGCGTG

[0124] AGCTATGAGAAAGCGCCACGCTTCCCGAAGGGAGAAAGGCGGACAGGTATCCGGTAAGCGGCAGGGTCGGAACAG

[0125] GAGAGCGCACGAGGGAGCTTCCAGGGGGAAACGCCTGGTATCTTTATAGTCCTGTCGGGTTTCGCCACCTCTGAC

[0126] TTGAGCGTCGATTTTTGTGATGCTCGTCAGGGGGGCGGAGCCTATGGAAAAACGCCAGCAACGCGGCCTTTTTAC

[0127] GGTTCCTGGCCTTTTGCTGGCCTTTTGCTCACATGTTCTTTCCTGCGTTATCCCCTGATTCTGTGGATAACCGTA

[0128] TTACCGCCTTTGAGTGAGCTGATACCGCTCGCCGCAGCCGAACGACCGAGCGCAGCGAGTCAGTGAGCGAGGAAG

[0129] CGGAAGAGCGCTTATCTTTCCCTTTATTTTTGCTGCGGTAAGTCGCATAAAAACCATTCTTCATAATTCAATCCA

[0130] TTTACTATGTTATGTTCTGAGGGGAGTGAAAATTCCCCTAATTCGATGAAGATTCTTGCTCAATTGTTATCAGCT

[0131] ATGCGCCGACCAGAACACCTTGCCGATCAGCCAAACGTCTCTTCAGGCCACTGACTAGCGATAACTTTCCCCACA

[0132] ACGGAACAACTCTCATTGCATGGGATCATTGGGTACTGTGGGTTTAGTGGTTGTAAAAACACCTGACCGCTATCC

[0133] CTGATCAGTTTCTTGAAGGTAAACTCATCACCCCCAAGTCTGGCTATGCAGAAATCACCTGGCTCAACAGCCTGC

[0134] TCAGGGTCAACGAGAATTAACATTCCGTCAGGAAAGCTTGGCTTGGAGCCTGTTGGTGCGGTCATGGAATTACCT

[0135] TCAACCTCAAGCCAGAATGCAGAATCACTGGCTTTTTTGGTTGTGCTTACCCATCTCTCCGCATCACCTTTGGTA

[0136] AAGGTTCTAAGCTTAGGTGAGAACATCCCTGCCTGAACATGAGAAAAAACAGGGTACTCATACTCACTTCTAAGT

[0137] GACGGCTGCATACTAACCGCTTCATACATCTCGTAGATTTCTCTGGCGATTGAAGGGCTAAATTCTTCAACGCTA

[0138] ACTTTGAGAATTTTTGTAAGCAATGCGGCGTTATAAGCATTTAATGCATTGATGCCATTAAATAAAGCACCAACG

[0139] CCTGACTGCCCCATCCCCATCTTGTCTGCGACAGATTCCTGGGATAAGCCAAGTTCATTTTTCTTTTTTTCATAA

[0140] ATTGCTTTAAGGCGACGTGCGTCCTCAAGCTGCTCTTGTGTTAATGGTTTCTTTTTTGTGCTCATACGTTAAATC

[0141] TATCACCGCAAGGGATAAATATCTAACACCGTGCGTGTTGACTATTTTACCTCTGGCGGTGATAATGGTTGCATG

[0142] TACTAAGGAGGTTGTATGGAACAACGCATAACCCTGAAAGATTATGCAATGCGCTTTGGGCAAACCAAGACAGCT

[0143] AAAGATCTCTCACCTACCAAACAATGCCCCCCTGCAAAAAATAAATTCATATAAAAAACATACAGATAACCATCT

[0144] GCGGTGATAAATTATCTCTGGCGGTGTTGACATAAATACCACTGGCGGTGATACTGAGCACATCAGCAGGACGCA

[0145] CTGACCACCATGAAGGTGACGCTCTTAAAAATTAAGCCCTGAAGAAGGGCAGCATTCAAAGCAGAAGGCTTTGGG

[0146] GTGTTGTGATACGAAACGAAGCATTGGTTAAAAATTAAGGAGG (SEQ ID NO: 1).

