A multiplex fluorescent genotyping detection primer probe set and kit for norovirus epidemic strains

By designing a multiplex fluorescent genotyping primer and probe set and fluorescent PCR technology, the problems of time-consuming and labor-intensive norovirus detection and low viral load detection were solved, realizing rapid and sensitive norovirus genotyping and supporting efficient source tracing of environmental samples.

CN121380458BActive Publication Date: 2026-05-01JIANGSU PROVINCIAL CENTER FOR DISEASE CONTROL AND PREVENTION (PUBLIC HEALTH RESEARCH INSTITUTE OF JIANGSU PROVINCE)
View PDF 2 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
JIANGSU PROVINCIAL CENTER FOR DISEASE CONTROL AND PREVENTION (PUBLIC HEALTH RESEARCH INSTITUTE OF JIANGSU PROVINCE)
Filing Date
2025-12-24
Publication Date
2026-05-01

AI Technical Summary

Technical Problem

Existing norovirus testing methods are time-consuming and labor-intensive, and it is difficult to effectively genotype samples with low viral loads, making it difficult to trace the source of norovirus outbreaks and to formulate timely prevention and control measures.

Method used

A set of primers and probes for multiplex fluorescent genotyping detection of norovirus strains was designed. Combined with multiplex fluorescent detection reagents, the simultaneous detection of GII.17, GII.3 and GII.4 types was achieved through fluorescent PCR technology. Specific fluorescent probes and MGB quenching groups were used to improve the sensitivity and specificity of the detection.

Benefits of technology

It enables rapid, simple, and sensitive norovirus genotyping detection, reducing the overall time to 1.5 hours, with 100% sensitivity and specificity. It is suitable for environmental specimen detection with low viral load and supports rapid source tracing and prevention.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121380458B_ABST
    Figure CN121380458B_ABST
Patent Text Reader

Abstract

This invention relates to a primer and probe set and kit for multiplex fluorescent genotyping detection of norovirus strains, belonging to the field of biotechnology. The primer and probe set of this invention includes primer pairs and probes for detecting norovirus types GII.17, GII.3, and GII.4; wherein the nucleotide sequences of the primer pairs and probes for detecting GII.17 are shown in SEQ ID NO: 1-3; the nucleotide sequences of the primer pairs and probes for detecting GII.3 are shown in SEQ ID NO: 4-6; and the nucleotide sequences of the primer pairs and probes for detecting GII.4 are shown in SEQ ID NO: 7-9. This invention has the following technical advantages: 1. Short detection time and simple operation, with a total detection time of approximately 1.5 hours. 2. High sensitivity. 3. Low detection limit, applicable to environmental sample detection.
Need to check novelty before this filing date? Find Prior Art

Description

A primer and probe set and kit for detecting multiplex fluorescent genotyping of norovirus strains Technical Field

[0001] This invention relates to a primer and probe set and kit for multiplex fluorescent genotyping detection of norovirus strains, belonging to the field of biotechnology. Background Technology

[0002] Norovirus has 10 genotypes (GI-GX), among which the GII genotype is the main genotype causing norovirus acute gastroenteritis infection in humans. Based on the viral polymerase (RdRp) gene sequence and capsid protein (VP1) gene sequence, the GII genotype can be further divided into 37 P types and 26 VP1 genotypes. In the past decade, the main prevalent types have been GII.4[P16], GII.4[P31], GII.17[P17], GII.3[P12], GII.2[P16], and GII.6[P7]. The three dominant genotypes, GII.17[P17], GII.4[P16], and GII.3[P12], account for nearly 90% of both outbreak and sporadic norovirus surveillance, indicating a severe disease burden.

[0003] Currently, norovirus detection first involves identifying the genome using real-time fluorescent RT-PCR, followed by conventional RT-PCR amplification and sequencing using genotyping primers. The sequencing products are then subjected to first-generation or second-generation sequencing, and finally, the obtained sequences are used for genotyping using online alignment tools. The entire process takes approximately two days, which is time-consuming and labor-intensive. Norovirus outbreaks often involve anal swab samples and environmental samples with low viral loads, making it difficult to perform genotyping using conventional RT-PCR amplification and sequencing. This increases the difficulty of tracing the source of norovirus, hinders the timely and effective development of control measures, and ultimately leads to the expansion of norovirus outbreaks.

[0004] Therefore, there is a need for a detection technology that can detect quickly and with high sensitivity. Summary of the Invention

[0005] The purpose of this invention is to overcome the shortcomings of the prior art and provide a primer and probe set and kit for multiplex fluorescent genotyping detection of norovirus strains.

