Construction method and application of KPCDK mouse model derived from inflammatory induced senescence cells

By constructing an inflammation-induced senescent cell-origin KPCDK mouse model, the problem of existing models being unable to simulate the dynamic causal relationship between cellular senescence and pancreatic cancer development has been solved, enabling efficient experiments to rapidly generate pancreatic cancer and enhancing the model's scientific research value and clinical translation potential.

CN121369293APending Publication Date: 2026-01-23FUDAN UNIV SHANGHAI CANCER CENT
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202511277928.9
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-09-09
Publication Date
2026-01-23

AI Technical Summary

Technical Problem

Existing mouse models are difficult to simulate the dynamic causal relationship between cellular senescence and pancreatic cancer development in the context of an intact immune system. They cannot effectively study the origin, distribution, and microenvironmental regulatory functions of senescent cells. Furthermore, the model construction process is cumbersome and lacks a true genetic background that reflects the natural occurrence mechanism of pancreatic cancer.

Method used

By crossing mice expressing the Cdkn2a-CreER2 gene with mice that have mutations in both the KrasLSL-G12D and Trp53R172H genes, and then inducing the development of pancreatic cancer through injection of tamoxifen and serotonin, an inflammation-induced KPCDK mouse model of senescent cell origin was constructed to mimic the natural development of pancreatic cancer.

Benefits of technology

It provides a highly reproducible and controllable animal model that can rapidly induce pancreatic cancer, reflecting the natural occurrence mechanism of pancreatic cancer, shortening the experimental cycle of spontaneous tumor formation, improving experimental efficiency, and providing a reliable platform for studying the relationship between pancreatic aging and cancer development and targeted therapy.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121369293A_ABST
    Figure CN121369293A_ABST
Patent Text Reader

Abstract

The invention discloses a construction method and application of a KPCDK mouse model originated from inflammatory senescence cells induced by inflammation and senescence, the construction method of the model comprises the following steps: hybridizing a mouse expressing a Cdkn2a-CreER2 gene with a mouse in which both KrasLSL-G12D and Trp53R172H are mutated to obtain a KPCDK mouse, and the genotypes of the KPCDK mouse are KrasLSL-G12D / +, Trp53R172H / + and Cdkn2a-CreER2 / +; the KPCDK mouse model is obtained by carrying out injection induction on a KPCDK mouse by using rain frog element and tamoxifen. According to the application, through the combined action of the leifrotin and the tamoxifen, the spontaneous tumorigenesis experiment period can be shortened, the experiment efficiency can be improved, the experiment cost can be saved, and a basis is better provided for the research of an aging tumorigenesis mechanism caused by pancreatic cancer and inflammation and the research and development of medicines.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the technical field of animal model construction, specifically to a method for constructing an inflammation-induced senescent cell-derived KPCDK mouse model and its application. Background Technology

[0002] Pancreatic cancer is a malignant tumor originating from pancreatic tissue. Although its incidence is relatively low compared to other common cancers, its mortality rate is extremely high, with a five-year survival rate of less than 10%, making it one of the most aggressive types of cancer. Pancreatic cancer is generally divided into two main types: pancreatic ductal adenocarcinoma and pancreatic neuroendocrine tumor. Among them, pancreatic ductal adenocarcinoma is the most common form, accounting for approximately 90% of all pancreatic cancer cases. Due to the insidious location and nonspecific clinical symptoms of pancreatic cancer, patients are often diagnosed at an advanced stage of the disease. Currently, the main treatments for pancreatic cancer remain surgery and traditional radiotherapy and chemotherapy, such as FOLFIRINOX and gemcitabine plus albumin-bound paclitaxel, but the overall prognosis for patients is poor.

[0003] The treatment efficacy of pancreatic cancer is often influenced by multiple factors in the tumor microenvironment (TME). The pancreatic cancer microenvironment contains a large number of immunosuppressive cells, fibroblasts, and a highly dense stromal barrier. However, in vitro studies, subcutaneous tumorigenesis, and in situ tumorigenesis models cannot fully simulate the natural evolution of pancreatic cancer from precancerous lesions to invasive cancer, nor can they effectively study changes in the microenvironment under normal immune system conditions. Meanwhile, in recent years, the potential role of cellular senescence, especially senescence-associated secretory phenotypes (SASPs), in shaping the pancreatic cancer immune microenvironment and promoting tumor progression has gradually attracted attention. However, current in vitro studies and subcutaneous tumorigenesis models struggle to simulate the dynamic causal relationship between cellular senescence and pancreatic cancer development in a complete immune system context, and cannot clearly trace the origin, distribution, and microenvironmental regulatory functions of senescent cells.

[0004] Chronic pancreatitis is an independent high-risk factor for pancreatic cancer, and numerous studies have been conducted on the incidence and relative risk of pancreatic cancer in patients with chronic pancreatitis. Reports show that the incidence of pancreatic cancer in patients with chronic pancreatitis ranges from 0.7% to 2.9%, with a relative risk of 7.6 to 68.1 times higher than the general population. Patients with autosomal dominant chronic pancreatitis carrying acquired PRSS1 mutations have an extremely high relative risk of pancreatic cancer, reaching up to 87 times higher, and this risk increases with the duration of pancreatitis. In some patients, acute pancreatitis may also be an early symptom of pancreatic cancer, especially in middle-aged and elderly patients presenting with unexplained acute pancreatitis, which should raise high suspicion of potential pancreatic cancer. Multiple epidemiological and genetic studies have found a certain correlation between pancreatitis and pancreatic cancer in their pathogenesis. Further research into the link between pancreatitis aging and the development and progression of pancreatic cancer is of great significance for early screening, early warning, and intervention in high-risk populations.

[0005] Acute pancreatitis is not limited to local inflammation of the pancreas; it often triggers systemic inflammatory response syndrome (SIRS), leading to secondary damage to multiple organs. Adipose tissue is one of the important early sites of involvement. Pancreatic lipases infiltrate adjacent and distant adipose tissues, hydrolyzing triglycerides to generate large amounts of non-esterified fatty acids (NEFAs). These NEFAs can directly induce adipocyte necrosis and activate macrophages to release pro-inflammatory factors such as TNF-α and IL-6, forming a "lipotoxic" amplification cycle that exacerbates systemic inflammation. Skeletal muscle is also significantly affected in the context of SIRS. Inflammatory mediators and oxidative stress activate ubiquitin-proteasome and autophagy-lysosomal degradation pathways, leading to accelerated muscle protein breakdown and inhibition of satellite cell function, manifested as muscle wasting and decreased strength in the acute phase. The liver is prone to hepatocellular damage and cholestasis due to pro-inflammatory cytokine storms, translocation of enterogenic endotoxins, and hepatic microcirculatory disturbances, which can progress to liver failure in severe cases. The cumulative secondary damage to these organs constitutes a key mechanism in the evolution of acute pancreatitis from local lesions to a systemic critical state.

