Preparation method and application of melatonin analogue
By preparing and administering melatonin analogs with specific structures via nasal administration, the problem of the blood-brain barrier restricting their action in the central nervous system has been solved, achieving stable and sustained effects in the central nervous system. These analogs have the effects of promoting cell proliferation, anti-oxidation, and regulating sleep, and are suitable for the treatment of nervous system diseases.
Patent Information
- Application Number
- CN202511379048.2
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-09-25
- Publication Date
- 2026-01-13
AI Technical Summary
The blood-brain barrier limits the therapeutic effects of melatonin in the central nervous system, while nasal administration can bypass the blood-brain barrier and achieve targeted delivery to the nervous system.
Prepare melatonin analogs with specific structures and deliver them to the central nervous system via nasal administration, including intranasal injection and nasal drops, and combine them with drug compositions to enhance their stability and persistence in the central nervous system.
Melatonin analogues can stably and persistently exert cell proliferation, antioxidant, and sleep-regulating effects in the central nervous system, and have the potential to treat nervous system diseases.
Smart Images

Figure CN121313635A_ABST
Abstract
Description
Technical Field
[0001] This invention relates to a method for preparing a melatonin analogue and its pharmaceutical use, particularly in the treatment of nervous system diseases. Background Technology
[0002] Melatonin (MT) is an indoleamine hormone primarily synthesized and secreted by the pineal gland. Melatonin plays a role in the regulation of circadian rhythms and possesses a variety of biological effects, including antioxidant defense, anti-inflammatory regulation, immunomodulatory activity, tumor homeostasis, and neuroprotective effects, establishing its multifaceted regulatory role in physiological homeostasis and pathological intervention. However, the blood-brain barrier restricts the passive diffusion of melatonin into the neuroplasm, hindering its therapeutic effects within the central nervous system. In contrast, nasal administration bypasses the blood-brain barrier, allowing direct transport from the nose to the brain via extracellular diffusion through olfactory sensory neurons and the trigeminal nerve.
[0003] Based on these premises, we aimed to achieve targeted delivery to the nervous system by administering melatonin and its analogues intranasally, and to evaluate their neuromodulatory effects. Summary of the Invention
[0004] The purpose of this invention is to provide a method for preparing melatonin analogues and their pharmaceutical uses.
[0005] On one hand, the present invention provides the use of a melatonin analog having the structure shown in Formula I or a pharmaceutically acceptable salt thereof, the use including: promoting cell proliferation, anti-oxidation, regulating sleep or preparing a medicament for treating nervous system diseases;
[0006]
[0007] Wherein, R is N-isopropyl or 1-aminoethyl.
[0008] In one embodiment, the melatonin analog having the structure shown in Formula I is a compound shown in Formula I-1 or I-2.
[0009]
[0010] In one embodiment, the use of a melatonin analogue having the structure shown in Formula I-1 or a pharmaceutically acceptable salt thereof includes: promoting cell proliferation or preparing a medicament for treating nervous system diseases.
[0011] In one embodiment, the use of a melatonin analogue having the structure shown in Formula I-1 or a pharmaceutically acceptable salt thereof includes promoting cell proliferation.
[0012] In one embodiment, the use of melatonin analogues having the structure shown in Formula I-2 or pharmaceutically acceptable salts thereof includes: promoting cell proliferation, antioxidation, regulating sleep, or preparing medicaments for treating nervous system diseases.
[0013] In one embodiment, the use of a melatonin analogue having the structure shown in Formula I-2 or a pharmaceutically acceptable salt thereof includes: promoting cell proliferation, anti-oxidation, and regulating sleep.
[0014] In one implementation, regulating sleep includes: improving sleep or promoting sleep.
[0015] In one embodiment, the neurological disease includes neuroregulation disorders and circadian rhythm regulation disorders.
[0016] In one embodiment, the melatonin analogue or its pharmaceutically acceptable salt is administered via nasal or intravenous route. Preferably, the melatonin analogue or its pharmaceutically acceptable salt is administered via nasal route.