[0147] The nucleotide sequence of GM-CSF is as follows:

[0148] ATGTGGCTGCAGAATTTACTTTTCCTGGGCATTGTGGTCTACAGCCTCTCAGCACCCACCCGCTCACCCAT

[0149] CACTGTCACCCGGCCTTGGAAGCATGTAGAGGCCATCAAAGAAGCCCTGAACCTCCTGGATGACATGCCTGTCAC

[0150] GTTGAATGAAGAGGTAGAAGTCGTCTCTAACGAGTTCTCCTTCAAGAAGCTAACATGTGTGCAGACCCGCCTGAA

[0151] GATATTCGAGCAGGGTCTACGGGGCAATTTCACCAAACTCAAGGGCGCCTTGAACATGACAGCCAGCTACTACCA

[0152] GACATACTGCCCCCCAACTCCGGAAACGGACTGTGAAACACAAGTTACCACCTATGCGGATTTCATAGACAGCCT

[0153] TAAAACCTTTCTGACTGATATCCCCTTTGAATGCAAAAAACCAGGCCAAAAATGA (SEQ ID NO: 2).

[0154] In other embodiments of the present invention, the raw materials and preparation conditions for the nanoparticles can be arbitrarily selected within a given range, wherein the acoustic sensitizer Ce6 has a better anti-tumor effect and can effectively inhibit tumor metastasis.

[0155] In other embodiments of the present invention, the amount of each component in the nanoparticles can be arbitrarily selected within a given range without significantly affecting the physicochemical properties, biological functions, and therapeutic effects of the nanoparticles.

[0156] Experimental Example

[0157] 1. Morphology testing of OL@Ce6 nanoparticles

[0158] A small amount of OL@Ce6 was diluted to 0.2 mg / mL with PBS. 20 μL of the suspension was repeatedly dropped onto a carbon-coated copper grid. After drying for 10 minutes, excess nanomaterials were absorbed with filter paper. The copper grid was then stained with 20 μL of 2% uranium acetate in the dark for 2 minutes. After drying, the morphology of the nanomaterials was observed and photographed using a transmission electron microscope. The results are as follows: Figure 2 As shown.

[0159] 2. Particle size and zeta potential analysis of OL@Ce6 nanoparticles

[0160] A small amount of liposomes (blank liposomes without Ce6 and OMVs), OMVs, Lip@Ce6, and OL@Ce6 prepared in the examples or reference examples were taken; the samples were diluted with PBS, and the particle size and polydispersity index (PDI) of the samples were determined using a particle size analyzer. The particle size was measured daily for one week to assess the stability of the nanomaterials. The potentials of liposomes Lip, OMVs, Lip@Ce6, and OL@Ce6 were measured using a potentiometer in the same manner. The obtained data were processed and analyzed using GraphPadPrism.

[0161] The particle size analysis results for each sample group are as follows: Figure 3 As shown, by optimizing the ratio of soybean phospholipids, cholesterol and DSPE-PEOz, liposomes with a particle size of (94.7±3.77) nm were synthesized. With further modification, the hydrated particle size gradually increased, and the hydrated particle size of nanoparticles OL@Ce6 was (142.2±6.75) nm.

[0162] The zeta potential detection results for each sample group are as follows: Figure 4 As shown, the potential of liposomes (Lip) was (-25.3 ± 0.96) mV. With Ce6 loading, the potential decreased to (-37.3 ± 1.45) mV, where positive and negative represent the positive or negative charge of the particles. OMVs are negatively charged, so after the liposomes and OMVs were fused and extruded, the potential of the nanocomposite further decreased to (-45.3 ± 1.27) mV, which is consistent with the expected results.

[0163] The particle size analysis results of OL@Ce6 nanoparticles after 7 days of storage are as follows: Figure 5 As shown, the hydrodynamic diameter of the OL@Ce6 nanoparticles remained essentially unchanged after 7 days in PBS, indicating that the nanoparticles have stable and uniform particle size and good biological stability.

[0164] 3. Ultraviolet full-wavelength scanning of OL@Ce6 nanoparticles

[0165] The loading of Ce6 on the nanocarrier was determined using a UV spectrophotometer. Free Ce6, Lip@Ce6, and OL@Ce6 nanoparticles were diluted and scanned in the wavelength range of 300-700 nm using a UV spectrophotometer.

