Method for synchronously constructing Clcn3 gene point mutation and knocking out mice and application

Abstract

The invention relates to the technical field of gene editing, in particular to a method for synchronously constructing a mouse model with the point mutation (Knockin, KI) of a Clcn3 gene p.T570I and the knockout (Knockout, KO) of the Clcn3 gene by utilizing a CRISPR-Cas9 (clustered regularly interspaced short palindromic repeats-associated protein 9) system and application of the mouse model. By optimizing a gRNA targeting site and a donor oligonucleotide sequence, efficient introduction of Clcn3 gene p.T570I point mutation is achieved, and the mutation efficiency is improved by 30% or above compared with a traditional method; the constructed Clcn3 gene p.T570I KI and KO mouse models can be used for stably inheriting target mutation. The method is short in period, low in cost and suitable for large-scale gene editing animal model construction, the first Clcn3 gene p.T570I KI mouse model carrying the human pathogenic mutation site in the world is constructed, and an ideal and reliable genetic tool is provided for deep analysis of the physiological function of the CLCN3 gene and related disease mechanisms.

Description

Technical Field

[0001] This invention relates to the field of gene editing technology, specifically to a method for simultaneously constructing Clcn3 gene p.T570I point mutation (Knockin, KI) and Clcn3 gene knockout (Knockout, KO) mouse models using the CRISPR-Cas9 system, and its application. Background Technology

[0002] Voltage-gated chlorine-hydrogen transporter 3 (CLCN3) is a 2Cl- / H⁺ exchanger primarily located on late endosomes and lysosomal membranes. It regulates vesicle transport, neurotransmitter loading and release at synapses, neuronal development, and cellular homeostasis by providing an electrically neutralizing current to the proton pump, driving vesicle acidification and promoting Cl⁻ accumulation within the lumen. In 2021, the CLCN3 gene was identified as a pathogenic gene for neurodevelopmental disorders (NDDs). The Lys112Asnfs* homozygous frameshift variant results in complete loss of ClC-3 protein function, with patients exhibiting severe developmental delay, seizures, retinal-cortical degeneration, and hippocampal loss, highly similar to the phenotype of Clcn3 gene knockout mice. Clcn3 gene knockout mice also exhibit growth retardation, hyperactivity, severe retinal and neuronal degeneration, and near-complete hippocampal loss. Electrophysiological analysis showed that the p.T570I and p.I607T variants of the CLCN3 gene significantly increased the inward current under acidic conditions, exhibiting gain-of-function (GOF) characteristics. This abnormally enhanced current may interfere with the normal gating process of the protein in an acidic environment, thereby triggering NDDs. In summary, both loss-of-function (LOF) and GOF variants of the CLCN3 gene can cause NDDs, but the specific molecular pathogenic mechanism remains unclear.

[0003] Constructing precise Clcn3 animal models that mimic human pathogenic mutations has been a persistent challenge due to the lack of efficient gene editing tools. Previous reports on Clcn3 gene knockout mouse models have all employed homologous recombination. However, traditional gene targeting techniques suffer from long operation cycles, high costs, low efficiency, and the potential introduction of exogenous selection marker genes that interfere with target function. While the CRISPR / Cas9 system is widely used in gene editing, optimizing gRNA targeting strategies and homologous targeted repair donor design is still necessary to improve editing efficiency when precisely introducing single nucleotide variants (such as point mutations). Therefore, innovative methods, technologies, or models are urgently needed to efficiently and accurately construct Clcn3 gene knockout mouse models and KI mouse models carrying the Clcn3 gene p.T570I GOF mutation at human pathogenic mutation sites. Summary of the Invention

[0004] This invention innovatively develops a highly efficient and precise method for simultaneously constructing a Clcn3 gene KO mouse model and a KI mouse model carrying the Clcn3 gene p.T570I GOF mutation at a human pathogenic mutation site. By constructing and studying the Clcn3 gene KO mouse model (simulating LOF) and the KI mouse model (simulating GOF) with the precise introduction of a GOF pathogenic mutation (such as p.T570I) at the Clcn3 gene site, the impact of CLCN3 LOF and GOF variations on neural development can be effectively simulated. This allows for a deeper understanding of the role of this gene in neural development and the molecular mechanisms by which its variations lead to NDDs. The mouse models constructed in this invention will provide an important tool for elucidating the pathogenic mechanisms of CLCN3 gene LOF / GOF in NDDs and lay a theoretical and experimental foundation for targeted intervention of NDDs.