[0017] In one embodiment, the melatonin analog having the structure shown in Formula I, the melatonin analog having the structure shown in Formula I-1, the melatonin analog having the structure shown in Formula I-2, or a pharmaceutically acceptable salt thereof, can be administered via intranasal injection, nasal spray, or nasal drops. Preferably, the melatonin analog having the structure shown in Formula I, the melatonin analog having the structure shown in Formula I-1, the melatonin analog having the structure shown in Formula I-2, or a pharmaceutically acceptable salt thereof, can be administered via intranasal injection or nasal drops.
[0018] In one embodiment, the dosage forms of the melatonin analogs having the structure shown in Formula I, the melatonin analogs having the structure shown in Formula I-1, the melatonin analogs having the structure shown in Formula I-2, or their pharmaceutically acceptable salts include injections, nasal drops, sprays, or powders. Preferably, the dosage forms of the melatonin analogs having the structure shown in Formula I, the melatonin analogs having the structure shown in Formula I-1, the melatonin analogs having the structure shown in Formula I-2, or their pharmaceutically acceptable salts are intranasal preparations.
[0019] On the other hand, the present invention also provides a pharmaceutical composition comprising the above-mentioned melatonin analog (a melatonin analog having the structure shown in Formula I, a melatonin analog having the structure shown in Formula I-1, a melatonin analog having the structure shown in Formula I-2) or a pharmaceutically acceptable salt thereof and at least one pharmaceutically acceptable carrier, excipient or diluent.
[0020] In one embodiment, the pharmaceutical composition comprises the above-described melatonin analogue (a melatonin analogue having the structure shown in Formula I, a melatonin analogue having the structure shown in Formula I-1, a melatonin analogue having the structure shown in Formula I-2) or a pharmaceutically acceptable salt thereof and at least one pharmaceutically acceptable carrier, excipient or diluent.
[0021] In one embodiment, the dosage form of the drug combination includes an injection, nasal drops, a spray, or a powder. Preferably, the dosage form of the drug combination is an intranasal preparation.
[0022] On the other hand, the present invention provides a method for preparing the melatonin analogue shown in I-1 above, the method comprising the following steps:
[0023] (1) 5-Methoxytryptamine dissolves in methanol solution;
[0024] (2) The compound shown in I-1 is obtained by reacting with concentrated hydrochloric acid, an appropriate amount of acetone and sodium borocyanide at low temperature; the reaction time is not less than 2 hours.
[0025] In one embodiment, the preparation method includes the following steps:
[0026] (1) One equivalent of 5-methoxytryptamine dissolves in a methanol solution;
[0027] (2) The compound shown in I-1 is obtained by reacting with 3.4 equivalents of concentrated hydrochloric acid, an appropriate amount of acetone, and 4 equivalents of sodium borocyanide at 0°C; the reaction time is not less than 2 hours.
[0028] In one embodiment, the method further includes the following steps for separating and purifying the obtained compound. The separation and purification method involves: quenching the reaction with a saturated sodium bicarbonate aqueous solution, extracting the aqueous layer with ethyl acetate, combining the organic layers, drying with anhydrous sodium sulfate, filtering, concentrating under reduced pressure to obtain a yellow oily substance, and purifying the crude product by preparative high-performance liquid chromatography.
[0029] In one embodiment, the yield of the compound shown in I-1 obtained by the method is not less than 10%, 15%, 20%, 25%, 30%, 35%, or 40%.
[0030] On the other hand, the present invention provides a method for preparing the melatonin analogue shown in I-2 above, the method comprising the following steps:
[0031] (1) 3-Buten-2-ol is dissolved in dichloromethane and reacts with Dess-Martin periodinane at low temperature;
[0032] (2) The reaction product of step (1) is added to a dichloromethane solution containing 5-methoxyindole, and then zirconium tetrachloride is added and reacted at low temperature;
[0033] (3) The reaction product of step (2), hydroxylamine hydrochloride and sodium bicarbonate react in a methanol-water mixed solution at high temperature;
[0034] (4) Add Raney nickel to the methanol solution of the reaction product of step (2) and react at room temperature and under a hydrogen atmosphere to obtain the compound shown in I-2.
[0035] In one embodiment, the low temperature is 0±10℃, preferably 0±5℃; the high temperature is 75±10℃, preferably 75±5℃.