[0006] Currently, several mouse models of spontaneous pancreatic cancer tumorigenesis have been reported, among which the KPC model is the most widely used and classic. The KPC mouse model is driven by Cre recombinase specifically expressed in the pancreas, leading to Kras... LSL-G12D and Trp53 R172H The gene is specifically activated in pancreatic epithelial cells, and this model typically uses the Pdx1-Cre system to achieve pancreatic-specific expression. The Kras mutant gene contains a Lox-stop-Lox termination sequence upstream, which is not expressed in the absence of Cre recombinase. After linking the Cre recombinase to the Pdx1 promoter, it is expressed in the acini, islets, and ducts of the pancreas. In Cre-mediated gene recombination, the Lox-stop-Lox termination sequence in the mutant Kras gene is removed, allowing Kras protein expression in the pancreas. Although the KPC mouse model can spontaneously progress from normal acinar cells through acinar-ductal metaplasia and pancreatic intraepithelial neoplasia to invasive pancreatic ductal adenocarcinoma, this model is not suitable for systematically studying the causal relationships and dynamic changes between pancreatitis—the inflammatory microenvironment—cellular senescence and the development and progression of pancreatic cancer.

[0007] Viola spp. is a decapeptide polypeptide isolated from the skin of the Australian green tree frog. It possesses biological activity similar to cholecystokinin, specifically activating cholecystokinin receptors on the surface of pancreatic cells. This strongly stimulates pancreatic acinar cells to secrete digestive enzymes, inducing persistent inflammation, fibrosis, and acinar loss in the pancreas. The pathological changes are highly similar to those in human pancreatitis, hence viola spp. is widely used to construct mouse models of pancreatitis. Repeated intraperitoneal injections of viola spp. can induce acute or chronic pancreatitis. Inducing an acute pancreatitis model in mice typically involves eight intraperitoneal injections of viola spp. (10 μg / mL working solution, 200 μL each time), one hour apart, for two consecutive days. Obvious acinar duct metaplasia appears early after acute inflammation (day 3). Multiple weekly injections at lower doses for several weeks can lead to chronic pancreatitis, characterized by pancreatic fibrosis and acinar loss.

[0008] In the field of research on taeniacin and mice, there is also a mouse model of pancreatic in situ carcinoma constructed by intraperitoneal injection of taeniacin combined with in situ injection of the potent carcinogen DMBA into the pancreatic tail. Although this model can simulate the process of inflammation promoting carcinogenesis, it is relatively complicated to construct because it relies on chemical carcinogens and requires surgical operation, and it lacks the real genetic background that reflects the natural occurrence mechanism of pancreatic cancer.

[0009] Therefore, developing an inflammation-induced pancreatic cancer mouse model originating from senescent cells can reproduce the entire process from inflammatory stimulation and cellular senescence to carcinogenesis, becoming a key tool for elucidating the "senescence-microenvironment remodeling-carcinogenesis" chain mechanism. This mouse model can not only reveal the role of senescent cells in pancreatic tumorigenesis but also provide theoretical support and new strategies for targeted intervention in high-risk populations (such as the elderly and patients with pancreatitis). In summary, in-depth research into the mechanisms of pancreatic cancer development driven by senescence, and the development of novel and more targeted animal models based on this, is of great significance for understanding the origin of pancreatic cancer and discovering new therapeutic targets. Summary of the Invention

[0010] The purpose of this invention is to address the shortcomings of existing technologies by providing a method for constructing and applying an inflammation-induced senescent cell-derived mouse model of pancreatic cancer, thereby providing a more targeted animal model for research, drug screening, and therapeutic targets of tumors such as pancreatic cancer driven by aging.

[0011] Technical solution of the present invention

[0012] In a first aspect, the present invention provides a method for constructing an inflammation-induced senescent cell-derived KPCDK mouse model, employing the following technical solution:

[0013] A method for constructing an inflammation-induced senescent cell-derived KPCDK mouse model includes the following steps: mixing mice expressing the Cdkn2a-CreER2 gene with Kras... LSL-G12D and Trp53 R172H Mice with the same gene mutation were crossbred to obtain KPCDK mice, the genotype of which is Kras. LSL-G12D / + Trp53 R172H / + and Cdkn2a-CreER2 / + The KPCDK mouse model was obtained by injecting tamoxifen and tamoxifen into the mice.

[0014] Furthermore, the method for constructing mice expressing the Cdkn2a-CreER2 gene includes: crossing C57BL / 6-Cdkn2a-CreERT2 gene mice with wild-type C57BL / 6 mice to obtain positive mice expressing the Cdkn2a-CreER2 gene.

[0015] Furthermore, the Kras LSL-G12D and Trp53 R172H The method for constructing mice with all gene mutations includes: using C57BL / 6-Kras... LSL-G12D Mice and C57BL / 6-Trp53 R172H Mouse hybridization to obtain Kras LSL-G12D and Trp53 R172H Positive mice with all gene mutations.

[0016] Furthermore, when inducing KPCDK mice through injection, the KPCDK mice were 6-8 weeks old. On day 1, they were injected with tamoxifen solution at an induction dose of 80 μg / kg / time, for a total of 7 injections, with an interval of 1 hour between each injection. From day 2 to day 8, they were injected with tamoxifen solution at an induction dose of 80 mg / kg / time, for a total of 1 injection per day. The injections were administered via intraperitoneal injection.

[0017] Secondly, the present invention provides an inflammation-induced KPCDK mouse model originating from senescent cells, employing the following technical solution:

[0018] An inflammation-induced senescent cell-derived KPCDK mouse model is constructed using the aforementioned method for constructing an inflammation-induced senescent cell-derived KPCDK mouse model.

[0019] Thirdly, this invention provides an application of an inflammation-induced senescent cell-derived KPCDK mouse model in studying the role of Kras, Trp53, or Cdkn2a gene mutations in tumorigenesis and development, screening of tumor therapeutic drugs, and evaluation of treatment strategies.

[0020] Furthermore, the tumor includes both benign and malignant tumors.

[0021] Furthermore, the malignant tumors include pancreatic cancer, liposarcoma, liver cancer, and rhabdomyosarcoma, and the benign tumors include lipomas.

