A kit for detecting Brucella ωRNA, a fluorescent detection kit, a visualization kit, and their applications.

The OMEGA system, which uses ωRNA to bind to TnpB protein, achieves highly sensitive and specific detection of Brucella, overcoming the limitations of traditional methods and providing a low-cost, rapid on-site detection solution.

CN121362759BActive Publication Date: 2026-03-13INNER MONGOLIA UNIVERSITY
View PDF 2 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-12-18
Publication Date
2026-03-13

AI Technical Summary

Technical Problem

Traditional methods for brucellosis diagnosis have limitations in detecting antibodies rather than pathogens, and PCR methods rely on expensive equipment and professional personnel, making them unsuitable for rapid on-site testing.

Method used

The OMEGA system, which combines ωRNA with TnpB protein, achieves high sensitivity and specificity for the Brucella bp26 gene through isothermal amplification and paracleavage activity. Results are observed using fluorescence detection or nucleic acid test strips.

Benefits of technology

This invention provides a low-cost and simple detection method that can rapidly and accurately detect Brucella in non-laboratory environments, with a sensitivity of 1×100 copies/μL, and has high specificity and wide applicability.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121362759B_ABST
    Figure CN121362759B_ABST
Patent Text Reader

Abstract

This invention relates to the field of gene detection technology, and in particular to an ωRNA for detecting Brucella, a fluorescent detection kit, a visualization kit, and their applications. The nucleotide sequence of the ωRNA provided by this invention is shown in SEQ ID NO:4. The ωRNA provided by this invention can specifically recognize the Brucella bp26 gene. Combined with TnpB protein, it exhibits high paracleavage activity against the amplified product of the Brucella bp26 gene. After the ωRNA recognizes the target sequence, TnpB cleaves the non-specific ssDNA reporter probe. Brucella can be detected by fluorescent detection or nucleic acid detection test strips, exhibiting high accuracy and sensitivity. Using the OMEGA-TnpB detection system of this invention, Brucella can be detected on-site anytime, outside of a laboratory setting, offering wide applicability, low operational requirements, high efficiency, and accuracy.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of gene detection technology, and in particular to a ωRNA detection kit, a fluorescence detection kit, a visualization kit, and their applications for detecting Brucella. Background Technology

[0002] Brucellosis is a disease caused by Brucella bacteria (Brucella) Brucella Brucellosis, a zoonotic infectious disease caused by pathogens, poses a significant threat to human and animal health. Traditional diagnostic methods for brucellosis primarily rely on serological testing, but these methods have limitations. They typically detect antibodies produced by infection but cannot directly confirm the presence of the pathogen. Polymerase chain reaction (PCR) offers a more sensitive diagnostic option, but its dependence on expensive equipment, skilled personnel, and time-consuming procedures makes it unsuitable for rapid, on-site testing. The advent of CRISPR-Cas systems has revolutionized molecular diagnostics. Notably, the Cas12 and Cas13 systems, with their paracleavage activity, show great promise in pathogen detection. These systems have been successfully applied to detect a variety of infectious pathogens, including those causing blood diseases in animals.

[0003] The OMEGA system is the ancestor of the CRISPR-Cas system, composed of a class of transposon-encoded RNA-guided nucleases, including key proteins such as IscB, IsrB, and TnpB. Among them, the prokaryotically derived TnpB has nuclease properties similar to the Cas12 protein, but its size is only half that of the Cas12a protein (approximately 400 amino acids). Its guide RNA is called ωRNA.