[0036] In one embodiment, the preparation method includes the following steps:
[0037] (1) One equivalent of 3-buten-2-ol is dissolved in dichloromethane and reacted with not less than one equivalent of Dess-Martin periodinane at 0°C;
[0038] (2) The reaction product of step (1) is added to a dichloromethane solution containing not less than 1 equivalent of 5-methoxyindole, and then 0.05 equivalent of zirconium tetrachloride is added and reacted at 0°C.
[0039] (3) The reaction product of step (2), 1.5 equivalents of hydroxylamine hydrochloride and 1.5 equivalents of sodium bicarbonate were reacted in a methanol-water mixed solution at 75°C.
[0040] (4) Add Raney nickel to the methanol solution of the reaction product of step (2) and react at room temperature and under a hydrogen atmosphere to obtain the compound shown in I-2.
[0041] In one embodiment, the reaction time of step (1) is not less than 2 hours; step (1) further includes a separation and purification step, wherein the separation and purification method is: the suspension is filtered with a diatomaceous earth pad to remove insoluble byproducts.
[0042] In one embodiment, the reaction time of step (2) is not less than 2 hours; step (2) further includes a separation and purification step, wherein the separation and purification method is as follows: dilute with dichloromethane, wash with water, dry the organic phase on anhydrous sodium sulfate, filter, concentrate under reduced pressure, and purify the crude product by silica gel column chromatography (petroleum ether / ethyl acetate = 2:1).
[0043] In one embodiment, the reaction time of step (3) is not less than 5 hours; step (3) also includes a separation and purification step, wherein the separation and purification method is as follows: after cooling, dilute with water, extract with dichloromethane, dry the combined organic layer, filter, concentrate under reduced pressure, and purify the crude product by silica gel column chromatography (petroleum ether / ethyl acetate = 1:1).
[0044] In one embodiment, the reaction time of step (4) is not less than 16 hours; step (4) further includes a separation and purification step, wherein the separation and purification method is: filtering the mixture through diatomaceous earth to remove the catalyst, concentrating the filtrate under reduced pressure to obtain a yellow oil, and purifying it by high performance liquid chromatography.
[0045] In one embodiment, the method further includes the step of monitoring and displaying the extent of the reaction using thin-layer chromatography (TLC).
[0046] In one embodiment, the yield of the compound shown in I-2 obtained by the method is not less than 10%, 15%, 20%, 25%, 30%, 35%, or 40%.
[0047] Beneficial effects
[0048] This invention provides a method for preparing a melatonin analogue and its uses. When administered intranasally, the melatonin analogue can exert a more stable and prolonged effect on the central nervous system, promoting cell proliferation, anti-oxidation, and regulating sleep. Attached Figure Description
[0049] Figure 1 The chemical synthesis process of MT-A1 and MT-A2.
[0050] Figure 2 CCK-8 assay of melatonin and its structural analogues in HT22 cells.
[0051] Figure 3 Drug concentrations in mouse brain regions after intranasal administration of melatonin and its analogues.
[0052] Figure 4 The effects of melatonin and its analogues on antioxidant genes Sod2, GPx4, and HO-1.
[0053] Figure 5 Effects of melatonin and its analogues on circadian rhythm genes Bmal1, Clock, and Per1.
[0054] Figure 6 Effects of melatonin and its analogues on sleep rhythm in mice. Detailed Implementation
[0055] The present invention will be further described below with reference to embodiments. The following description is merely a preferred embodiment of the present invention and is not intended to limit the invention in any other way. Any person skilled in the art may make equivalent modifications to the disclosed technical content to create equivalent embodiments. Any simple modifications or equivalent changes made to the following embodiments based on the technical essence of the present invention without departing from the scope of the invention are all within the protection scope of the present invention.
[0056] Example 1: Chemical Synthesis of Melatonin Analogs MT-A1 and MT-A2
[0057] 1. Synthesis of MT-A1
[0058] 5-Methoxytryptamine (1.0 g, 5.26 mmol, 1.0 equivalent) was added to a methanol (10 mL) solution. Concentrated hydrochloric acid (1.5 mL, 18 mmol, 3.4 equivalent) and acetone (10 mL) were added sequentially at 0 °C. After stirring at 0 °C for 10 minutes, sodium boron cyanide (1.50 g, 20.5 mmol, 4.0 equivalent) was added. The reaction mixture was stirred at 0 °C for another 2 hours, monitored by thin-layer chromatography (TLC) until completion. The reaction was quenched with a saturated sodium bicarbonate aqueous solution (100 mL), and the aqueous layer was extracted with ethyl acetate (2 × 50 mL). The organic layers were combined, dried over anhydrous sodium sulfate, filtered, and concentrated under reduced pressure to obtain a yellow oil. The crude product was purified by preparative high-performance liquid chromatography (prep-HPLC) to give compound MT-A1 as a yellow oil (502 mg, yield: 41.1%, purity: 98.99%).