[0022] Fourthly, this invention provides an application of an inflammation-induced senescent cell-derived KPCDK mouse model in studying the mechanisms of pancreatic cancer development, treatment methods, screening drugs for treating pancreatic cancer, evaluating the therapeutic effects of candidate antitumor drugs, cell therapy, and gene therapy strategies in vivo.

[0023] Furthermore, the pancreatic cancer mentioned is poorly differentiated pancreatic cancer.

[0024] Fifthly, this invention provides an application of an inflammation-induced senescent cell-derived KPCDK mouse model in the study of pancreatitis-induced systemic inflammatory response and its effects on distant organs.

[0025] Furthermore, the applications include: applications in the study of systemic inflammation associated with senescent cells, drug screening, or the development of treatment strategies; wherein the systemic inflammation associated with senescent cells includes, but is not limited to, systemic inflammation induced by pancreatitis; the study includes research on the mechanisms of distant organ damage caused by systemic inflammation; the drug screening includes screening candidate drugs targeting senescent cells or systemic inflammation; and the treatment strategy development includes the design of intervention programs for inflammation-related diseases.

[0026] Furthermore, the remote organs include the lungs, liver, kidneys, heart, brain, fat, or muscle.

[0027] Furthermore, the drug screening includes evaluating the effects of candidate drugs on the clearance of senescent cells, inhibition of inflammatory factors, or protection of distant organs.

[0028] Furthermore, the development of the treatment strategies includes targeted interventions against senescent cells, anti-inflammatory interventions, or multi-organ protection strategies.

[0029] Beneficial technical effects of this application

[0030] This invention provides a method for constructing an inflammation-induced senescent cell-derived KPCDK mouse model. It innovatively integrates the mutation characteristics of three key genes—Cdkn2a, Kras, and Trp53—into a single mouse model and, through the synergistic effect of tamoxifen and tadalafil, establishes an animal model capable of rapidly inducing pancreatic cancer within two months. The KPCDK mouse model exhibits high reproducibility and good controllability, possesses a realistic genetic background reflecting the natural occurrence mechanism of pancreatic cancer, and more closely resembles the pathogenesis of human pancreatic cancer. It can specifically study the relationship between pancreatic aging and pancreatic cancer development, and shortens the spontaneous tumorigenesis experimental cycle, improves experimental efficiency, and saves experimental costs, providing a reliable platform for elucidating tumorigenesis mechanisms and developing targeted therapeutic drugs.

[0031] Furthermore, the KPCDK mouse model has the ability to simulate the occurrence of various benign and malignant solid tumors, providing possibilities for expanding applications in studying the development mechanisms of various benign / malignant tumors, screening therapeutic drugs, and evaluating related treatment strategies, thereby further enhancing the scientific research value and clinical translation potential of this animal model.

[0032] Furthermore, the KPCDK mouse model provides a powerful tool for studying the role of inflammation-induced cellular senescence in the occurrence and progression of tumors such as pancreatic cancer, which helps to reveal the intrinsic link between inflammation and tumor evolution and lays an experimental foundation for the exploration and validation of relevant intervention strategies.

[0033] Furthermore, the KPCDK mouse model not only provides a reliable tool for studying the mechanisms of systemic inflammation associated with senescent cells (including but not limited to systemic inflammation induced by pancreatitis), screening candidate drugs targeting senescent cells or systemic inflammation, and designing intervention programs for inflammation-related diseases, but also allows for in-depth exploration of the mechanisms of damage to distant organs such as the lungs, liver, kidneys, heart, brain, fat, or muscle caused by systemic inflammation. It can also evaluate the effects of candidate drugs on clearing senescent cells, inhibiting inflammatory factors, or protecting distant organs, thus contributing to the development of targeted interventions, anti-inflammatory interventions, or multi-organ protection strategies for senescent cells. Simultaneously, it possesses the ability to simulate the occurrence of various benign and malignant solid tumors, providing expanded applications for studying the mechanisms of development and progression of various benign / malignant tumors, screening therapeutic drugs, and evaluating related treatment strategies. In particular, it demonstrates unique advantages in studying the role of inflammation-induced cellular senescence in the occurrence and progression of tumors such as pancreatic cancer, helping to deeply reveal the intrinsic link between inflammation and tumor evolution, laying an experimental foundation for the exploration and validation of related intervention strategies, and significantly enhancing the scientific research value and clinical translation potential of this animal model. Attached Figure Description

[0034] Figure 1 The diagram shows the KPCDK mouse model obtained in Example 1 (left) and the conditional gene expression pattern (right).

[0035] Figure 2 The images show in vivo imaging and Luciferase expression levels in the KPCDK mouse model and wild-type control mice in Example 1; where 2a is an example of in vivo imaging of mice in the left lateral decubitus position on days 0, 2, 5, and 8, and 2b is a statistical chart of Luciferase expression levels in mice on days 0, 2, 5, and 8. The horizontal axis represents the number of days, and the vertical axis represents the Luciferase expression level.

[0036] Figure 3 SA-β-Gal aging staining in the KPCDK mouse model of Example 1; where 3a is an example image of frozen section staining of pancreas before injection of taurine (200×), and 3b is an example image of frozen section of pancreas sample taken on day 3 of induction (400×);

[0037] Figure 4 This is an anatomical diagram of pancreatic tumor formation in the KPCDK mouse model in Example 2; where 4a is a gross example of the KPCDK mouse model and 4b is an example of pancreatic tumor tissue.

[0038] Figure 5 Example image (400×) of frozen sections of pancreatic tumor tissue sampled after tumor formation in the KPCDK mouse model in Example 2, stained with SA-β-Gal senescence.

[0039] Figure 6 The images shown are examples of paraffin-embedded sections of pancreatic tumor tissue stained after tumor formation in the KPCDK mouse model in Example 2. Among them, 6a is an example of HE staining of pancreatic tumor tissue (100×), and 6b is an example of HE staining of pancreatic tumor tissue (400×).

[0040] Figure 7 Example image (200×) of CD68 paraffin section staining of pancreatic tumor tissue after tumor formation in the KPCDK mouse model in Example 2;

[0041] Figure 8 Example image (200×) of HE staining of pancreas from a normal wild-type mouse in Example 2;

[0042] Figure 9 This is an example image (200×) of HE staining of lipomas, benign tumors of non-pancreatic origin, that appeared in some KPCDK mouse models during the induction of the KPCDK mouse model in Example 2.

[0043] Figure 10 This is an example image (200×) of HE staining of rhabdomyosarcoma, a non-pancreatic malignant tumor, in some KPCDK mouse models during the induction process in Example 2.