[0166] The results are as follows Figure 6 As shown, the nanoparticles OL@Ce6 exhibit significant ultraviolet absorption at the absorption wavelengths of Ce6, namely 402 nm and 662 nm, indicating the successful construction of this nanocomposite.

[0167] 4. Anti-tumor study of OL@Ce6 nanoparticles at the cell level

[0168] (1) CCK8 assay to assess cytotoxicity

[0169] First, 4T1 cells were seeded into 96-well plates. After cell adhesion, drugs were administered, with different drug concentrations designated as experimental groups and complete culture medium supplemented with an equal volume of PBS buffer as the control group. 4T1 cells were incubated with Ce6, Lip@Ce6, and OL@Ce6 at different drug concentrations for 12 h, followed by ultrasound irradiation (US) with or without, and then incubated for another 12 h. The drug-containing culture medium was discarded, and 100 μL of fresh culture medium and 10 μL of CCK8 solution were added to each well. The cells were then incubated for 2 h in a 5% CO2 environment at 37°C in the dark. The absorbance of each well was measured at 450 nm using a microplate reader, and the cell viability of each experimental group was calculated to evaluate the toxicity of the constructed nanomaterials to tumor cells. The experiment was repeated three times (the amount of drug used in each treatment group was kept consistent; that is, the amount of Ce6 in the OL@Ce6 group was the same as that in the Lip@Ce6 group and the Ce6 group, and subsequent experiments were the same).

[0170] The experimental results of the 4T1 cell group are as follows: Figure 7 As shown, the cell survival rate of the OL@Ce6 nanoparticle treatment group was lower than that of the free Ce6 and Lip@Ce6 treatment groups, indicating that OL@Ce6 can selectively accumulate in tumor cells and enhance its anti-tumor effect. The cell survival rate of all experimental groups treated with ultrasound was lower than that of the untreated group. This is because the ultrasound response is more conducive to Ce6 generating reactive oxygen species, inducing immunogenic cell death in tumor cells. Furthermore, the cell survival rate of the OL@Ce6 treatment group was lower than that of the Lip@Ce6 treatment group, mainly attributed to the increased active targeting of the nanoparticles to tumor cells by the increased loading of OMVs.

[0171] (2) Intracellular ROS levels were detected by staining with the fluorescent dye 2,7-dichlorodihydrofluorescein (DCFH-DA).

[0172] 4T1 cells (1×10) 5Cells were seeded at 6-well plates with PBS, PBS (+US), free Ce6, free Ce6 (+US), Lip@Ce6, Lip@Ce6 (+US), OL@Ce6, and OL@Ce6 (+US), respectively, and co-incubated for 6 h. Cells requiring sonication were then irradiated with ultrasound. After 4 h, the culture medium was discarded, and the cells were washed with cold PBS. Cells were then incubated with a 5 μL LDCFH-DA (10 mM) probe for 40 min, and the fluorescence intensity was observed under a fluorescence microscope.

[0173] The results are as follows Figure 8 As shown, 4T1 cells in the free Ce6(+US) group exhibited increased green fluorescence, attributed to ROS generated by Ce6 sonodynamic therapy. 4T1 cells treated with Lip@Ce6(+US) and OL@Ce6(+US) showed stronger green fluorescence than the free Ce6(+US) group, attributed to the efficient drug delivery capability of the nanocarriers. The significantly enhanced green fluorescence in OL@Ce6(+US)-treated cells indicates that loading OMVs increases the internalization efficiency of OL@Ce6 nanoparticles by tumor cells.

[0174] 5. Anti-tumor metastasis study of OL@Ce6 nanoparticles in animals

[0175] (1) 4T1 cells (1×10 6 The tumor was resuspended in PBS and injected subcutaneously into the right back of mice to construct a 4T1 subcutaneous tumor model.

[0176] (2) Seven days later, the mice were randomly divided into four groups, with an average tumor volume of 100 mm in each group. 3 (n=5). Mice were then injected via tail vein with PBS (G1), free Ce6(+US)(G2), OMVs (G3), and OL@Ce6(+US)(G4) (Ce6 at 7 mg / kg). Groups requiring sonication underwent ultrasound irradiation 24 hours after administration. After receiving different treatments, mice in each group were injected via tail vein with 4T1 cells (3 × 10⁶ cells per mouse). 5 A lung metastasis model was established using 100 cells. On day 15 after injection, the mice were dissected to collect lung tissue. After washing with PBS, metastatic tumor foci were counted, fixed with 4% tissue fixative, and then stained with H&E to evaluate the inhibitory effect of different treatments on lung metastasis.