[0059] 1H NMR (400MHz, DMSO-d6) δ10.55(s,1H),7.21(d,J=8.7Hz,1H),7.08(d,J=2.3Hz,1H),6.98(d,J= 2.4Hz, 1H), 6.70 (dd, J = 8.7, 2.4Hz, 1H), 3.75 (s, 3H), 2.87-2.69 (m, 5H), 0.97 (d, J = 6.2Hz, 6H).
[0060] HRMS(ESI): m / z[m+H] + calcd for C13H17N2O2:233.13; found:233.
[0061] The chemical synthesis process of MT-A1 is as follows: Figure 1 As shown in Figure A.
[0062] 2. Synthesis of MT-A2
[0063] Step a: At 0°C, 3-buten-2-ol (1.44 g, 20.0 mmol, 1.0 equivalent) was stirred in dichloromethane (50 mL), and Dess-Martin periodinane (9.2 mL, 22.0 mmol, 1.1 equivalent) was added dropwise. The reaction mixture was heated to room temperature and stirred for 2 hours. The resulting suspension was filtered through a diatomaceous earth filter to remove insoluble byproducts. The filtrate containing the crude methyl vinyl ketone intermediate was used directly for the next step without further purification.
[0064] Step b: The filtrate obtained in step a (containing approximately 20.0 mmol of the ketone intermediate) was added dropwise at 0 °C to a solution of 5-methoxyindole (3.23 g, 22.0 mmol, 1.1 equivalents) in dichloromethane (30 mL). Zirconium tetrachloride (ZrCl4, 233 mg, 1.0 mmol, 0.05 equivalents) was added, and the mixture was stirred at room temperature for 2 h. After TLC analysis showed complete consumption of the starting material, the mixture was diluted with dichloromethane (100 mL) and washed with water (2 × 100 mL). The organic phase was dried over anhydrous sodium sulfate, filtered, and concentrated under reduced pressure. The crude product was purified by silica gel column chromatography (petroleum ether / ethyl acetate = 2:1) to give compound 2 as a yellow solid (2.0 g).
[0065] ESI-MS: m / z[m+H]+=218.
[0066] Step c: Compound 2 (1.5 g, 7.0 mmol, 1.0 equivalent), hydroxylamine hydrochloride (0.73 g, 10.5 mmol, 1.5 equivalent), and sodium bicarbonate (0.88 g, 10.5 mmol, 1.5 equivalent) were mixed with a mixture of methanol (20 mL) and water (10 mL). The reaction mixture was heated to 75 °C and stirred for 5 hours. TLC monitoring indicated that the reaction was complete. After cooling, the mixture was diluted with water (100 mL) and extracted with dichloromethane (2 × 100 mL). The combined organic layers were dried, filtered, and concentrated under reduced pressure. The crude product was purified by silica gel column chromatography (petroleum ether / ethyl acetate = 1:1) to give compound 3 as a yellow solid (1.6 g).
[0067] ESI-MS: m / z[m+H]+=233.
[0068] Step d: Raney nickel (200 mg) was added to a methanol (20 mL) solution of compound 3 (1.5 g, 6.4 mmol, 1.0 equivalent). The flask was rinsed with hydrogen (3 cycles) and stirred for 16 hours at room temperature under a hydrogen atmosphere. After TLC confirmation of the reaction completion, the mixture was filtered through diatomaceous earth to remove the catalyst. The filtrate was concentrated under reduced pressure to give a yellow oil, which was purified by high performance liquid chromatography to give compound MT-A2 as a yellow solid (620 mg, yield: 44.4%, purity: 99.85%).