[0044] Figure 11 This is an example image (200×) of HE staining of some KPCDK mouse models that developed non-pancreatic malignant tumors—liver cancer—during the induction of the KPCDK mouse model in Example 2.

[0045] Figure 12 This is an example image (200×) of HE staining of liposarcoma, a non-pancreatic malignant tumor, in some KPCDK mouse models during the induction process in Example 2.

[0046] Figure 13 This is an example image of pancreatic tumor tissue from the KPC mouse model in Comparative Example 1.

[0047] Figure 14 Example image (400×) of HE staining of pancreatic tumor tissue from the KPC mouse model in Comparative Example 1. Detailed Implementation

[0048] The present invention will be further described below with reference to the accompanying drawings and embodiments, but this is not intended to limit the invention. It should be noted that, unless otherwise specified, the embodiments and features described in the embodiments of the present invention can be combined with each other.

[0049] Example 1

[0050] A method for constructing an inflammation-induced senescent cell-derived KPCDK mouse model includes the following steps:

[0051] Step 1: Construction of Cdkn2a-CreER2 positive mice:

[0052] The expression C57BL / 6Smoc-Cdkn2a will be used. Luc-tdTomato -CreERT2 gene mice were crossed with wild-type C57BL / 6JGpt-wt / wt mice to obtain Cdkn2a-CreER2. / + Heterozygous mice; then the above Cdkn2a-CreER2 / + Heterozygous mice were self-crossed to obtain the mutant Cdkn2a-CreER2. + / + Homozygous positive mice; mutant Cdkn2a-CreER2 + / + Homozygous positive mice were used as F0 generation mice, and the genotypes of F0 generation mice were identified by PCR.

[0053] The above expression is C57BL / 6Smoc-Cdkn2a Luc-tdTomato -CreERT2 gene mice were purchased from Shanghai Southern Model Biotechnology Co., Ltd., catalog number NM-KI-18039; the C57BL / 6Smoc-Cdkn2a mice were... Luc-tdTomatoThe method for constructing the CreERT2 gene mouse includes: knocking the Luc-2A-tdTomato-2A-CreERT2-WPRE-pA expression cassette into the exon2 (after the 62nd amino acid) of the Cdkn2a gene Cdkn2a-201 transcript;

[0054] The above-mentioned wild-type C57BL / 6JGpt-wt / wt mice were purchased from Jiangsu Jicui Yaokang Biotechnology Co., Ltd., catalog number N000013.

[0055] The above-mentioned PCR method for genotyping includes the following steps:

[0056] (1) Obtaining mouse DNA by alkaline boiling method: Place the mouse tail (about 5 mm in length) or toe (about 2 mm in length) at the bottom of the tube, add 100 μL of 50 mM NaOH solution, centrifuge the mouse tail / toe to the bottom of the tube, heat at 100℃ for 45 min in a PCR instrument, cool on ice for 2 min, vortex mix, add 30 μL of Tris-HCl (pH 6.8) to neutralize, and obtain the mouse DNA sample solution; temporarily store the mouse DNA sample solution on ice at 4℃, or store it in a -20℃ freezer for later use.

[0057] (2) PCR amplification:

[0058] PCR amplification was performed on mouse DNA sample solutions using Cdkn2a-CreER2 gene mutant primers and Cdkn2a-CreER2 gene wild-type primers, respectively, to obtain mouse DNA sample solutions after PCR amplification.

[0059] The PCR amplification system is shown in Table 1 below:

[0060] Table 1 PCR amplification system

[0061] Element volume 2×EasyTaq PCR premix 10μL Forward primer (10mM) 1μL Reverse primer (10mM) 1μL mouse DNA sample solution 2μL <![CDATA[ddH2O]]> Make up to 20 μL

[0062] The sequences of the forward primers for the Cdkn2a-CreER2 gene mutant bands are shown in SEQ ID NO.1 (5'-3'): ATAGGGCTTCTTTCTTGGGTCC, and the sequences of the reverse primers are shown in SEQ ID NO.2 (5'-3'): TCACGTTCATTATAAATGTCGTTCG;

[0063] The sequence of the forward primer for the wild-type band of the Cdkn2a-CreER2 gene is shown in SEQ ID NO.3 (5'-3'): TGTGTGTAAGAAGAATTCCAAGGC, and the sequence of the reverse primer is shown in SEQ ID NO.4 (5'-3'): GAACGCAAATATCGCACGATG;

[0064] The PCR amplification program was as follows: 94℃ pre-denaturation for 10 min; 94℃ denaturation for 20 s, 56℃ annealing for 30 s, 72℃ extension for 1 min, 35 cycles; 72℃ hold for 5 min to obtain the mouse DNA sample solution after PCR amplification, which was then stored at 4℃ for testing.

[0065] (3) DNA electrophoresis:

[0066] Prepare a 2% agarose gel (dissolve 2g of agarose in 100mL of 1×TAE buffer, heat in a microwave oven until the agarose melts, add 10μL of SuperRed nucleic acid dye, mix well, pour into an electrophoresis template, insert a comb, and use after cooling).

[0067] 10 μL of PCR-amplified mouse DNA sample solution was loaded into the wells of a 2% agarose gel, along with 10 μL of DNA marker. Electrophoresis was performed at 120V for 30-40 min to separate the DNA fragments in the agarose gel. After electrophoresis, the DNA bands in the agarose gel were observed using a gel imaging system.

[0068] The expected results are: a wild-type band of Cdkn2a-CreER2 gene of 418 bp and a mutant band of Cdkn2a-CreER2 gene of 469 bp.

[0069] Based on the PCR genotyping method described above, mice with positive mutant bands and negative wild-type bands were screened, which are the F0 generation Cdkn2a-CreER2 mice. + / + Homozygous positive mice.

[0070] Step 2, pancreas-specific mutation Kras LSL-G12D and Trp53 R172H Mouse construction:

[0071] C57BL / 6Smoc-Kras em4(LSL-G12D)Smoc Mice and C57BL / 6Smoc-Trp53 em4(R172H)Smoc Mice were crossbred to obtain KP mice (genotype Kras). LSL-G12D / + Trp53 R172H / + Then, the two KP mice were self-crossed to obtain Kras. LSL -G12D / + and Trp53 R172H+ / + Genotype mice; Kras LSL-G12D / + and Trp53 R172H+ / + Genotype mice were used as F0 generation mice. The genotype of F0 generation mice was determined by PCR identification and nucleic acid sequencing.