[0006] The inventors of this invention have designed a primer and probe set and kit for multiplex fluorescent genotyping detection of norovirus strains, which can detect the capsid protein VP1 gene (i.e., GII.17, GII.3, and GII.4) of three dominant circulating strain genotypes GII.17[P17], GII.4[P16], and GII.3[P12]. The primers and probes for these three genotypes were all designed by the inventors. The GII.17-F primer is located at nucleotides 277-300 of the VP1 gene, the GII.17-R primer is located at nucleotides 435-459 of the VP1 gene, and the GII.17-Probe primer is located at nucleotides 321-345 of the VP1 gene. The GII.3-F primer is located at nucleotides 53-74 of the VP1 gene, the GII.3-R primer is located at nucleotides 290-311 of the VP1 gene, and the GII.3-Probe primer is located at nucleotides 170-190 of the VP1 gene. The GII.4-F primer is located at nucleotides 59-80 of the VP1 gene, the GII.4-R primer is located at nucleotides 211-232 of the VP1 gene, and the GII.4-Probe primer is located at nucleotides 113-134 of the VP1 gene.

[0007] In this invention, a primer and probe set for multiplex fluorescent genotyping detection of circulating norovirus strains includes primer pairs and probes for detecting norovirus types GII.17, GII.3, and GII.4. The specific sequences of each primer and probe are as follows:

[0008] GII.17-F is the upstream primer of GII.17, and its nucleotide sequence is shown in SEQ ID NO: 1; the specific nucleotide sequence is TCAAGGATGTACAATGGGTATGCT.

[0009] GII.17-R is the downstream primer of GII.17, and its nucleotide sequence is shown in SEQ ID NO: 2; the specific nucleotide sequence is TGGYTCAAGAGTCCTRACATCTACT.

[0010] GII.17-Probe, also known as GII.17 probe, has the nucleotide sequence shown in SEQ ID NO: 3; the specific nucleotide sequence is TCTCCTGGCAGGGAACGCGTTCACT.

[0011] GII.3-F is the upstream primer of GII.3, and its nucleotide sequence is shown in SEQ ID NO: 4; the specific nucleotide sequence is TCGTCCCAGAGATCAACARTGA;

[0012] GII.3-R is the downstream primer of GII.3, and its nucleotide sequence is shown in SEQ ID NO: 5; the specific nucleotide sequence is TCAAAYCCACCTGCATAACCAT.

[0013] GII.3-Probe, also known as GII.3 probe, has the nucleotide sequence shown in SEQ ID NO: 6; the specific nucleotide sequence is ACTCACCACCAGGTGCTTGCA.

[0014] GII.4-F is the upstream primer of GII.4, and its nucleotide sequence is shown in SEQ ID NO: 7; the specific nucleotide sequence is CAGAGGTCAACAATGAGGTTAT.

[0015] GII.4-R is the downstream primer of GII.4, and its nucleotide sequence is shown in SEQ ID NO: 8; the specific nucleotide sequence is CTCCATAGTATTTCACCTGGA.

[0016] GII.4-Probe, also known as GII.4 probe, has the nucleotide sequence shown in SEQ ID NO: 9; the specific nucleotide sequence is TGTTGGCCCGCTACAGGTGC.

[0017] The fluorescent probe is an oligonucleotide probe, with a fluorescent group attached to the 5' end and a quencher group attached to the 3' end. The fluorescent group for detecting GII.17 is FAM, and the quencher group is MGB. The fluorescent group for detecting GII.3 is VIC, and the quencher group is MGB. The fluorescent group for detecting GII.4 is CY5, and the quencher group is MGB.

[0018] The present invention also provides a multiplex fluorescent genotyping detection kit for circulating norovirus strains, which includes the above-mentioned multiplex fluorescent genotyping detection primer and probe set for circulating norovirus strains.

[0019] Furthermore, the kit also includes a multiplex fluorescence detection reagent, which can be a commercially available multiplex fluorescence detection reagent, such as the HiScript II U+ One Step qRT-PCRProbe Kit produced by Nanjing Novizan.

[0020] The present invention also provides a method for preparing the primer-probe set working solution, comprising the following steps:

[0021] 1) Prepare a working concentration of 10 μmol / L by adding RNase-free water to the synthetic dry powder of each primer and probe.

[0022] 2) Each primer and probe used to detect GII.17, GII.3 and GII.4 is prepared into three probe-primer mixtures according to the volume ratio of upstream primer: downstream primer: probe of 2:2:1; in this invention, the volume ratio of upstream primer: downstream primer: probe is 400:400:200 (μL).