[0069] 1 H NMR (400MHz, MeOD) δ7.21(d,J=8.8Hz,1H),7.04(s,1H),7.01(d,J=2.4Hz,1H),6.75(dd,J=8.8,2.4Hz,1H),3. 81(s,3H),3.29-3.23(m,1H),2.91-2.76(m,2H),2.13-2.02(m,1H),1.95-1.84(m,1H),1.35(d,J=6.6Hz,3H).
[0070] ESI-MS: m / z[m+H]+=219.
[0071] The chemical synthesis process of MT-A2 is as follows: Figure 1 As shown in B.
[0072] Example 2: Bioactivity of melatonin and its analogues
[0073] 1. Effects of melatonin and its analogues on HT22 cell viability
[0074] To investigate the in vitro functional effects of melatonin (MT) and its analogues (MT-A1 and MT-A2) on hippocampal neurons, we used the cell counting kit-8 (CCK-8) assay to study their effect on the cell viability of HT22 cells.
[0075] The specific method is as follows: Mouse hippocampal HT22 cells were cultured in DMEM high glucose medium (Gibco), with 10% FBS (Gibco), 1% L-glutamine (Gibco), and 1% penicillin-streptomycin (P / S) dual antibiotics (100U / ml) added to the medium. -1 Cells were incubated at 37°C in a humidified environment with 5% CO2. When cell confluence reached 80%, the cells were separated using trypsin-EDTA digestion solution, washed, and then cultured in a fresh 25 cm⁻¹ container. 2 Cultured in flasks for 1-2 days. HT22 cells were seeded into 96-well plates and incubated at 37°C with 5% CO2 for 24 hours to allow them to adhere to the plates. The original culture medium was then replaced with a medium containing different groups of melatonin or its analogues (MT, MT-A1, MT-A2), while the control group was cultured in the original medium. CCK-8 assays were performed on days 1, 3, 5, and 7 after incubation.
[0076] Melatonin was added to the culture medium at concentration gradients of 100 nM, 10 μM, 20 μM, 100 μM, 500 μM, and 5 mM, and its cytotoxicity to cells was tested. The results are as follows: Figure 2 As shown in Figure a, the results indicate that when the melatonin concentration is below 500 μM, the cell viability is greater than 85%, while a melatonin concentration of 5 mM exhibits significant cytotoxicity. Figure 2 In (a), Ctr served as the control group, and 100 nM, 10 μM, 20 μM, 100 μM, 500 μM, and 5 mM represent the concentrations of melatonin. Therefore, we chose 100 nM and 20 μM to compare the effects of melatonin and its analogues on HT22 cells over a period of one week. The effects of 100 nM MT, MT-A1, and MT-A2 on HT22 cells are shown in the figure. Figure 2 As shown in b, compared with the control group ( Figure 2 Compared to Con in b), MT, MT-A1, and MT-A2 all showed similar proliferative effects on days 3, 5, and 7. The effects of 20 μM MT, MT-A1, and MT-A2 on HT22 cells are shown in the following results. Figure 2 As shown in c, compared with the control group ( Figure 2 Compared to Con in c), MT, MT-A1, and MT-A2 all exhibited similar proliferative effects on days 1 and 3. There were no significant differences between MT-A1 and MT-A2 and MT. These results suggest that melatonin MT and its analogues (MT-A1 and MT-A2) all possess similar proliferative effects, particularly at low concentrations (100 nM and 20 μM).
[0077] 2. Effects of melatonin and its analogues on the central nervous system
[0078] The ability of melatonin (MT) and its analogues (MT-A1 and MT-A2) to reach the central nervous system via the naso-brain pathway after intranasal administration was evaluated by monitoring drug concentrations in brain regions in mice.
[0079] The specific methods are as follows: Four-week-old male C57BL / 6J mice were placed under controlled laboratory conditions (22±2℃, 50±5% humidity, light / dark / 12h). All mice were randomly divided into four groups (n=8 per group): control group (no treatment); MT group; MT-A1 group; and MT-A2 group. Mice were anesthetized by inhalation of oxygen containing 2% isoflurane (1L / min flow rate) and injected bilaterally intranasally with MT, or MT-A1, or MT-A2 (20 μg / mouse, dissolved in 16 μL of physiological saline containing 0.1% DMSO) using a calibrated micropipette. The control group was injected with an equal volume of 0.1% DMSO physiological saline solution. Drug concentrations in different brain regions (olfactory bulb, prefrontal cortex, and hippocampus) were measured at 5, 15, 60, and 120 minutes after administration.