[0072] The aforementioned C57BL / 6Smoc-Kras em4(LSL-G12D)Smoc Mice were purchased from Shanghai Southern Model Organisms Technology Co., Ltd., catalog number NM-KI-190003; the C57BL / 6Smoc-Kras mice were... em4(LSL-G12D)Smoc The method for constructing mice includes: inserting Lox-longStop-Lox into intron1 of the Kras gene and introducing a G12D point mutation into exon2;

[0073] The aforementioned C57BL / 6Smoc-Trp53 em4(R172H)Smoc Mice were purchased from Shanghai Southern Model Biotechnology Co., Ltd., catalog number NM-KI-18028; the C57BL / 6Smoc-Trp53 mice were... em4(R172H)Smoc The method for constructing mice involves mutating the 172nd amino acid in the protein encoded by Trp53 from arginine (Arg, R) to histidine (His, H) to obtain heterozygous mice with the p.R172H point mutation in the Trp53 gene.

[0074] The above-mentioned PCR method for genotyping includes the following steps:

[0075] (1) Obtaining mouse DNA by alkaline boiling method: The steps are the same as those in step 1 (1) for obtaining mouse DNA by alkaline boiling method.

[0076] (2) PCR amplification:

[0077] PCR amplification of mouse DNA sample solutions was performed using Kras gene mutant primers, Kras gene wild-type primers, and Trp53 gene primers, respectively, to obtain mouse DNA sample solutions after PCR amplification.

[0078] In PCR amplification, except for the difference between the forward and reverse primers, the PCR amplification system and PCR amplification procedure are the same as the PCR amplification step (2) in step 1.

[0079] The sequence of the forward primer for the Kras gene mutant band is shown in SEQ ID NO.5 (5'-3'): AGCAGGCAGAAGTCACAGAGG, and the sequence of the reverse primer is shown in SEQ ID NO.6 (5'-3'): GGGGTGGGGTGGGATTAGA;

[0080] The sequence of the forward primer for the wild-type band of the Kras gene is shown in SEQ ID NO.7 (5'-3'): CTTCGGCTTCCTATTTTGTTGC, and the sequence of the reverse primer is shown in SEQ ID NO.8 (5'-3'): AAGTGGACTTTCTTTCTCTGTGGTG;

[0081] The sequence of the forward primer for the Trp53 gene is shown in SEQ ID NO.9 (5'-3'): GAGGGCGTCCAATGGTGCTT, and the sequence of the reverse primer is shown in SEQ ID NO.10 (5'-3'): CTAGGCTGGAGTCAACTGTC;

[0082] (3) DNA electrophoresis:

[0083] The mouse DNA sample solutions amplified by PCR using Kras gene mutant primers and Kras gene wild-type primers were subjected to electrophoresis. The remaining steps were the same as the DNA electrophoresis steps in step 1 (3).

[0084] Expected results: 870bp for wild-type Kras genotype mice and 830bp for mutant mice;

[0085] Since homozygous mutations in the Kras gene are lethal in mice, mice with positive mutant bands, identified using the PCR genotype identification method described above, can be screened as Kras mice. LSL-G12D Genotype heterozygous mice.

[0086] (4) Nucleic acid sequencing:

[0087] The mouse DNA sample solution amplified by PCR using the above-mentioned Trp53 gene primers was identified by nucleic acid sequencing. The sequence of the sequencing primers is shown in SEQ ID NO.9 (5'-3'): GAGGGCGTCCAATGGTGCTT.

[0088] Search for GAGAC in the sequencing file and determine whether there is a point mutation based on the specific sequence of the 14 base pairs after GAGAC. Among them, 5'-GAGACACTGCCCCC-3' (heterozygous) and 5'-GAGACACTGCCCGC-3' (homozygous).

[0089] Filter out Trp53 R172H Homozygous positive mice, combined with Kras mice screened in step (3) LSL-G12D Genotype heterozygous mice, i.e., F0 generation Kras LSL-G12D / + and Trp53 R172H+ / + Genotype mice.

[0090] Step 3: Construction of KPCDK mice:

[0091] Take one F0 generation genotype obtained in step 2 and name it Kras. LSL-G12D / + and Trp53 R172H+ / + Male mice, along with multiple F0 generation mice obtained in step 1, had the genotype Cdkn2a-CreER2. + / +KPCDK(Kras) was obtained by crossing homozygous positive female mice. LSL -G12D / + Trp53 R172H / + ;Cdkn2a-CreER2 / + The mice were used as the F1 generation, and the identification method was the same as the PCR genotype identification method in step 1 and the PCR genotype identification and nucleic acid sequencing identification method in step 2.

[0092] It should be noted that the genotype Kras in step 2 is used. LSL-G12D / + and Trp53 R172H+ / + Male mice with the genotype Cdkn2a-CreER2 in step 1 + / + Hybridization with homozygous positive female mice aims to increase the probability of obtaining KPCDK mice, thereby reducing costs. In other embodiments, the KP mice obtained in step 2 can also be directly crossed with multiple Cdkn2a-CreER2 mice obtained in step 1. / + KPCDK(Kras) mice were obtained by direct hybridization of heterozygous female mice and genotyping. LSL-G12D / + Trp53 R172H / + ;Cdkn2a-CreER2 / + Mice.

[0093] Step 4: Experiment on pancreatic tumor formation induced by tamoxifen and tamoxifen:

[0094] Take the KPCDK mice obtained in step 3 and conduct experiments uniformly when the KPCDK mice are 6-8 weeks old. On the first day of experimental model construction, use tamoxifen to construct an acute pancreatitis senescence injury model. The induction dose is 80 μg / kg. Each KPCDK mouse (weighing about 25g) is injected intraperitoneally 7 times a day with 200 μL of 10 μg / mL tamoxifen solution each time, with an interval of 1 hour. Then, from the second to the eighth day, tamoxifen is used to induce CreER2 recombinase expression. The induction dose is 80 mg / kg. Each KPCDK mouse is injected intraperitoneally once a day with 100 μL of 20 mg / mL tamoxifen solution. This results in mice that induce the senescence phenotype of pancreatic tissue, i.e., the KPCDK mouse model of pancreatic cancer originating from inflammatory senescent cells.

[0095] The above-mentioned tamoxifen solution is a tamoxifen solution with a concentration of 10 μg / mL formed by dissolving tamoxifen in physiological saline, and the tamoxifen solution is a tamoxifen solution with a concentration of 20 mg / mL formed by dissolving tamoxifen in corn oil.