[0004] The IS200 / IS605 transposon family is widely distributed in prokaryotes and eukaryotes. Recent reports confirm that TnpB, encoded by the IS200 / IS605 transposon family, is the evolutionary ancestor of Cas12 in the type V CRISPR-Cas system. The RNA transcript at the right end of the TnpB transposon generates ωRNA. The RNP complex formed by TnpB and ωRNA recognizes the transposon-associated motif (TAM) and leads to cleavage of the target sequence, which is complementary to the guide sequence at the 3' end of the ωRNA. Studies have confirmed that TnpB possesses paracleavage activity, but there is currently no information on its application in Brucella detection. Summary of the Invention

[0005] To address the aforementioned problems, this invention provides an ωRNA detection kit, a fluorescent detection kit, a visualization kit, and their applications for detecting Brucella. The ωRNA combined with TnpB protein provided by this invention exhibits high targeting specificity and paracleavage activity against the Brucella bp26 gene. Brucella can be detected using fluorescent detection or nucleic acid detection test strips, demonstrating high accuracy and sensitivity.

[0006] To achieve the above objectives, the present invention provides the following technical solution:

[0007] This invention provides an ωRNA for detecting Brucella, the nucleotide sequence of which is shown in SEQ ID NO:4.

[0008] This invention provides a fluorescent detection kit for Brucella, comprising ωRNA, isothermal amplification primers, TnpB protein, and ssDNA reporter probe 1 as described in the above technical solution; the isothermal amplification primers are isothermal amplification primers for amplifying the Brucella bp26 gene; and the ssDNA reporter probe 1 is a nucleic acid molecule modified with fluorescent and quenching groups.

[0009] Preferably, the nucleotide sequence of the ssDNA reporter probe 1 is 5'-TTTTATTTT-3'; the fluorescent group includes FAM; and the quenching group includes BHQ1.

[0010] Preferably, the nucleotide sequences of the isothermal amplification primers are shown in SEQ ID NO:1 and SEQ ID NO:2; the TnpB protein includes the ISDra2 TnpB protein derived from *Geococcus radiodurans*.

[0011] This invention provides a visualization kit for detecting Brucella, comprising the ωRNA, isothermal amplification primers, TnpB protein, ssDNA reporter probe 2, and nucleic acid detection test strips described in the above technical solution; the isothermal amplification primers are isothermal amplification primers for amplifying the Brucella bp26 gene; the ssDNA reporter probe 2 is a nucleic acid molecule modified with a fluorescent group and biotin.

[0012] Preferably, the nucleotide sequence of the ssDNA reporter probe 2 is 5'-TTTTATTTT-3'; the fluorescent group includes FAM.

[0013] Preferably, the nucleotide sequences of the isothermal amplification primers are shown in SEQ ID NO:1 and SEQ ID NO:2; the TnpB protein includes the ISDra2 TnpB protein derived from *Geococcus radiodurans*.

[0014] This invention provides the application of the ωRNA described in the above-described technical solution, or the fluorescence detection kit described in the above-described technical solution, or the visualization kit described in the above-described technical solution in (1) and / or (2):

[0015] (1) Non-diagnostic and non-therapeutic detection of Brucella and / or its DNA;

[0016] (2) Screening or assisting in the screening of drugs for the prevention and treatment of Brucella infection.

[0017] Preferably, (1) includes detecting Brucella infection in food and / or the living environment of animals.

[0018] Preferably, the detection or screening method includes:

[0019] The test samples were amplified by isothermal PCR using isothermal amplification primers to obtain amplification products;

[0020] The amplification product, ωRNA, TnpB protein, and ssDNA reporter probe 1 are reacted, and the fluorescence of the reaction solution is detected. If the reaction solution is fluorescent, the sample contains Brucella and / or its DNA; if the reaction solution is not fluorescent, the sample does not contain Brucella and / or its DNA.

[0021] Alternatively, the amplification product, ωRNA, TnpB protein, and ssDNA reporter probe 2 are reacted, and the nucleic acid test strip is inserted into the reaction solution. The T line and C line on the nucleic acid test strip are observed. If only the T line is colored or both the T line and C line are colored, the sample to be tested contains Brucella and / or its DNA. If only the C line is colored, the sample to be tested does not contain Brucella and / or its DNA.