[0023] 3) Finally, the three probe primer mixtures are mixed in equal volumes to prepare the primer probe working solution.

[0024] During testing, the general multiplex fluorescent detection reagents, combined with the primer and probe working solution of this invention, can be used for instrumental detection and can simultaneously identify GII.17, GII.3 and GII.4 epidemic strains.

[0025] The inventive concept of this invention is as follows: PCR primers and fluorescent TaqMan probes are designed targeting the conserved gene sequences of three prevalent variants of norovirus. A nucleotide probe with fluorescent dye groups labeled at both ends is added to conventional PCR, with the fluorescent group at the 5' end and the quencher group at the 3' end, forming an energy transfer structure. When the probe is intact, the fluorescent group is inhibited by the quencher group and does not produce fluorescence. When the probe binds to the target sequence, the upstream primer extends to that position, and the probe is hydrolyzed by an exonuclease, releasing the fluorescent signal, which is collected and detected by the instrument, thus indicating the presence of the target sequence. The detection genes of the three prevalent strains form a combination, utilizing the real-time nature, high sensitivity, and good specificity of fluorescent PCR technology, allowing for a direct and rapid identification of GII.17, GII.3, and GII.4 infections even before or at the end of the reaction. Furthermore, the quencher group for all three gene probes is MGB, rather than a TAMRA-type quencher. The MGB quencher system, with its unique small groove binding capability, allows for the use of shorter, more specific probes. Combined with non-fluorescent quenching technology, it significantly outperforms traditional TAMRA quenchers in terms of specificity, sensitivity, and signal-to-noise ratio.

[0026] The multiplex fluorescent genotyping primer and probe set and kit for detecting prevalent norovirus strains of the present invention have the following technical advantages:

[0027] 1. Short testing time and simple operation

[0028] Current norovirus detection methods first involve real-time fluorescent RT-PCR for genogroup identification (approximately 1.5-2 hours), followed by conventional RT-PCR amplification and sequencing using genotyping primers (approximately 2-5 hours). The sequencing products are then subjected to first-generation sequencing (approximately 10 hours) or second-generation sequencing (approximately 20 hours). Finally, the sequenced sequences are genotyped using an online alignment tool (approximately 1 hour). The entire process takes about two days, which is time-consuming and labor-intensive. This invention requires simpler experimental procedures. General reagents combined with the primer and probe working solution of this invention are sufficient for detection, and it can simultaneously identify GII.17, GII.3, and GII.4 circulating strains. The overall detection time is approximately 1.5 hours. The results are also readily apparent, requiring only attention to the cycle number (Ct value) of the three channels. The simple operating procedure and standard fluorescent detection equipment make it suitable even for grassroots units.

[0029] 2. High sensitivity, good specificity, strong repeatability, and no cross-reactivity between types.

[0030] This invention is designed based on the VP1 region sequences of the three currently prevalent genotypes, which account for nearly 90% of all strains. Theoretically, it can detect all prevalent variants of the GII.17, GII.3, and GII.4 genotypes. In practical applications, the inventors tested all GII.17, GII.3, and GII.4 variants (including GII.17[P17], GII.4[P16], and GII.3[P12]), while using GII.2[P16], GII.6[P7], and GII.7[P7] variants as controls. The results showed that the sensitivity and specificity were both 100%. Monthly retesting of norovirus samples revealed complete consistency with the sequencing results, demonstrating excellent stability and reproducibility.

[0031] 3. It has a low detection limit and can be applied to environmental sample testing.

[0032] The most significant advantage of this invention lies in the detection of environmental samples. The large volume and low viral load of environmental samples pose considerable challenges to testing. Due to the low viral load, sequencing and genotyping of environmental samples are difficult. However, during norovirus outbreaks, areas with infected individuals are almost always contaminated with environmental pollutants. Without sequencing, it's impossible to obtain the genotype of norovirus variants, leading to difficulties in tracing the source. Using the method of this invention, specific circulating strains can be detected when testing environmental samples. The detection results are completely consistent with epidemiological tracing investigation results, with 100% sensitivity and specificity. This effectively assists in the rapid tracing and timely formulation of control strategies during norovirus outbreaks. Attached Figure Description

[0033] Figure 1 shows the results of nucleic acid testing after mixing from patients with norovirus GII.17[P17], GII.3[P12], and GII.4[P16] types.

[0034] Figure 2 shows the detection results of anal swab specimens and environmental specimens during the norovirus GII.17 [P17] outbreak.