[0096] The above-mentioned Caerulein (catalog number: HY-A0190, MedChemExpress, purity: 99.97%) was used to induce a pancreatitis model. Its structural formula is as follows:

[0097]

[0098] The aforementioned tamoxifen (catalog number: T5648, Sigma-Aldrich, purity >99%) was used to induce gene recombination in the CreER2 system in mice. Its structural formula is as follows:

[0099]

[0100] It is important to note that the common model of "administering tamoxifen solution (10 μg / mL, 200 μL each time) 8 times a day, one hour apart, intraperitoneal injection for two consecutive days" is not recommended. When tamoxifen solution is injected into the pancreatic cancer model to induce pancreatic cancer, the survival time of KPCDK mice is too short, which is insufficient to wait for tumor formation in KPCDK mice.

[0101] The specific experimental procedure is as follows: Figure 1 As shown in the left image, the Trp53 gene in KPCDK mice contains a dominant repressive point mutation (Trp53). R172H The Kras gene contains a conditional activation point mutation (Kras). LSL-G12D The Kras mutant gene contains a Lox-longStop-Lox termination sequence upstream, which is not expressed in the absence of CreER2 recombinase. Intraperitoneal injection of tamoxifen into KPCDK mice induces pancreatic senescence, leading to the specific expression of the Cdkn2a gene and its downstream gene, CreERT2, in senescent pancreatic cells. Simultaneously, under the influence of tamoxifen, the CreERT2 recombinase specifically enters the nucleus and expresses Kras... LSL-G12D / + Lox-longStop-Lox knockout in Krax makes Krax... G12D Gene mutations are expressed, leading to the formation of an inflammation-induced senescent cell-derived pancreatic cancer KPCDK mouse model.

[0102] In the KPCDK mouse model of pancreatic cancer originating from inflammation-induced senescent cells, while pancreatitis induced by taurine was expressed with the expression of the senescence gene Cdkn2a, its downstream Luciferase (luciferase gene, which interacts with D-luciferin potassium salt and releases energy in the form of reddish light at a visible wavelength of about 560 nm, which is visible as a light signal in a live imaging device), tdTomato (red fluorescence), and CreERT2 recombinase were expressed in the same cell.

[0103] In this embodiment, day 1 was designated as the induction of luciferase, and day 0 was the period before induction. Two KPCDK mouse models were used in the experimental group, and one wild-type mouse was used in the control group (without Luciferase gene expression, and did not emit light in in vivo imaging). In vivo imaging of the mice in the left lateral decubitus position was performed on days 0, 2, 5, and 8, and statistical analysis of Luciferase expression levels was conducted. Figure 2 As shown, the results indicated that the pancreas region of mice injected with luciferase (days 2, 5, and 8) showed obvious light signals in in vivo imaging, and the luminescence intensity of the pancreas region was higher than that on day 0, indicating the expression of luciferase. Furthermore, since luciferase is downstream of the aging gene Cdkn2a, it indicates that the aging gene Cdkn2a is expressed in the pancreas, suggesting that luciferase induces pancreatic aging.

[0104] Since senescence-associated β-galactosidase (SA-β-Gal) is activated and highly expressed only in senescent cells, and SA-β-Gal catalyzes the hydrolysis of X-Gal to produce a blue product, it can be used to locate senescent cells. Pancreatic tissue samples were cultured for 3 days after treatment with tamoxifen and tamoxifen via intraperitoneal injection for SA-β-Gal senescence staining experiments (Cellular Senescence β-Galactosidase Staining Kit, Catalog No.: C0602, Shanghai Beyotime Biotechnology Co., Ltd.). The specific steps included: Fresh pancreatic tissue was extracted from the KPCDK mouse model and washed with physiological saline. The surface moisture was dried with paper towels and cotton balls. The pancreatic tissue was placed in an embedding cassette, OCT embedding reagent was added, and the cassette and the tissue were rapidly frozen in liquid nitrogen. The embedded tissue was cut into 20 μm thick slices using a cryostat and mounted on glass slides. The slides were fixed with the fixative solution provided in the Cellular Senescence β-Galactosidase Staining Kit for 15 min. The staining working solution was prepared according to the instructions, and 200 μL of the staining working solution was added to each slide. The slides were incubated overnight at 37°C and observed under a regular optical microscope. The results are as follows: Figure 3 As shown in b(400×). The results indicate that β-galactosidase (blue staining) was expressed in the pancreatic tissue of the KPCDK mouse model of pancreatic cancer originating from inflammatory-induced senescent cells on the third day after intraperitoneal injection of daphnetin, and Figure 3 Compared to the senescence staining before a(200×) saturation induction, 3b showed more blue-stained cells, indicating that saturation induction can induce pancreatic senescence compared to no saturation induction.

[0105] Example 2

[0106] Fifteen additional KPCDK mice were constructed using the method described in Example 1. After PCR identification confirmed that the genotypes were accurate, they were routinely fed in an SPF-grade animal facility and observed weekly after drug injection to establish the model.

[0107] When the KPCDK mouse model exhibits symptoms such as emaciation, lethargy, decreased activity, or has a significant tumor (≥1.5cm), 3 During the exploratory laparotomy, aseptic surgery was performed to examine the pancreatic tissue and determine the presence of a pancreatic tumor. Mice with pancreatic tumors were euthanized, and the tumor tissue was removed and photographed. Figure 4 As shown.

[0108] The KPCDK mouse model derived from inflammation-induced senescent cells constructed in this invention can spontaneously and rapidly form pancreatic tumors (tumor formation can occur within 2 months). After tumor formation in the KPCDK mouse model derived from inflammation-induced senescent cells, SA-β-Gal senescence staining was found in frozen sections of pancreatic tumor tissue samples (e.g.,...). Figure 5 (400×), proving that there are senescent cells in pancreatic tumor tissue.

[0109] The pancreatic tumor tissue was preserved in 4% paraformaldehyde, then embedded in paraffin and sectioned for HE staining or immunohistochemical experiments. An example image of HE staining of pancreatic tumor tissue is shown below. Figure 6 As shown, where, Figure 6 a is 100×, Figure 6 b is 400×; Example image of CD68 staining in pancreatic tumor tissue is shown below. Figure 7 As shown, 200×; Figure 8 HE staining image of pancreas from a normal wild-type mouse, 200×;

[0110] The CD68 staining of the aforementioned pancreatic tumor tissue was commissioned to Shanghai Ruiyu Biotechnology Co., Ltd., and the CD68(E3O7V)Rabbit mAb, catalog number: 97778, was manufactured by Cell Signaling Technology.