[0080] The results are as follows Figure 3As shown, in the olfactory bulb, within the first 15 minutes after administration, the concentrations of MT-A1 and MT-A2 were significantly higher than MT; after 1 hour, MT was undetectable, while MT-A1 and MT-A2 remained detectable, with MT-A2 showing a higher residual concentration; after 2 hours, only MT-A2 remained detectable. In the prefrontal cortex, MT, MT-A1, and MT-A2 were all detectable at 1 hour, with MT-A2 concentration comparable to or slightly higher than MT; by 2 hours, MT dropped below the detection limit, while MT-A1 and MT-A2 remained detectable, indicating that these two analogues had longer retention times, especially MT-A2. In the hippocampus, MT, MT-A1, and MT-A2 all reached detectable levels within 1 hour, but the concentration of MT-A2 was significantly higher than MT and MT-A1; at 2 hours, MT was undetectable, MT-A1 decreased significantly, and MT-A2 maintained a relatively high concentration. These results indicate that, after nasal administration, MT-A1 and MT-A2 are more efficient and longer-lasting in delivering medication from the nose to the brain than MT, with MT-A2 exhibiting greater brain stability and persistence, particularly in functionally critical regions such as the hippocampus and prefrontal cortex. MT-A2 shows great potential as a central nervous system-targeting drug and is a promising candidate for developing intranasal formulations for the treatment of neurological disorders.
[0081] 3. The antioxidant effects of melatonin and its analogues
[0082] Melatonin is a powerful antioxidant that plays a unique role in protecting cells from oxidative stress. We investigated the effects of melatonin (MT) and its analogues (MT-A1 and MT-A2) on the expression of antioxidant genes in mice via intranasal administration.
[0083] The specific methods are as follows: 24-week-old male C57BL / 6J mice were placed under controlled laboratory conditions (22±2℃, 50±5% humidity, light / dark / 12h). All mice were randomly divided into 4 groups (n=8 per group): control group (no treatment); MT group; MT-A1 group; and MT-A2 group. Mice were anesthetized by inhalation of oxygen containing 2% isoflurane (1L / min flow rate) and injected bilaterally intranasally with MT, MT-A1, or MT-A2 (20 μg / mouse, dissolved in 16 μL of physiological saline containing 0.1% DMSO) using a calibrated micropipette. The control group was injected with an equal volume of 0.1% DMSO physiological saline solution. Total RNA was extracted using TRIzol reagent (Thermo Fisher Scientific). An equal volume of RNA was reverse transcribed into cDNA using the HiScript IV All-in-One Ultra RT SuperMix kit (Vazyme). qPCR was performed using the Tag Pro Universal SYBR qPCR Master Mix (Vazyme) on a CFX96 real-time PCR system (Bio-Rad). Relative mRNA expression was normalized to GAPDH, and data were analyzed using the 2-ΔΔCT method. Primers used are shown in Table 1.
[0084] Table 1. Primer sequences
[0085] Gene Forward primer (5' to 3') Reverse primer (5' to 3') Gapdh AGGTCGGTGTGAACGGATTTG TGTAGACCATGTAGTTGAGGTCA Sod2 CAGACCTGCCTTACGACTATGG CTCGGTGGCGTTGAGATTGTT GPx4 GATGGAGCCCATTCCTGAACC CCCTGTACTTATCCAGGCAGA HO-1 AAGCCGAGAATGCTGAGTTCA GCCGTGTAGATATGGTACAAGGA
[0086] The results are as follows Figure 4 As shown, Figure 4 The values of ac represent the effects of MT, MT-A1, and MT-A2 on the expression levels of antioxidant genes Sod2, GPx4, and HO-1 in the prefrontal cortex of the mouse brain, respectively. Figure 4 The values df represent the effects of MT, MT-A1, and MT-A2 on the expression levels of antioxidant genes Sod2, GPx4, and HO-1 in the mouse hippocampus. The results showed that both melatonin MT and MT-A2 significantly enhanced the expression of the antioxidant genes Sod2 and GPx4 in the mouse prefrontal cortex and hippocampus, but had no significant effect on the expression of the antioxidant genes GPx4, HO-1, and HO-1 in the prefrontal cortex and hippocampus. MT-A1 had no significant effect on the expression of these antioxidant genes. Therefore, MT-A2 and MT have similar effects on the expression of multiple antioxidant genes.