[0022] Beneficial effects:

[0023] This invention provides an ωRNA for detecting Brucella, the nucleotide sequence of which is shown in SEQ ID NO:4. The ωRNA provided by this invention can recognize the Brucella bp26 gene and, in conjunction with the TnpB protein, exhibits high paracleavage activity against the amplified product of the Brucella bp26 gene. After recognizing the target sequence, the ωRNA cleaves a nonspecific ssDNA reporter probe, allowing for the detection of Brucella via fluorescence detection or nucleic acid test strips, demonstrating high accuracy and sensitivity.

[0024] Furthermore, the kit prepared using the ωRNA provided by this invention is a novel Brucella detection kit with low manufacturing cost and high operability. Using the OMEGA-TnpB detection system, Brucella can be detected on-site at any time outside the laboratory, with a sensitivity of 1×10⁻⁶. 0 The copies / μL method is characterized by high specificity, wide versatility, low operational requirements, high efficiency, and accuracy. Attached Figure Description

[0025] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the accompanying drawings used in the embodiments will be briefly described below.

[0026] Figure 1 A schematic diagram of primer and ωRNA design for isothermal amplification;

[0027] Figure 2 This is a graph of the isothermal amplification products;

[0028] Figure 3 Image showing ωRNA screening;

[0029] Figure 4 The results represent the fluorescence detection sensitivity; where A represents the relative fluorescence intensity after detection of different concentrations of plasmid, and B represents the fluorescence detection results after detection of different concentrations of plasmid.

[0030] Figure 5 The results represent the specificity of fluorescence detection; where A represents the fluorescence value at different times, B represents the relative fluorescence intensity of different pathogens, and C represents the fluorescence detection results of different pathogens.

[0031] Figure 6 This indicates the specificity of the test strip.

[0032] Figure 7 This is the result of fluorescence detection of animal samples; where A represents the fluorescence value of different test samples at different times; B represents the relative fluorescence intensity of different test samples compared to uninfected samples, and ** represents... P <0.01; C represents the fluorescence detection results of different test samples;

[0033] Figure 8 The results of testing animal samples with test strips. Detailed Implementation

[0034] This invention provides an ωRNA for detecting Brucella, the nucleotide sequence of which is shown in SEQ ID NO:4. The ωRNA provided by this invention can specifically recognize the Brucella bp26 gene. Combined with the TnpB protein, it exhibits high paracleavage activity against the amplified product of the Brucella bp26 gene. After recognizing the target sequence, the ωRNA cleaves a nonspecific ssDNA reporter probe. Brucella can be detected using fluorescence detection or nucleic acid test strips, demonstrating high accuracy and sensitivity.

[0035] Based on the above advantages, the present invention provides a fluorescent detection kit for detecting Brucella, comprising ωRNA, isothermal amplification primers, TnpB protein and ssDNA reporter probe 1 as described in the above technical solution; the isothermal amplification primers are isothermal amplification primers for amplifying the Brucella bp26 gene; the ssDNA reporter probe 1 is a nucleic acid molecule modified with fluorescent groups and quenching groups.

[0036] In one embodiment, the nucleotide sequence of the ssDNA reporter probe 1 is 5'-TTTTATTTT-3'; the fluorescent group includes FAM; and the quenching group includes BHQ1.

[0037] In one embodiment, the nucleotide sequences of the isothermal amplification primers are shown in SEQ ID NO:1 and SEQ ID NO:2; the TnpB protein includes the ISDra2 TnpB protein derived from *Mortisus radiata*. The purification method for the ISDra2 TnpB protein derived from *Mortisus radiata* described in this invention is referenced in the literature: [Wang M, Sun Z, Liu Y, et al. Hypercompact TnpB and truncated TnpB systems enable efficient genome editing in vitro and in vivo[J]. Cell Discovery, 2024, 10(1):27. DOI:10.1038 / s41421-023-00645-w.].