[0111] like Figure 6-8 Analysis shows that the pancreatic tumors formed by the KPCDK mouse model of inflammation-induced senescent cell origin constructed in this invention are pathologically classified as poorly differentiated pancreatic cancer with osteoclast giant cells. This can represent poorly differentiated pancreatic cancer patients encountered in clinical practice. Poorly differentiated pancreatic cancer is a type of pancreatic cancer with high malignancy, large differences between tumor cells and normal pancreatic cells, rapid growth, and poor prognosis. This is consistent with the pathological characteristics of this KPCDK mouse model. Therefore, this model has certain clinical representativeness and is suitable for laboratory research.

[0112] Meanwhile, in the same batch of KPCDK mouse models derived from inflammatory-induced senescent cells, benign / malignant tumors of non-pancreatic origin, such as lipomas (benign), also appeared. Figure 9 ,200×), rhabdomyosarcoma (malignant) (such as Figure 10 ,200×), liver cancer (malignant) (such as Figure 11,200×), liposarcoma (malignant) (such as Figure 12 The results (e.g., 200×) indicate that acute pancreatitis is not limited to local inflammation of the pancreas but often triggers systemic inflammatory response syndrome (SIRS), leading to secondary damage to multiple organs and cellular senescence. This phenomenon suggests that the KPCDK mouse model can not only be used for pancreatic cancer research but also has the ability to simulate the occurrence of various benign and malignant solid tumors. This characteristic provides possibilities for expanding applications in studying the mechanisms of development and progression of various benign / malignant tumors, screening therapeutic drugs, and evaluating related treatment strategies, further enhancing the scientific research value and clinical translational potential of this animal model.

[0113] Comparative Example 1

[0114] A method for constructing a mouse model of pancreatic cancer includes the following steps:

[0115] Step 1: Construction of Pdx1-Cre positive mice:

[0116] B6.FVB-Tg(Pdx1-cre)6Tuv / J mice were crossed with C57BL / 6JGpt-wt / wt mice to obtain Pdx1-Cre mice. / + Heterozygous mice; then Pdx1-Cre expression was used. / + Gene-modified mice and mice expressing Pdx1-Cre / + Genetically modified mice were crossed to obtain Pdx1-Cre positive mice; Pdx1-Cre positive mice were used as F0 generation mice, and the genotypes of F0 generation mice were identified by PCR.

[0117] The B6.FVB-Tg(Pdx1-cre)6Tuv / J mouse strain expressing the Pdx1-Cre gene described above was obtained from the Jackson Laboratory, catalog number 014647.

[0118] The above-mentioned PCR method for genotyping includes the following steps:

[0119] (1) Obtaining mouse DNA by alkaline boiling method: The same as the step (1) in Example 1 for obtaining mouse DNA by alkaline boiling method;

[0120] (2) PCR amplification:

[0121] The PCR amplification system is shown in Table 2 below:

[0122] Table 2 PCR amplification system

[0123] Element volume 2×EasyTaq PCR premix 10μL Primer 1 (10mM) 0.5μL Primer 2 (10mM) 0.5μL Primer 3 (10mM) 0.5μL Primer 4 (10mM) 0.5μL mouse DNA sample solution 2μL <![CDATA[ddH2O]]> Make up to 20 μL

[0124] The sequence of primer 1 above is shown in SEQ ID NO.11 (5'-3'): CTGTCCCTGTATGCCTCTGG;

[0125] The sequence of primer 2 is shown in SEQ ID NO.12 (5'-3'): AGATGGAGAAAGGACTAGGCTACA;

[0126] The sequence of primer 3 is shown in SEQ ID NO.13 (5'-3'): CCTGGACTACATCTTGAGTTGC;

[0127] The sequence of primer 4 is shown in SEQ ID NO.14 (5'-3'): AGGCAAATTTTGGTGTACGG;

[0128] The PCR amplification program was as follows: 94℃ pre-denaturation for 10 min; 94℃ denaturation for 20 s, 65℃ annealing for 30 s, decreasing by 0.5℃ per cycle, extension at 72℃ for 1 min, for 10 cycles; 94℃ denaturation for 20 s, 60℃ annealing for 30 s, decreasing by 0.5℃ per cycle, extension at 72℃ for 1 min, for 25 cycles; hold at 72℃ for 5 min to obtain the PCR-amplified mouse DNA sample solution, which was then stored at 4℃ for later detection.

[0129] (3) DNA electrophoresis:

[0130] The DNA electrophoresis step is the same as step 1(3) in Example 1;

[0131] The expected result is: a 650bp band of the Pdx1-Cre genotype mutant.

[0132] Based on the PCR method for genotyping described above, mice with positive mutant bands were screened out, which are F0 generation Pdx1-Cre positive mice.

[0133] Step 2, pancreas-specific mutation Kras LSL-G12D and Trp53 R172H Mouse construction:

[0134] Compared with the pancreas-specific mutation Kras in step 2 of Example 1 LSL-G12D Trp53 R172H The construction steps for mice are the same.

[0135] Step 3: Construction of the KPC mouse model:

[0136] Take one F0 generation Kras obtained in step 2 LSL-G12D / + and Trp53 R172H+ / +Genotype-positive male mice were crossed with multiple F0 generation B6.FVB-Tg(Pdx1-cre)6Tuv / J positive mice obtained in step 1 to obtain KPC(Kras) mice. LSL-G12D / + Trp53 R172H / + ;Pdx1-Cre / + The mice were used as the F1 generation, and the identification method was the same as the PCR genotype identification method in step 1 and the PCR genotype identification and sequencing identification method in step 2, thus obtaining the KPC mouse model.

[0137] The KPC mouse model was routinely housed in an SPF-grade animal facility. Mice were observed weekly for the first 8 weeks of age, and every two days thereafter. The KPC mouse model was indicated by symptoms such as emaciation, lethargy, decreased activity, or the presence of a significant tumor (≥1.5 cm). 3 During the exploratory laparotomy, aseptic surgery was performed to examine the pancreatic tissue and determine the presence of a spontaneous pancreatic tumor. If a spontaneous pancreatic tumor was found, the mouse was euthanized, and the pancreatic tumor tissue was removed for gross imaging. Figure 13 As shown, it was stored in 4% paraformaldehyde, and subsequently embedded in paraffin and sectioned for HE staining or immunohistochemical experiments. The results are as follows. Figure 14 As shown (400×).

[0138] Depend on Figure 13-14 It is known that the pancreatic cancer model constructed by the KPC mouse model is a pancreatic ductal adenocarcinoma model, which takes about 4 months to spontaneously form tumors during the actual induction process. However, the KPCDK mouse model constructed in this invention can spontaneously and rapidly form pancreatic tumors (2 months), and the induced pancreatic cancer is poorly differentiated pancreatic cancer, which is different from the pancreatic cancer type induced by the KPC mouse model, thus supplementing the mouse pancreatic cancer research model.