[0035] Figure 3 shows the detection results of anal swab specimens and environmental specimens during the norovirus GII.4[P16] outbreak.

[0036] Figure 4 shows the nucleic acid detection results of norovirus GII.2[P16], GII.6[P7], and GII.7[P7].

[0037] Figure 5 shows the specificity verification results (influenza virus, enterovirus, rotavirus, and zarrovirus).

[0038] Figure 6 shows the combined comparison results of first-generation sequencing genotyping and fluorescence genotyping. Detailed Implementation

[0039] The following are specific embodiments of the present invention, which are described in conjunction with the accompanying drawings. However, the present invention is not limited to these embodiments.

[0040] Example 1

[0041] 1. Primer and probe design:

[0042] The inventors designed their own primers for detecting prevalent norovirus strains by downloading 1000 complete VP1 region gene sequences for each of three genotypes (GII.17, GII.3, and GII.4) and performing comparative analysis. Primers were designed using Oligo 7 software, resulting in 15 primer-probe pairs for GII.17, 12 for GII.3, and 10 for GII.4. Specificity comparison analysis of these primers and probes was performed using the NCBI BLAST online database. Primers with high PCR efficiency, high sensitivity, good specificity, and good stability were screened, ultimately yielding three sets of primer and probe sequences with the best quality control. Simultaneously, the quenching groups of the probes were changed from TAMRA-type to MGB, improving their specificity and accuracy. The nucleotide sequences of the obtained primer-probe sets are shown in Table 1.

[0043] Table 1 Primer and probe sequences for multiplex fluorescent detection of circulating norovirus strains

[0044] .

[0045] 2. Kit for multiplex fluorescent detection of circulating norovirus strains

[0046] The kit for multiplex fluorescence detection of circulating norovirus strains includes the above-mentioned primer and probe set and multiplex fluorescence detection reagent. The multiplex fluorescence detection reagent can be any commercially available multiplex fluorescence detection reagent. In this invention, the HiScript II U+ One Step qRT-PCR Probe Kit (purchased from Nanjing Novizan) is used.

[0047] The primer and probe kit is prepared as a primer and probe working solution. The preparation method is as follows:

[0048] 1) Prepare a working concentration of 10 μmol / L by adding RNase-free water to the synthetic dry powder of each primer and probe.

[0049] 2) The primers and probes used to detect GII.17, GII.3 and GII.4 are prepared into three probe-primer mixtures in a volume ratio of upstream primer: downstream primer: probe of 2:2:1. In this invention, the volumes of upstream primer: downstream primer: probe are 400 μL, 400 μL and 200 μL, respectively.

[0050] 3) Finally, the three mixtures are mixed in equal volumes to prepare the primer and probe working solution.

[0051] During testing, a general-purpose multiplex fluorescent detection reagent, along with the prepared primer and probe working solution, can be used for instrumental testing and can simultaneously identify GII.17, GII.3, and GII.4 epidemic strains.

[0052] 3. The testing process is as follows:

[0053] 3.1 System Configuration

[0054] The experimental system was prepared in the system preparation room. A commercially available multiplex fluorescence detection kit can be used; this invention uses the HiScript II U+ One Step qRT-PCR Probe Kit (purchased from Nanjing Novizan). The system preparation is shown in Table 2.

[0055] Table 2 PCR reaction system

[0056] .

[0057] After the system is prepared, shake to mix and centrifuge, then dispense into PCR reaction tubes at a rate of 10 μL / person.

[0058] 3.2 Sample Processing

[0059] In the sample loading chamber, add 2.5 μL each of the test sample nucleic acid, positive control, and negative control to the prepared PCR reaction tubes, bringing the final volume to 12.5 μL. Tightly cap the tubes and centrifuge with shaking. The samples are norovirus nucleic acids possessed by the inventor's laboratory, including three types: GII.17[P17], GII.4[P16], and GII.3[P12]. Other types include GII.2[P16], GII.6[P7], and GII.7[P7]. Additionally, it includes GII genogroup-positive but untyped nucleic acids from patient and environmental samples. It also includes nucleic acid samples from influenza virus, enterovirus, rotavirus, and zarrovirus used for specific detection. The positive control is successfully sequenced GII.17[P17] nucleic acid. The negative control is RNase-free water.

[0060] 3.3 PCR Amplification

[0061] The PCR reaction tubes were placed in an ABI QuantStudio Q5 real-time PCR instrument for amplification and detection, without selecting ROX correction. The fluorescent groups were FAM, VIC, and CY5. The cycling parameters are set as shown in Table 3.