[0038] This invention provides a visualization kit for detecting Brucella, comprising the ωRNA, isothermal amplification primers, TnpB protein, ssDNA reporter probe 2, and nucleic acid test strip described in the above-mentioned technical solution; the isothermal amplification primers are isothermal amplification primers for amplifying the Brucella bp26 gene; the ssDNA reporter probe 2 is a nucleic acid molecule modified with a fluorescent group and biotin. The nucleic acid test strip of this invention is a nucleic acid test strip capable of capturing or binding to biotin.

[0039] In one embodiment, the nucleotide sequence of the ssDNA reporter probe 2 is 5'-TTTTATTTT-3'; the fluorescent group includes FAM.

[0040] As one embodiment, the nucleotide sequences of the isothermal amplification primers are shown in SEQ ID NO:1 and SEQ ID NO:2; the TnpB protein includes the ISDra2 TnpB protein derived from *Geococcus radiodurans*.

[0041] The isothermal amplification primers in the kit provided by this invention specifically amplify Brucella DNA using it as a template. The resulting amplification product contains a target sequence that can be recognized by ωRNA. After the ωRNA recognizes the target sequence, the TnpB protein exhibits paracleavage activity against the nonspecific ssDNA reporter probe, enabling fluorescence detection and test strip detection, thereby achieving visual detection of Brucella. The kit provided by this invention allows for on-site detection of Brucella at any time outside of a laboratory setting, and is characterized by its wide applicability, low operational requirements, high efficiency, and accuracy.

[0042] The kit described in the above technical solution of this invention is a novel kit for detecting Brucella nucleic acid, developed based on isothermal amplification technology combined with the OMEGA-TnpB gene editing system. This kit is easy to operate, has low manufacturing cost, and offers advantages such as fast reaction speed, high sensitivity, high specificity, and visually observable results. It enables rapid and efficient detection of Brucella nucleic acid and has promising application prospects.

[0043] Based on the above advantages, the present invention provides the application of the ωRNA described in the above technical solution, or the fluorescence detection kit described in the above technical solution, or the visualization kit described in the above technical solution in (1) and / or (2):

[0044] (1) Non-diagnostic and non-therapeutic detection of Brucella and / or its DNA;

[0045] (2) Screening or assisting in the screening of drugs for the prevention and treatment of Brucella infection.

[0046] In one embodiment, (1) includes detecting Brucella infection in food and / or the living environment of animals. In one embodiment, the animals include cattle and / or sheep.

[0047] As one implementation method, the detection or screening method includes:

[0048] The test samples were amplified by isothermal PCR using isothermal amplification primers to obtain amplification products;

[0049] The amplification product, ωRNA, TnpB protein, and ssDNA reporter probe 1 are reacted, and the fluorescence of the reaction solution is detected. If the reaction solution is fluorescent, the sample contains Brucella and / or its DNA; if the reaction solution is not fluorescent, the sample does not contain Brucella and / or its DNA.

[0050] Alternatively, the amplification product, ωRNA, TnpB protein, and ssDNA reporter probe 2 are reacted, and the nucleic acid test strip is inserted into the reaction solution. The T line and C line on the nucleic acid test strip are observed. If only the T line is colored or both the T line and C line are colored, the sample to be tested contains Brucella and / or its DNA. If only the C line is colored, the sample to be tested does not contain Brucella and / or its DNA.

[0051] To further illustrate the present invention, the following detailed description, in conjunction with embodiments and accompanying drawings, describes a kit for detecting Brucella ωRNA, a fluorescent detection kit, a visualization kit, and their applications, but these descriptions should not be construed as limiting the scope of protection of the present invention.