[0005] The first aspect of this invention provides a method for constructing Clcn3 gene p.T570I KI and Clcn3 gene KO mice, comprising the following steps: (1) Design and synthesize gRNA targeting the mouse Clcn3 gene, wherein the gRNA sequence includes gRNA-A1 and gRNA-B1; prepare donor oligonucleotides containing the ACT→ATA mutation; (2) Mix the gRNA-A1 and gRNA-B1, donor oligonucleotides and Cas9 protein described in (1) to form a microinjection system and inject it into mouse fertilized eggs; perform PCR and DNA sequencing identification on the F0 generation mice born; The gRNA-A1 sequence is shown in SEQ.ID.NO.1: 5'-GGGGCTGACTGCATCACTCCCGG-3'; The gRNA-B1 sequence is shown in SEQ.ID.NO.2: 5'-GGGCTGACTGCATCACTCCCGGG-3'.

[0006] Furthermore, the PCR product was sequenced using F1 primers to confirm the ACT→ATA mutation; The PCR primers are as follows: Primer F1 is shown in SEQ.ID.NO.3: 5'-GTCCCGTCAGGCTTGTTTATCC-3'; Primer R1 is shown in SEQ.ID.NO.4: 5'-AAGGCTATGTTGTACCAAGATGGTTTC-3'; PCR cycling conditions: Pre-denaturation at 94℃ for 3 minutes (minute, min); 94℃ denaturation for 30 seconds, 60℃ annealing for 30 seconds, 65℃ extension for 50 seconds / kb (33 cycles in total); Extend the heat to 65°C for 10 minutes.

[0007] In the microinjection system, the concentration of gRNA (i.e., gRNA-A1 and gRNA-B1) is 100 ng / μL, the concentration of donor oligonucleotides is 25-50 ng / μL, and the concentration of Cas9 protein is 50-100 ng / μL.

[0008] Preferably, gRNA1 is 100 ng / μL, donor is 25 ng / μL, and Cas9 is 50 ng / μL.

[0009] The PCR reaction system contains: 2 μL of genomic DNA, 2 μL of F1 primer (10 μM), 2 μL of R1 primer (10 μM), 6 μL of dNTPs (2.5 mM), 10 μL of 5X LongAmp Taq Buffer, 2 μL of LongAmp Taq enzyme, and water to a final volume of 50 μL.

[0010] In a second aspect, the application of Clcn3 gene p.T570I KI and Clcn3 gene KO mice constructed by the above method in the preparation of research models for nervous system diseases.

[0011] The Clcn3 gene exon 10 of the Clcn3 gene in the Clcn3 gene KO mice had two CT bases deleted (see [link]). Figure 2 The Clcn3 gene in p.T570I KI mice contains an ACT→ATA point mutation in exon 10 of the Clcn3 gene (see...). Figure 3 ).

[0012] gRNA Design and Synthesis: Two specific gRNAs targeting the mouse Clcn3 gene were designed and screened, with the following sequences: gRNA-A1: 5'-GGGGCTGACTGCATCACTCCCGG-3' gRNA-B1: 5'-GGGCTGACTGCATCACTCCCGGG-3' Donor oligonucleotide preparation: Synthesize single-stranded oligonucleotide donors carrying the p.T570I mutation (ACT→ATA) for homologous recombination repair.

[0013] Construction of microinjection system: gRNA, donor oligonucleotides and Cas9 protein were mixed to prepare microinjection solution.

[0014] Injection and transfer of fertilized eggs: The injection solution was injected into the pronucleus of fertilized eggs from C57BL / 6J mice and then transferred to pseudopregnant recipient mice.

[0015] F0 generation mouse genotyping: F0 generation mice carrying the target mutation were identified and screened using PCR and DNA sequencing, specifically including: PCR primers: Forward primer F1: 5'-GTCCCGTCAGGCTTGTTTATCC-3' Reverse primer R1: 5'-AAGGCTATGTTGTACCAAGATGGTTTC-3' PCR conditions: annealing temperature 60℃, 33 cycles.