[0087] 4. Effects of melatonin and its analogues on circadian rhythms
[0088] Melatonin plays an important role in regulating circadian rhythms. The effects of melatonin (MT) and its analogues (MT-A1 and MT-A2) on the expression of circadian rhythm genes in mice were examined using the methods described above. Primer sequences are shown in Table 2.
[0089] Table 2. Primer sequences
[0090] Gene Forward primer (5' to 3') Reverse primer (5' to 3') Bmal1 AAAAATAGGTCGAATGATCGC GGAGTCCCTCCATTTAGAATC Clock TGGTGTTTACCGTAAGCTGTAG CTCGCGTTACCAGGAAGC Per1 CGGATTGTCTATATTTCGGAG TGGGCAGTCGAGATGGT
[0091] The results are as follows Figure 5 As shown, Figure 5 The values of ac represent the effects of MT, MT-A1, and MT-A2 on the expression levels of circadian rhythm genes (Bmal1, Clock, and Per1) in the mouse prefrontal cortex, respectively. Figure 5 The values df represent the effects of MT, MT-A1, and MT-A2 on the expression levels of circadian rhythm genes (Bmal1, Clock, and Per1) in the mouse hippocampus. The results showed that MT-A2 significantly enhanced the expression of the circadian rhythm gene Per1 in the mouse hippocampus, while melatonin MT and its analogue MT-A1 had no significant effect on the expression of several circadian rhythm genes.
[0092] In addition, to investigate the effects of melatonin (MT) and its analogues (MT-A1 and MT-A2) on the sleep-wake cycle in mice, we administered MT, MT-A1 or MT-A2 intranasally at the peak of circadian rhythm activity (ZT12) and continuously recorded electroencephalograms (EEG), electromyograms (EMG) and hypnotic graphs over 12 hours.
[0093] The specific method is as follows: Adult mice were anesthetized with 1.0-2.0% isoflurane and fixed in a stereotactic frame. Under aseptic conditions, the scalp was incised to expose the skull. Two stainless steel electrodes were implanted in each of the two cortical sites for EEG recording: the frontal cortex (AP +1.5mm, ML relative to bregma ±1.5mm) and the parietal cortex (AP -3.0mm, ML ±1.5mm). In the cerebellum (AP -5.8mm, ML ±1.0mm), one electrode served as a reference electrode, and the other as a ground electrode. Bipolar EMG electrodes were inserted into the bilateral dorsal neck muscles to record muscle activity. All electrodes were connected to custom-made plastic six-pin head-level connectors and fixed to the skull surface with dental acrylic resin. Mice recovered for 7 days post-surgery. After recovery, the animals were acclimatized to the EEG / EMG recorder and experimental environment for 3 days. Melatonin and its analogues were dissolved in dimethyl sulfoxide (DMSO), then diluted in physiological saline, and administered intranasally at a dose of 10 mg / kg. The control group received the same intranasal administration of physiological saline containing the same concentration of DMSO. Polysomnography recording began immediately after administration. Using the Neurokey small animal electrophysiological recording system, EEG and EMG signals were continuously recorded every 12 hours from 20:00 on day 1 to 08:00 on day 2. The signal sampling frequency was 2000 Hz. Sleep-wake states were scored offline according to standard EEG and EMG criteria. NREM sleep was defined as high-amplitude, low-frequency EEG activity (high delta power, 1-4 Hz) and low EMG tone. REM sleep was defined as low-amplitude, relatively high-frequency EEG activity (high theta power, 6-10 Hz) accompanied by very low EMG activity. Wakefulness was characterized by low-amplitude, high-frequency EEG waves and sustained EMG tones indicating muscle activity.