[0052] Example 1: Design of primers and ωRNA for isothermal amplification of Brucella bp26 gene

[0053] 1.1 Based on the Brucella bp26 gene DNA sequence, isothermal amplification primers F and R were designed using Primer Premier5. The specific sequences are as follows:

[0054] F: 5'-GCTACGCCAGGCAAAGAC-3' (SEQ ID NO: 1);

[0055] R: 5'-CGTGACGGATTCATCCAAA-3' (SEQ ID NO: 2);

[0056] First, the bp26 gene sequence (SEQ ID NO:3) was synthesized and ligated into the pMD19-T vector as an amplification template. The template was then serially diluted to 1×10⁻⁶. 3 DNA was amplified at a constant temperature using copies / μL. The isothermal amplification kit was purchased from Guangzhou Aidi Gene Technology Co., Ltd. The isothermal amplification system consisted of: 29.4 μL A buffer, 2 μL F, 2 μL R, 1 μL DNA template, 2.5 μL B buffer, and ddH2O added to a final volume of 50 μL.

[0057] bp26:

[0058] 5'--3' (SEQ ID NO:3).

[0059] After isothermal amplification, the agarose gel electrophoresis was performed, and the electrophoresis results were observed and photographed using a gel imaging system. The results are as follows: Figure 2 As shown, the F and R primer sets amplified a bright target band with a length of 265 bp.

[0060] 1.2 Design ωRNA based on the isothermal amplification products of F and R, see schematic diagram. Figure 1, where 5’-GCCGCCTGTCTGGAGATCGC-3’ (SEQ ID NO:7) is the sequence on ωRNA that recognizes the isothermal amplification product, and the TAM sequence is TTGAT. The specific sequences are as follows:

[0061] ωRNA-1:

[0062] 5’-GATTCAAGAATCCCGAAGTGAAGAATCTTGCCGTCCGTACATGGACTTGCCCGAACTGTGGGGAAACCCATGACCGAGACGAGAACGCTGCGCTGAACATTCGGCGTGAAGCGTTGGTGGCTGCGGGAATCTCAGACACCTTAAACGCTCATGGAGGCTATGTCAGACCTGCTTCGGCGGGCAATGGTCTGCGAAGTGAGAATCACGCGACTTTAGTCGTGTGAGGTTCAAGCCGCCTGTCTGGAGATCGC-3’ (SEQ ID NO:4);

[0063] ωRNA-2:

[0064] 5’-GATTCAAGAATCCCGAAGTGAAGAATCTTGCCGTCCGTACATGGACTTGCCCGAACTGTGGGGAAACCCATGACCGAGACGAGAACGCTGCGCTGAACATTCGGCGTGAAGCGTTGGTGGCTGCGGGAATCTCAGACACCTTAAACGCTCATGGAGGCTATGTCAGACCTGCTTCGGCGGGCAATGGTCTGCGAAGTGAGAATCACGCGACTTTAGTCGTGTGAGGTTCAAGCCGCCTGTCTGGAGATCGCGA-3’ (SEQ ID NO:5);

[0065] ωRNA-3:

[0066] 5'-GATTCAAGAATCCCGAAGTGAAGAATCTTGCCGTCCGTACATGGACTTGCCCGAACTGTGGGGAAACCCATGACCGAGACGAGAACGCTGCGCTGAACATTCGGCGTGAAGCGTTGGTGGCTGCGGGAA TCTCAGACACCTTAAACGCTCATGGAGGCTATGTCAGACCTGCTTCGGCGGGCAATGGTCTGCGAAGTGAGAATCACGCGACTTTAGTCGTGTGAGGTTCAAGCCGCCTGTCTGGAGATCGCGATC-3' (SEQ ID NO:6);

[0067] The isothermal amplification products were subjected to fluorescence detection using ωRNA-1, ωRNA-2, and ωRNA-3 as guide sequences, respectively. The fluorescence reaction system was as follows: 2 μL TnpB, 1 μL ωRNA, 5 μL 10×Buffer, 1 μL ssDNA reporter probe 1 (FAM-TTTTATTTT-BHQ1), 1 μL isothermal amplification product, and water was added to a final volume of 50 μL.