[0016] Sequencing verification: The PCR product was sequenced using F1 primers to confirm the ACT→ATA mutation.

[0017] The beneficial effects of this invention are: (1) This invention precisely designs and synthesizes gRNA targeting exon 10 of the mouse Clcn3 gene; prepares donor oligonucleotides containing the ACT→ATA (T570I) mutation; mixes gRNA, donor oligonucleotides and Cas9 protein and co-injects into C57BL / 6J mouse zygotes to generate a Clcn3 gene p.T570I KI mouse model; during this process, gRNA causes the deletion of two bases "CT" in exon 10 and the premature appearance of the stop codon in exon 11, thereby generating a Clcn3 gene KO mouse model. The F0 generation mice born were verified by PCR and DNA sequencing; this invention achieves efficient introduction of Clcn3 gene p.T570I KI by optimizing the gRNA target site and donor oligonucleotide sequence, and the mutation efficiency is more than 30% higher than that of traditional methods.

[0018] (2) The constructed Clcn3 gene KO and p.T570I KI mouse models can stably inherit the target mutation, providing a reliable animal model for studying the function of the Clcn3 gene and related diseases. This invention is the first to obtain a whole-body KO mouse model of the Clcn3 gene using CRISPR-Cas9 gene editing, and constructs the world's first Clcn3 gene p.T570I KI mouse model carrying a human pathogenic mutation site, providing an ideal and reliable genetic tool for in-depth analysis of the physiological function of the CLCN3 gene and its related disease mechanisms.

[0019] (3) This method has a short operation cycle (only 8-10 weeks from injection to obtaining F0 generation mice), low cost, and is suitable for large-scale gene editing animal model construction. Attached Figure Description

[0020] Figure 1 A schematic diagram illustrating the strategy for constructing Clcn3 gene p.T570I KI and Clcn3 gene KO mice.

[0021] Figure 2 Schematic diagram of PCR sequencing for identifying Clcn3 gene KO F1 heterozygous and F2 homozygous mice: Wild-type (WT) Clcn3+ / + is ACT; heterozygous Clcn3+ / - is ACC and ACT; homozygous Clcn3- / - is ACC.

[0022] Figure 3 The diagram shows the DNA sequencing results of heterozygous F1 and homozygous F2 mice for the Clcn3 gene p.T570I KI: WT Clcn3+ / + represents ACT; heterozygous Clcn3+ / p.T570I represents ATA and ACT; and homozygous Clcn3 / p.T570I / / p.T570I represents ATA.

[0023] Figure 4 The image shows the results of the Clcn3 gene p.T570I KI and Clcn3 gene KO mouse animal models constructed based on CRISPR / cas9.

[0024] Figure 5 Real-time quantitative PCR for Clcn3 gene p.T570I KI and Clcn3 gene KO mice.

[0025] Figure 6 The image shows the results of hippocampal neurodegenerative changes in Clcn3 gene knockout mice.

[0026] Figure 7 This image shows the retinal degenerative changes in Clcn3 gene KO mice.

[0027] Figure 8Image showing the results of sagittal Golgi body staining in p.T570I KI mice with Clcn3 gene. Detailed Implementation

[0028] Example 1: Preparation of Clcn3 gene p.T570I KI F0 generation mice Clcn3 gene KO mouse construction strategy, such as Figure 1 As shown.

[0029] I. Experimental Materials Laboratory animals: WT C57BL / 6J mice (SPF grade, 8-10 weeks old), purchased from Beijing Vital River Laboratory Animal Technology Co., Ltd.

[0030] Main reagents: Cas9 protein (NEB, M0386M) gRNA Synthesis Kit (IDT) Donor oligonucleotides (bioengineering synthesis) LongAmp Taq DNA polymerase (NEB, M0323V) TaKaRa MiniBEST Genomic DNA Extraction Kit (Code No. 9765) Main instruments: microinjection apparatus (Eppendorf FemtoJet), PCR instrument (Bio-Rad C1000), sequencer (Applied Biosystems 3730).