[0177] H&E slice images of the lungs and the results of lung metastasis counts in each group of mice are as follows: Figure 9 As shown, the G4 group significantly inhibited lung metastasis of tumors, with alveolar structure tending to normalize and lung metastases reduced, indicating that OL@Ce6 nanoparticles can delay tumor metastasis to the maximum extent under ultrasound irradiation.

[0178] 6. Animal-level anti-tumor studies using OL@Ce6 nanoparticles in combination with anti-PD-1

[0179] (1) 4T1 cells (1×10 6 The tumor was resuspended in PBS and injected subcutaneously into the right back of mice to construct a 4T1 subcutaneous tumor model.

[0180] (2) Seven days later, the mice were randomly divided into four groups, with an average tumor volume of 100 mm in each group. 3 (n=5). Antitumor experiments were conducted using OL@Ce6 nanoparticles in combination with anti-PD-1: PBS (G1), anti-PD-1 (G2), OL@Ce6(+US)(G3), and anti-PD-1+OL@Ce6(+US)(G4) (Ce6 was 7 mg / kg). Groups G3 and G4 were subjected to ultrasound irradiation 24 h after drug administration.

[0181] (3) At the end of the experiment, the tumor was collected for optical photography and weighing.

[0182] Tumor status of mice in each group as follows Figure 10 As shown, compared with other treatment groups, the anti-PD-1+OL@Ce6(+US) group had the highest tumor inhibition rate, indicating that the combination of nanoparticles OL@Ce6 and anti-PD-1 has a significant inhibitory effect on tumor growth.

[0183] The engineered platform (OL@Ce6) developed in this invention represents a novel integration of GM-CSF-expressing outer membrane vesicles with ultrasound-responsive liposomes containing dihydroporphyrin e6 (Ce6) as a sonosensitive agent. OL@Ce6 nanoparticles reach the tumor microenvironment and decompose upon ultrasound stimulation, thereby achieving spatiotemporal release of GM-CSF. Simultaneously, ultrasound irradiation triggers Ce6-mediated reactive oxygen species (ROS) generation, inducing immunogenic cell death (ICD). This process releases tumor-associated antigens (TAAs) and damage-associated molecular patterns (DAMPs) such as adenosine triphosphate (ATP) and high-mobility group box 1 (HMGB1), further enhancing dendritic cell (DC) activation. The locally released GM-CSF then promotes the maturation of these antigen-loaded DCs, enabling them to migrate efficiently to draining lymph nodes, where they initiate a tumor-specific T-cell response. The activated T cells infiltrate and eliminate tumor cells, thus establishing a self-sustaining anti-tumor immune cycle.

[0184] In a mouse model of breast cancer, this integrated approach has demonstrated significant therapeutic effects, including enhanced immune cell infiltration, significant tumor regression, effective metastasis inhibition, and good safety. By combining the immunogenicity of bacterial vesicles with responsive drug delivery, the immunosuppressive effects of the tumor microenvironment are effectively overcome, establishing durable anti-tumor immunity and providing a clinically translatable solution for cancer immunotherapy.

[0185] Although the technical solution of the present invention has been described in detail above with general descriptions, specific embodiments, and experimental examples, it should be noted that the embodiments and experimental examples are only used to illustrate the technical solution and technical effects of the present invention, and should not be regarded as any limitation on the scope of protection of the present invention. Simple modifications, alterations, or improvements made based on the technical concept of the present invention are all within the scope of protection claimed by the present invention.

Claims

1. An ultrasound-responsive nanoparticle based on the fusion of genetically engineered bacterial outer membrane vesicles and liposomes, characterized in that: The raw materials for preparing the nanoparticles include OMVs loaded with GM-CSF and liposomes loaded with a sonication agent.