[0139] In summary, the method for constructing the KPCDK mouse model of inflammation-induced senescent cell origin provided in this application induces pancreatitis through viviparin, leading to pancreatic inflammatory senescence. This causes cells in the pancreas that simultaneously express the Cdkn2a senescence gene and the Kras and Trp53 mutant genes to transform into cancer cells, thereby constructing a mouse model capable of spontaneously and rapidly forming pancreatic cancer. This animal model is an ideal tool for in-depth research on pancreatic precancerous lesions and pancreatic cancer. Through the synergistic effect of viviparin and tamoxifen, the experimental cycle of spontaneous tumorigenesis can be shortened, experimental efficiency improved, and experimental costs saved, thus providing a better foundation for research on the tumorigenesis mechanism of pancreatic cancer and inflammation-induced senescence, as well as for drug development.

[0140] The above are merely preferred embodiments of the present invention and are not intended to limit the implementation methods and protection scope of the present invention. Those skilled in the art should recognize that any equivalent substitutions and obvious changes made based on the content and illustrations of this specification should be included within the protection scope of the present invention.

Claims

1. A method for constructing an inflammation-induced senescent cell-derived KPCDK mouse model, characterized in that, The steps include: mixing mice expressing the Cdkn2a-CreER2 gene with Kras... LSL-G12D and Trp53 R172H Mice with the same gene mutation were crossbred to obtain KPCDK mice, the genotype of which is Kras. LSL-G12D / + Trp53 R172H / + and Cdkn2a-CreER2 / + The KPCDK mouse model was obtained by injecting tamoxifen and tamoxifen into the mice.

2. The method for constructing an inflammation-induced senescent cell-derived KPCDK mouse model as described in claim 1, characterized in that, The method for constructing mice expressing the Cdkn2a-CreER2 gene includes: crossing C57BL / 6-Cdkn2a-CreERT2 gene mice with wild-type C57BL / 6 mice to obtain positive mice expressing the Cdkn2a-CreER2 gene.

3. The method for constructing an inflammation-induced senescent cell-derived KPCDK mouse model as described in claim 1, characterized in that, The Kras LSL-G12D and Trp53 R172H The method for constructing mice with all gene mutations includes: using C57BL / 6-Kras... LSL-G12D Mice and C57BL / 6-Trp53 R172H Mouse hybridization to obtain Kras LSL-G12D and Trp53 R172H Positive mice with all gene mutations.

4. The method for constructing an inflammation-induced senescent cell-derived KPCDK mouse model as described in claim 1, characterized in that, When inducing KPCDK mice through injection, the KPCDK mice were 6-8 weeks old. On day 1, they were injected with tamoxifen solution at an induction dose of 80 μg / kg / time, 7 times, with an interval of 1 hour between each injection. From day 2 to day 8, they were injected with tamoxifen solution at an induction dose of 80 mg / kg / time, once a day. The injections were administered via intraperitoneal injection.

5. A KPCDK mouse model of inflammation-induced senescent cell origin, characterized in that, The KPCDK mouse model is constructed using the method described in any one of claims 1-4 for constructing an inflammation-induced senescent cell-derived KPCDK mouse model.

6. The application of the KPCDK mouse model of inflammation-induced senescent cell origin as described in claim 5 in studying the mechanisms of Kras, Trp53 or Cdkn2a gene mutations in tumorigenesis and development, screening of tumor therapeutic drugs and evaluation of treatment strategies.

7. The application of the KPCDK mouse model of inflammation-induced senescent cell origin as described in claim 6 in studying the mechanisms of Kras, Trp53, or Cdkn2a gene mutations in tumorigenesis and development, screening of tumor therapeutic drugs, and evaluation of treatment strategies, characterized in that... The tumors include both benign and malignant tumors.

8. The application of the KPCDK mouse model of inflammation-induced senescent cell origin as described in claim 7 in studying the mechanisms of Kras, Trp53, or Cdkn2a gene mutations in tumorigenesis and development, screening of tumor therapeutic drugs, and evaluation of treatment strategies, characterized in that... The malignant tumors include pancreatic cancer, liposarcoma, liver cancer, and rhabdomyosarcoma, while the benign tumors include lipomas.

9. The application of the KPCDK mouse model of inflammation-induced senescent cell origin as described in claim 5 in studying the mechanism of pancreatic cancer, treatment methods, screening drugs for treating pancreatic cancer, evaluating the therapeutic effects of candidate antitumor drugs, cell therapy, and gene therapy strategies in vivo.

10. The application of the KPCDK mouse model of inflammation-induced senescent cell origin as described in claim 9 in studying pancreatic cancer treatment methods, screening drugs for treating pancreatic cancer, evaluating the therapeutic effects of candidate antitumor drugs, cell therapy, and gene therapy strategies in vivo, characterized in that... The pancreatic cancer mentioned is poorly differentiated pancreatic cancer.

11. The application of the KPCDK mouse model of inflammation-induced senescent cell origin as described in claim 5 in the study of pancreatitis-induced systemic inflammatory response and its effects on distant organs.

12. The application of the KPCDK mouse model of inflammation-induced senescent cell origin as described in claim 11 in the study of pancreatitis-induced systemic inflammatory response and its effects on distant organs, characterized in that... The applications include: research on systemic inflammation associated with senescent cells, drug screening, or the development of treatment strategies; wherein the systemic inflammation associated with senescent cells includes, but is not limited to, systemic inflammation induced by pancreatitis; the research includes research on the mechanisms of distant organ damage caused by systemic inflammation; the drug screening includes screening candidate drugs targeting senescent cells or systemic inflammation; and the treatment strategy development includes the design of intervention programs for inflammation-related diseases.

13. The application of the KPCDK mouse model of inflammation-induced senescent cell origin as described in claim 12 in the study of pancreatitis-induced systemic inflammatory response and its effects on distant organs, characterized in that... The remote organs include the lungs, liver, kidneys, heart, brain, fat, or muscle.

14. The application of the KPCDK mouse model of inflammation-induced senescent cell origin as described in claim 12 in the study of pancreatitis-induced systemic inflammatory response and its effects on distant organs, characterized in that... The drug screening includes evaluating the effects of candidate drugs on the clearance of senescent cells, inhibition of inflammatory factors, or protection of distant organs.

15. The application of the KPCDK mouse model of inflammation-induced senescent cell origin as described in claim 12 in the study of pancreatitis-induced systemic inflammatory response and its effects on distant organs, characterized in that... The development of treatment strategies includes targeted interventions against senescent cells, anti-inflammatory interventions, or multi-organ protection strategies.