[0031] II. Experimental Methods (I) gRNA Design and Preparation gRNAs targeting exon 10 of the mouse Clcn3 gene were designed using the CRISPR design tool (CHOPCHOP v3). The gRNAs with the highest targeting efficiency, gRNA-A1 and gRNA-B1, were screened (although gRNA-A2 and gRNA-B2 sequences, even after adjusting different concentrations, still did not produce positive mice). gRNA-A1 and gRNA-B1 were synthesized via in vitro transcription, purified, and their concentrations were determined and adjusted to 100 ng / μL for later use.

[0032] The gRNA-A1 sequence is shown in SEQ.ID.NO.1: 5'-GGGGCTGACTGCATCACTCCCGG-3'; The gRNA-B1 sequence is shown in SEQ.ID.NO.2: 5'-GGGCTGACTGCATCACTCCCGGG-3'.

[0033] (II) Donor Oligonucleotide Design and Synthesis Design a 120 bp single-stranded oligonucleotide donor containing the p.T570I mutation (ACT→ATA), with 50 bp sequences at both ends homologous to the Clcn3 gene, and the mutation site located in the central region. The donor sequence is as follows: 5'-GTCCCGTCAGGCTTGTTTATCCTCAAGGAGTGGTGTGAGGTTGGGGCTGACTGC ATAATAATCCCGGGCTGTATGCCATGGTTGGGGCTGCTGCGTGCTTAGG-3'; (Note: The underlined part is the mutation site ACT→ATA).

[0034] (III) Preparation of microinjection system GRNA-A1 and gRNA-B1 (100 ng / μL each), donor oligonucleotide (50 ng / μL), and Cas9 protein (100 ng / μL) were mixed and the total volume was adjusted with RNase-free water to prepare an injection solution with the following final concentrations: 50 ng / μL gRNA, 25 ng / μL donor, and 50 ng / μL Cas9.

[0035] (iv) Fertilized egg retrieval and injection Superovulation: Female C57BL / 6J mice were intraperitoneally injected with pregnant mare serum gonadotropin (PMSG, 5 IU), followed by human chorionic gonadotropin (hCG, 5 IU) 48 hours later, and then mated with male mice that had been sterilized by vasectomy.

[0036] Fertilized egg collection: The fallopian tubes were dissected the following morning to release the fertilized eggs, which were then placed in M2 culture medium (a special culture medium for in vitro fertilization and early embryo manipulation in mammals).

[0037] Microinjection: 5-10 pL of injection solution was injected into the pronucleus of the fertilized egg using an Eppendorf FemtoJet microinjector. The injected fertilized eggs were then transferred to the oviducts of pseudopregnant ICR female mice (15-20 eggs were transferred to each side).

[0038] After successful oviduct transplantation, the female mouse will usually give birth 19-20 days after the operation, which are the F0 generation mice.

[0039] (V) Birth, numbering and identification of F0 generation mice The recipient female mice gave birth 19-20 days after conception, and the F0 generation mice were numbered, and their birth dates and sexes were recorded. The F0 generation mice born on December 3, 2022 included 2 males (ID: 6, 8) and 1 female (ID: 29).

[0040] Collect tissues (tail or toe tissues) from 1-2 week old mice and use the TaKaRa MiniBEST Universal Genomic DNA Extraction Kit (Ver.5.0, catalog number: 9765) to obtain high-purity genomic DNA.

[0041] PCR amplification and electrophoresis are performed using primers specific to the target gene to screen offspring with integrated exogenous genes. Mice with integration are called founder mice, which can be passaged and used to establish lines. Protein expression levels can also be identified if necessary.

[0042] (vi) PCR screening Reaction system (50 μL): Genomic DNA: 2 μL F1 primer (10 μM): 2 μL R1 primer (10 μM): 2 μL dNTPs (2.5 mM): 6 μL 5X LongAmp Taq Buffer: 10 μL LongAmp Taq enzyme: 2 μL ddH2O: 26 μL Loop condition: Pre-denaturation at 94℃ for 3 min 94℃ denaturation for 30 s, 60℃ annealing for 30 s, 65℃ extension for 50 s / kb (33 cycles in total) Final extension at 65℃ for 10 min Product analysis: The PCR products were detected by 1.5% agarose gel electrophoresis. Both WT and mutant (Mutant, MT) amplified a 463 bp fragment.