[0094] The results are as follows Figure 6 As shown, Figure 6 A. Representative EEG spectrograms, raw EMG waveforms, and sleep-wake graphs within 12 hours after nasal instillation of 0.1% DMSO (Control), MT, MT-A1, and MT-A2; Figure 6 B is a statistical graph showing the duration of each sleep stage in each group of mice; Figure 6 C is a statistical graph showing the number of occurrences of each sleep stage in each group of mice; Figure 6D represents the ratio of the time spent in each sleep stage in each group of mice. The results showed that, compared with the control group, there were no significant differences in the duration and frequency of each sleep stage between the MT and MT-A1 groups; however, compared with the control group, the MT-A2 group had a significantly shorter duration of wakefulness and a significantly increased frequency of wakefulness and non-rapid eye movement (NREM) episodes. These findings suggest that MT-A2 shortens the total wakefulness time and increases the number of wakefulness episodes, indicating a fragmented wakefulness pattern. This may reflect a reduced ability of MT-A2 to maintain sustained wakefulness, possibly due to its strong sleep-inducing effect. Compared with the control group ( Figure 6 Compared to the control group (D), the MT and MT-A2 groups showed a decrease in the wake phase and an increase in the non-rapid eye movement (NREM) phase in mice, while the ratio of the time spent in each sleep stage was not significantly different in the MT-A1 group. In conclusion, MT-A2 administered intranasally can effectively regulate sleep structure in mice, and both MT and MT-A2 exhibit sleep-promoting effects.
[0095] Compared to MT, MT-A1 and MT-A2 can be administered nasally, bypassing the blood-brain barrier, and exert a more stable and sustained effect in the central nervous system, making them suitable for treating neurological disorders. MT-A1 is similar to MT in promoting cell proliferation and its effects on sleep; MT-A2 is similar to MT in promoting cell proliferation and its antioxidant effects, and its sleep-promoting effects are even superior to MT, demonstrating the potential to improve sleep.
[0096] Although specific embodiments of the invention have been described in detail, those skilled in the art will understand that various modifications and variations can be made to the details based on all the published teachings, and all such changes are within the scope of protection of the invention. The entire scope of the invention is given by the appended claims and any equivalents thereof.
Claims
1. Use of a melatonin analog having the structure shown in Formula I below: ###00001### Formula I or a pharmaceutically acceptable salt thereof, comprising: promoting cell proliferation, antioxidation, regulating sleep or preparing a medicament for treating nervous system diseases; wherein R is N-isopropyl or 1-aminoethyl.
2. Use according to claim 1, characterized in that, The melatonin analogue or its pharmaceutically acceptable salt is administered by nasal administration.
3. Use according to claim 2, characterized in that, The nasal administration includes intranasal injection, nasal cavity spray or nasal drop.
4. Use according to claim 1, characterized in that, The melatonin analogue having the structure of formula I is a compound of formula I-1 or I-2, 5. Use according to any one of claims 1 to 4, characterized in that, The sleep regulation includes improving sleep.
6. Use according to any one of claims 1 to 4, characterized in that, The nervous system diseases include circadian rhythm regulation disorder.
7. A pharmaceutical composition, characterized by, The pharmaceutical composition includes the melatonin analogue or its pharmaceutically acceptable salt of any one of claims 1-6 and at least one pharmaceutically acceptable carrier, excipient or diluent.
8. The pharmaceutical composition of claim 7, wherein, The dosage form of the pharmaceutical composition is intranasal preparation.
9. A method of preparing the melatonin analog of Formula I-1 as recited in claim 4, wherein, The preparation method includes the following steps: (1) 5-methoxytryptamine is dissolved in methanol solution; (2) the compound of formula I-1 is obtained by reacting with concentrated hydrochloric acid, proper amount of acetone and sodium boron cyanide at low temperature; the reaction time is not less than 2 hours.
10. A method of preparing the melatonin analog of Formula I-2 as recited in Claim 4, wherein: ###00006### I-2 The preparation method includes the following steps: (1) 3-buten-2-ol is dissolved in dichloromethane and reacted with des-martin oxidant at low temperature; (2) the reaction product of step (1) is added to a dichloromethane solution containing 5-methoxyindole, then zirconium tetrachloride is added and reacted at low temperature; (3) the reaction product of step (2), hydroxylamine hydrochloride and sodium bicarbonate are reacted in a methanol-water mixed solution at high temperature; (4) the methanol solution of the reaction product of step (2) is added with Raney nickel and reacted at room temperature in hydrogen atmosphere to obtain the compound of formula I-2.