2. The nanoparticles according to claim 1, characterized in that: The mass ratio of the GM-CSF-loaded OMVs to the liposomes loaded with the sound-sensing agent is (1-5):(1-5); And / or, the OMVs loaded with GM-CSF contain plasmids expressing GM-CSF; And / or, the raw materials for preparing the liposomes include lipid material and a sound-sensitizing agent, wherein the mass ratio of lipid material to sound-sensitizing agent is (3-15):(1-5), and the lipid material includes, but is not limited to, one or more of phospholipids, cholesterol, and DSPE-PEOz; And / or, the sound-sensitive agent includes, but is not limited to, one or more of dihydroporphyrin E6 and hematoporphyrin monomethyl ether.

3. The nanoparticles according to claim 2, characterized in that: The nucleotide sequence of the plasmid expressing GM-CSF is shown in SEQ ID NO: 1; And / or, the lipid material includes phospholipids, cholesterol and DSPE-PEOz, with a molar ratio of (1-3):(0.5-1.5):(0.2-0.6), and the number average molecular weight of PEOz in DSPE-PEOz is 1000-4000.

4. The nanoparticles according to claim 1, characterized in that: The liposomes loaded with the sound-sensing agent have a particle size of 80-110 nm; And / or, the nanoparticles have a particle size of 120-180 nm.

5. A method for preparing ultrasound-responsive nanoparticles based on the fusion of genetically engineered bacterial outer membrane vesicles and liposomes as described in any one of claims 1-4, characterized in that: Includes the following steps: OMVs loaded with GM-CSF were mixed with liposomes loaded with a sound-sensing agent and then co-extruded to obtain nanoparticles.

6. The preparation method according to claim 5, characterized in that: The method for preparing GM-CSF-loaded OMVs includes: transforming a plasmid expressing GM-CSF into Gram-negative bacteria for culture, and then performing differential ultracentrifugation on the cultured bacterial solution to obtain GM-CSF-loaded OMVs. And / or, the method for preparing the liposomes loaded with the sound-sensitizing agent includes: mixing a solution of dissolving the lipid material with a solution of dissolving the sound-sensitizing agent, removing the solvent to obtain a lipid film; and hydrating the lipid film to obtain liposomes loaded with the sound-sensitizing agent.

7. The preparation method according to claim 6, characterized in that: The Gram-negative bacteria include, but are not limited to, Escherichia coli; And / or, the specific operations of the differential ultracentrifugation include: Collect the bacterial culture and centrifuge at 200-400×g for 5-20 min; Centrifuge the supernatant at 1500-3000×g for 5-20 min; Centrifuge the supernatant at 8000-12000×g for 20-40 min; Centrifuge the supernatant at 100,000-150,000 × g for 50-100 min; Discard the supernatant, wash the precipitate and centrifuge at 100,000-150,000×g for 50-100 min; Collect the precipitate, which is the OMVs loaded with GM-CSF; And / or, the co-extrusion comprises passing polycarbonate films sequentially through 400 nm, 200 nm, and 100 nm.

8. An application of an ultrasound-responsive nanoparticle based on the fusion of genetically engineered bacterial outer membrane vesicles and liposomes as described in any one of claims 1-4, characterized in that: Including but not limited to one or more of the following aspects: (1) Application in the preparation of antitumor drugs; (2) Application in the preparation of drugs or formulations that recruit dendritic cells and promote their maturation; (3) Application in the preparation of drugs that enhance T cell-mediated antitumor immune responses; (4) Application in the preparation of drugs that inhibit lung metastasis of tumors.

9. An antitumor drug, characterized in that: The antitumor drug includes a pharmaceutically effective amount of ultrasound-responsive nanoparticles based on the fusion of genetically engineered bacterial outer membrane vesicles and liposomes as described in any one of claims 1-4.

10. The antitumor drug according to claim 9, characterized in that: The anti-tumor drug also includes other anti-tumor pharmacological components, including but not limited to anti-PD-1 / PD-L1 antibodies; And / or, the antitumor drug further includes pharmaceutically acceptable excipients, including but not limited to one or more of the following: carrier, diluent, excipient, filler, binder, wetting agent, disintegrant, emulsifier, solubilizer, solvent, osmotic pressure regulator, surfactant, coating material, colorant, pH adjuster, antioxidant, antibacterial agent, and buffer. And / or, the dosage form of the antitumor drug includes, but is not limited to, any one of tablets, powders, suspensions, granules, capsules, solutions, enemas, and emulsions.

Images