[0043] (vii) Sequencing confirmation Sanger sequencing of the PCR products using F1 primers showed the following results: Mouse ID:6#: A 7 bp deletion (GTTTATC) was detected at exon 10 of the Clcn3 gene, and the ACT→ATA mutation was successfully introduced. The mutation sequence is as follows: 5'-GTCCCGTCAGGCTTGTTTATCTTCAAGGAGTGGTGTGAGGTTGGGGCTGACTGC--del 7 bp--CCGGGCTGTATGCCATGGTTGGGGCTGCTGCGTGCTTAGG-3'.

[0044] Mouse IDs: 8# and 29#: No target mutation detected, WT sequence.

[0045] III. Experimental Conclusions This invention successfully constructed F0 generation mice with Clcn3 gene p.T570I KI and Clcn3 gene KO, among which mice #1 and #2 are Clcn3 gene KO positive mutants, and mice #3 and #4 are p.T570I KI positive mutants. These mutant mice can be used for subsequent Clcn3 gene function studies and the establishment of neurological disease models.

[0046] Example 2: Preparation and identification of F1 generation heterozygous and F2 generation homozygous mice The F0 generation mouse positive mutant prepared in Example 1 was bred and passaged with WT mice to form the F1 generation mouse.

[0047] F0 generation mice with Clcn3+ / - and / or Clcn3+ / p.T570I genotypes were crossbred with WT mice with a C57BL / 6J background. The F1 generation mice were identified by PCR and DNA sequencing, yielding 3 Clcn3+ / - F1 generation mice (numbered 2, 3, and 5) and 3 Clcn3+ / p.T570I F1 generation mice (numbered 8, 10, and 13). Subsequently, heterozygous F1 generation mice with Clcn3+ / - and / or Clcn3+ / p.T570I genotypes were crossbred with WT mice, and the F2 generation mice were identified, yielding 2 Clcn3- / - F2 generation mice (numbered 22 and 26) and 2 Clcn3 p.T570I / p.T570I F2 generation mice (numbered 19 and 20). Sequencing results are shown below. Figure 2 and Figure 3 .

[0048] Example 1: The effects of the CRISPR / Cas9-based Clcn3 gene p.T570I KI and Clcn3 gene KO mouse animal models are shown in the figure. Figure 4 As shown in 'a'.

[0049] Figure 4 b and Figure 4 The results in c show that Clcn3- / - mice died around day 20, with the longest survival time being 67 days. This indicates that Clcn3 gene knockout significantly shortens the lifespan of mice. Clcn3+ / p.T570I and Clcn3 p.T570 I / p.T570I mice experienced partial mortality in the early stages, but their longest survival time was not significantly different from that of WT mice.

[0050] Example 2 of the effect Clcn3 Gene p.T570I KI and Clcn3Quantitative real-time polymerase chain reaction (qPCR) in gene-knockout mice

[0051] The kit used in this experiment was Novizan ChamQ Universal SYBR qPCR Master Mix.

[0052] (1) Beijing Qingke Biotechnology Co., Ltd. was commissioned to synthesize primers and then diluted to 10 μM.

[0053] (2) Prepare the total system: Prepare the primers, SYBR qPCR Master Mix and ddH2O into a total system, and add 18 μL to each well of a 96-well plate (see Table 1 for the ratio and Table 2 for primer details).

[0054]

[0055] (3) After adding the total system, add 2 μL of the corresponding cDNA to each well.

[0056] (4) Perform qPCR reaction according to the conditions described in Table 3 below.

[0057]

[0058] The results are as follows Figure 5 As shown: qPCR results indicate that... Clcn3 - / - mouse Clcn3 mRNA expression levels were significantly reduced. Clcn3 + / p.T570I and Clcn3 p.T570 I / p.T570I mouse Clcn3 mRNA expression was not significantly different from that in WT mice.

[0059] Example 3: Effect Clcn3 Gene-knockout mice exhibit hippocampal neurodegenerative changes 1. Hematoxylin and Eosin (HE) staining (1) Rehydration treatment of tissue sections: The samples are restored to hydrophilicity through gradient hydration treatment, and the steps are the same as above.

[0060] (2) Nucleocytoplasmic contrast staining: The sample was immersed in modified Gill's hematoxylin working solution for 3-5 min, and rinsed with running water to remove non-specific staining. Overstaining was removed by color separation with 1% hydrochloric acid and ethanol for 10 seconds, and the alkaline environment was restored by blueing with 0.2% ammonia water for 1 min. The reaction was terminated with double distilled water.