[0068] FAM fluorescence signals were collected once per minute and detected continuously for 20 minutes.

[0069] Test results as follows Figure 3 As shown (** is) P (<0.01, the same applies to the figure below), so the ωRNA-1 with the highest paracleavage activity was selected for subsequent detection.

[0070] Example 2: Sensitivity detection of Brucella based on the OMEGA-TnpB detection kit

[0071] The high concentration of the bp26 gene plasmid was serially diluted to 1×10⁻⁶. 5 1×10 4 1×10 3 1×10 2 1×10 1 and 1×10 0 Copies / μL, with NC (enzyme-free water) as the negative control, were used for fluorescence detection. The detection method was the same as in Example 1.

[0072] The results are as follows Figure 4 As shown in the figure, A represents the relative fluorescence intensity after detection with different plasmid concentrations, and B represents the fluorescence detection results after detection with different plasmid concentrations. The results show that the sensitivity of fluorescence reading is 1×10⁻⁶. 0copies / μL. This indicates that the OMEGA-TnpB-based Brucella detection kit has good sensitivity.

[0073] Example 3: Specific detection of Brucella based on the OMEGA-TnpB detection kit

[0074] Using Brucella ( Brucella NCBI Taxonomy ID:235), Bovine viral diarrhea virus ( ...) Bovine viral diarrhea virus BVDV, NCBI Taxonomy ID:11099), Bovine nodular dermatitis virus (BVDV, NCBI Taxonomy ID:11099), Lumpy Skin disease virus LSDV, NCBI Taxonomy ID: 376849) and bovine tuberculosis mycobacterium ( Mycobacterium bovis The specificity of the kit was verified by using nucleic acid (NCBI Taxonomy ID: 1765) as an amplification template for fluorescence detection and test strip detection.

[0075] The fluorescence detection method is the same as in Example 1.

[0076] The test strip reaction system consisted of: 2 μL TnpB, 1 μL ωRNA, 3 μL 10×Buffer, 1 μL isothermal amplification product, 1 μL ssDNA reporter probe 2 (FAM-TTTTATTTTT-Biotin), and water to a final volume of 30 μL. The mixture was incubated at 37°C for 20 minutes. The nucleic acid test strip was then inserted into the reaction solution to read the results (positive result is indicated by a single "T" line or both "T" and "C" lines; negative result is indicated by a "C" line and no "T" line). The nucleic acid test strip was purchased from AidiGene (catalog number: EDN-CZ01). Detection results are shown below. Figure 5 and Figure 6 ,in, Figure 5 In the figure, A represents the fluorescence value at different times. Figure 5 In the figure, B represents the relative fluorescence intensity of different pathogens. Figure 5 In the middle, C represents the fluorescence detection results of different pathogens.

[0077] Fluorescence detection ( Figure 5 ) and test strip detection ( Figure 6 All tests were able to accurately read the Brucella positive results, and there was no obvious cross-reaction with the nucleic acids of the other four pathogens that infect cattle and sheep, indicating that the OMEGA-TnpB-based Brucella detection kit has good specificity.

[0078] Example 4: Application of the OMEGA-TnpB-based Brucella detection kit

[0079] To verify the effectiveness of the kit in detecting Brucella in real samples, this example collected 8 samples infected with Brucella virus (including 2 bovine blood samples, 2 sheep blood samples, 2 cow milk samples, and 2 sheep milk samples) and 2 samples not infected with Brucella virus for application evaluation. First, a room temperature sample lysis kit (purchased from Nanjing Novizan Biotechnology Co., Ltd.) was used. The samples were incubated at room temperature for 3 minutes, and then the bp26 gene fragment product was obtained by isothermal amplification. Fluorescence detection and test strip detection were then performed, using the same method as in Example 3.