[0061] (3) Cytoplasmic counterstaining process: After the sample was pretreated with gradient ethanol (70%-80%-95%), it was transferred into 0.5% eosin-ethanol staining solution (pH4.6) for 15s selective staining, and 0.1% acidic ethanol was used for 2s color separation to optimize staining contrast.

[0062] (5) Media replacement and sealing: Dehydration was performed using gradient ethanol (95%-100% I-100% II) for 2 min each, followed by transition treatment with environmentally friendly bio-clearing agent (n-butanol I / II), and finally media replacement was completed by passing through xylene-based clearing agent (I / II) for 2 min each. UV-curable neutral sealing film was used for bubble-free sealing, and photopolymerization at 37℃ for 12 h enhanced the sealing effect.

[0063] (6) Digital pathological analysis: The prepared samples are analyzed by acquiring high-definition images under a microscope.

[0064] 2.Nissl staining (1) Sample pretreatment: The dehydration steps are the same as above.

[0065] (2) Selective staining: The pretreated sections were immersed in cresol purple staining working solution (0.5%, pH 3.8) and stained at room temperature for 3 min. The sections were then rinsed with running water to remove the excess stain. Dynamic differentiation was performed using 0.1% glacial acetic acid ethanol solution (v / v=1:9). The staining intensity was adjusted by real-time microscopic observation until the Nissl bodies were clearly visible. The reaction was terminated with double distilled water and the sections were baked at 65℃ for 30 min to solidify the staining effect.

[0066] (3) Optical enhancement treatment: The samples were soaked in an environmentally friendly transparent agent for 15 minutes to improve light transmittance, and then sealed in an oxygen-free environment using an anti-fading mounting medium. The staining results were stabilized after 24 hours of storage away from light.

[0067] (4) Quantitative analysis: Further analysis using microscopic images.

[0068] The results are as follows Figure 6 As shown, Figure 6 a and Figure 6 b in the text respectively shows WT and Clcn3 - / - HE and Nissl staining results of mice at three time points: 15 days (sagittal), 1 month (m) (sagittal), and 2 m (coronal). The results showed that at 15 days... Clcn3 - / - The number of hippocampal neurons in mice was not significantly different from that in WT mice; at 1 month, hippocampal neurons in the CA1 region began to be lost, and at 2 months, the loss of hippocampal neurons worsened, with only a small number of neurons remaining in the dentate gyrus and part of the CA1 region. The black arrows indicate the locations of hippocampal loss. Clcn3 The loss of genes can impair the survival of hippocampal neurons.

[0069] Example 4 Clcn3 Degenerative changes in the retina of gene knockout mice The HE staining method is the same as above.

[0070] The results are as follows Figure 7 As shown, Figure 7 The ac values ​​represent HE staining results of the retina of WT mice at 15 days, 1 minute, and 2 minutes, respectively. Figure 7 df in the two cases are respectively Clcn3 - / - HE staining results of the retina of mice at 15 days, 1 month, and 2 months.

[0071] The results showed that Clcn3 - / - The photoreceptor layers OS and IS in the retina of mice were lost at 1m (shown in red box).

[0072] illustrate Clcn3 Genes are crucial to the photoreceptor layer of the mouse retina.

[0073] Example 5: Effect Clcn3 The number of neurons in the cortex and hippocampus of mice with the p.T570I KI gene increased.

[0074] Golgi body staining: Fresh brain slices or cells were fixed in a 5% potassium dichromate-mercuric chloride-potassium chromate mixture and protected from light for 14 days. After being impregnated twice with 3% silver nitrate, they were dehydrated, embedded in paraffin, and ultrathin sections of 100–150 µm were prepared. The sections were developed with ammonia alcohol and mounted with neutral resin. Under the microscope, the Golgi apparatus appeared as brownish-black linear or granular structures against a pale yellow background, clearly showing its polar distribution and vesicle network.

[0075] Figure 8 The three smaller images at the top, from left to right, represent a 1-year-old WT, Clcn3 + / p.T570I and Clcn3 p.T570 I / p.T570I Sagittal Golgi body staining results in mouse brain tissue. Figure 8 The lower part of the image is a magnified view. The results show that... Clcn3 p.T570 I / p.T570I The number of neurons in the cortex and hippocampus of mice increased significantly, and the number of axonal branches increased.

[0076] This invention achieves [the desired effect] by optimizing the gRNA target site and the donor oligonucleotide sequence. Clcn3 The efficient introduction of the p.T570I point mutation in the gene improved mutation efficiency by more than 30% compared to traditional methods; the constructed Clcn3The p.T570I gene KI and KO mouse models can stably inherit the target mutation. This method is short-cycle and low-cost, suitable for large-scale gene-editing animal model construction, and enables the creation of the world's first mouse model carrying a human pathogenic mutation site. Clcn3 The p.T570I KI mouse model is used for in-depth analysis. CLCN3 Gene physiological functions and related disease mechanisms provide an ideal and reliable genetic tool.

[0077] Appendix. Abbreviations: Ganglion Cell Layer (GCL); Inner Plexiform Layer (IPL); Inner Nuclear Layer (INL); Outer Plexiform Layer (OPL); Outer Nuclear Layer (ONL); Inner Segment (IS); Outer Segment (OS); Retinal Pigment Epithelium (RPE); Clcn3 It is a mouse-derived gene; CLCN3 Human-derived genes.

Claims

1. A method for constructing Clcn3 gene p.T570I point mutation and Clcn3 gene knockout mice, characterized in that, Includes the following steps: (1) Design and synthesize gRNA targeting the mouse Clcn3 gene, wherein the gRNA sequence includes gRNA-A1 and gRNA-B1; prepare donor oligonucleotides containing the ACT→ATA mutation; (2) Mix the gRNA-A1 and gRNA-B1, donor oligonucleotides and Cas9 protein described in (1) to form a microinjection system and inject it into mouse fertilized eggs; perform PCR and DNA sequencing identification on the F0 generation mice born; The gRNA-A1 sequence is shown in SEQ.ID.NO.1: 5'-GGGGCTGACTGCATCACTCCCGG-3'; The gRNA-B1 sequence is shown in SEQ.ID.NO.2: 5'-GGGCTGACTGCATCACTCCCGGG-3'.

2. The method according to claim 1, characterized in that: The PCR products were sequenced using F1 primers to confirm the ACT→ATA mutation. The PCR primers are as follows: Primer F1 is shown in SEQ.ID.NO.3: 5'-GTCCCGTCAGGCTTGTTTATCC-3'; Primer R1 is shown in SEQ.ID.NO.4: 5'-AAGGCTATGTTGTACCAAGATGGTTTC-3'; PCR cycling conditions: Pre-denaturation at 94℃ for 3 min; 94℃ denaturation for 30 s, 60℃ annealing for 30 s, 65℃ extension for 50 s / kb, for a total of 33 cycles; Extend the heat to 65°C for 10 minutes.

3. The method according to claim 1, characterized in that: In the microinjection system, the concentrations of gRNA-A1 and gRNA-B1 are 100 ng / μL, the concentration of donor oligonucleotides is 25-50 ng / μL, and the concentration of Cas9 protein is 50-100 ng / μL.

4. The method according to claim 3, characterized in that: The concentrations of gRNA-A1 and gRNA-B1 in the microinjection system were 100 ng / μL, the concentration of donor oligonucleotides was 25 ng / μL, and the concentration of Cas9 protein was 50 ng / μL.

5. The method according to claim 1, characterized in that, The PCR reaction system contains: 2 μL genomic DNA, 2 μL LF1 primer (10 μM), 2 μL R1 primer (10 μM), 6 μL dNTPs (2.5 mM), 10 μL 5X LongAmp Taq Buffer, 2 μL LongAmp Taq enzyme, and water added to a final volume of 50 μL.

6. The application of Clcn3 gene p.T570I point mutation and Clcn3 gene knockout mice constructed by any one of claims 1-5 in the preparation of research models for nervous system diseases.

7. The application according to claim 6, characterized in that: The Clcn3 gene knockout mice have two CT bases deleted from exon 10 of the Clcn3 gene; the Clcn3 gene p.T570I point mutation mice have an ACT→ATA point mutation in exon 10 of the Clcn3 gene.

Images