[0080] The results are as follows Figure 7 and 8 As shown, where, Figure 7 In the figure, A represents the fluorescence value of different test samples at different times; Figure 7 In the diagram, B represents the relative fluorescence intensity of different test samples. Compared with uninfected samples, ** represents... P <0.01; Figure 7 In the middle, C represents the fluorescence detection results of different test samples. Figure 8 This is the test result of the test strip.

[0081] The results showed that the positive detection rate of the fluorescence method was 100% (8 / 8) and the positive detection rate of the test strip method was 100% (8 / 8) in different samples.

[0082] Although the above embodiments have provided a detailed description of the present invention, they are only some embodiments of the present invention, and not all embodiments. People can obtain other embodiments based on these embodiments without creative effort, and these embodiments all fall within the protection scope of the present invention.

Claims

1. A fluorescent detection kit for detecting Brucella, characterized by, The kit comprises an omega RNA, a TnpB protein, and a ssDNA reporter probe 1; the nucleotide sequence of the omega RNA is shown as SEQ ID NO: 4; the TnpB protein is an ISDra2 TnpB protein from Deinococcus radiodurans; and the ssDNA reporter probe 1 is a nucleic acid molecule modified with a fluorescent group and a quencher group.

2. The fluorescent detection kit according to claim 1, characterized in that, The nucleotide sequence of the ssDNA reporter probe 1 is 5'-TTTTATTTT-3'; the fluorescent group comprises FAM; and the quencher group comprises BHQ1.

3. The fluorescence detection kit according to claim 1 or 2, characterized in that, The nucleotide sequence of the TnpB protein is shown as SEQ ID NO:

3.

4. A visualisation kit for detecting Brucella, characterised in that, The kit comprises an omega RNA, a TnpB protein, a ssDNA reporter probe 2, and a nucleic acid detection test strip; the nucleotide sequence of the omega RNA is shown as SEQ ID NO: 4; the TnpB protein is an ISDra2 TnpB protein from Deinococcus radiodurans; and the ssDNA reporter probe 2 is a nucleic acid molecule modified with a fluorescent group and biotin.

5. The visualization kit of claim 4, wherein, The nucleotide sequence of the ssDNA reporter probe 2 is 5'-TTTTATTTT-3'; and the fluorescent group comprises FAM.

6. The visualization kit of claim 4 or 5, wherein, The nucleotide sequence of the TnpB protein is shown as SEQ ID NO:

3.

7. Use of the fluorescent detection kit of any one of claims 1-3 or the visualization kit of any one of claims 4-6 in (1) and / or (2): (1) non-diagnostic and non-therapeutic detection of Brucella and / or DNA thereof; (2) screening or assisting in screening of drugs for preventing and treating Brucella infection.

8. Use according to claim 7, characterized in that, The (1) comprises detection of food and / or animal living environment infected with Brucella.

9. Use according to claim 7 or 8, characterized in that, The method for detection or screening comprises: performing isothermal PCR amplification on the sample to be tested by using the isothermal amplification primer, to obtain an amplification product; reacting the amplification product, the omega RNA, the TnpB protein, and the ssDNA reporter probe 1, to detect whether the reaction solution has fluorescence; if the reaction solution has fluorescence, the sample to be tested contains Brucella and / or DNA thereof; and if the reaction solution has no fluorescence, the sample to be tested does not contain Brucella and / or DNA thereof; or, reacting the amplification product, the omega RNA, the TnpB protein, and the ssDNA reporter probe 2, inserting the nucleic acid detection test strip into the reaction solution, and observing the T line and the C line on the nucleic acid detection test strip; if only the T line develops color or both the T line and the C line develop color, the sample to be tested contains Brucella and / or DNA thereof; and if only the C line develops color, the sample to be tested does not contain Brucella and / or DNA thereof.

Citation Information

Patent Citations

  • High-temperature-resistant TnpB protein and application thereof in nucleic acid detection

    CN117512071A

  • Application of programmable TnpB nuclease gene editing

    CN119752847A