[0062] Table 3 Reaction Procedure

[0063] .

[0064] 3.4. Results Analysis

[0065] The negative control showed no fluorescence curve, while the positive control showed three smooth curves. A specimen was considered positive if its fluorescence curve was smooth and the cycle number (Ct value) was less than 38; otherwise, it was negative. If only one of FAM and VIC had a Ct ≤ 38, a retest was required regardless of whether CY5 also had a Ct ≤ 38. Specific determination results are shown in Table 4.

[0066] Table 4 Result Judgment

[0067] .

[0068] (1) The results of nucleic acid mixing detection in patients with norovirus GII.17[P17], GII.3[P12] and GII.4[P16] types showed curves in the FAM, VIC and CY5 channels with Ct≤38, indicating infection with norovirus GII.17[P17], GII.3[P12] and GII.4[P16] types. The results are shown in Figure 1.

[0069] (2) Results of anal swab and environmental specimen tests in the GII.17[P17] outbreak: The presence of a curve in the FAM channel and Ct≤38 indicates GII.17[P17] infection. The results are shown in Figure 2.

[0070] (3) The results of anal swab specimens and environmental specimens in the GII.4[P16] outbreak showed curves in the CY5 channel and Ct≤38, indicating GII.4[P16] infection. The results are shown in Figure 3.

[0071] (4) The nucleic acid detection results of norovirus GII.2[P16], GII.6[P7] and GII.7[P7] types showed no curves in the FAM, VIC and CY5 channels, indicating that the primer combination of the present invention does not react with other types of norovirus nucleic acid. The results are shown in Figure 4.

[0072] (5) Specificity verification results (influenza virus, enterovirus, rotavirus and zarif virus): no curves were observed in the FAM, VIC and CY5 channels, indicating that the primer combination of the present invention does not react with other viral nucleic acids. The results are shown in Figure 5.

[0073] (6) Comparative results of sequencing-based genotyping and fluorescence-based genotyping. Eighty-two recent GII group fluorescently positive nucleic acids were selected for testing. In terms of the total number of genotypeable samples, the number of suspected samples, and the number of genotypeable samples of different types, the fluorescence-based genotyping results were higher than those of first-generation sequencing. The number of ungenerated samples was significantly lower than that of first-generation sequencing, indicating that the primer combination of this invention has excellent detection capabilities. Suspected samples in first-generation sequencing exhibited irregular peak shapes and high sequence base variability; in fluorescence-based genotyping, they showed Ct values ​​around 38 and a near-S-shaped amplification curve. The comprehensive comparison results are shown in Figure 6.

[0074] The above embodiments are only for illustrating the technical concept and features of the present invention, and are intended to enable those skilled in the art to understand the content of the present invention and implement it accordingly. They should not be construed as limiting the scope of protection of the present invention. All equivalent changes or modifications made in accordance with the spirit and essence of the present invention should be covered within the scope of protection of the present invention.

Claims

1. A primer and probe set for detecting multiplex fluorescent genotyping of norovirus strains, characterized in that, The primer and probe set includes primer pairs and probes for detecting norovirus types GII.17, GII.3, and GII.

4. The specific sequences of each primer and probe are as follows: GII.17-F, the upstream primer for GII.17, has the nucleotide sequence shown in SEQ ID NO: 1; the specific nucleotide sequence is TCAAGGATGTACAATGGGTATGCT; GII.17-R, the downstream primer for GII.17, has the nucleotide sequence shown in SEQ ID NO: 2; the specific nucleotide sequence is TGGYTCAAGAGTCCTRACATCTACT; GII.17-Probe, the probe for GII.17, has the nucleotide sequence shown in SEQ ID NO: 3; the specific nucleotide sequence is TCTCCGGCAGGGAACGCGTTCACT; GII.3-F, the upstream primer for GII.3, has the nucleotide sequence shown in SEQ ID NO: 4; the specific nucleotide sequence is TCGTCCCAGAGATCAACARTGA; GII.3-R, the downstream primer for GII.3, has the nucleotide sequence shown in SEQ ID NO:

4. SEQ ID NO: 5; the specific nucleotide sequence is TCAAAYCCACCTGCATAACCAT; GII.3-Probe, i.e., the GII.3 probe, has the nucleotide sequence shown in SEQ ID NO: 6; the specific nucleotide sequence is ACTCACCACCAGGTGCTTGCA; GII.4-F, i.e., the upstream primer of GII.4, has the nucleotide sequence shown in SEQ ID NO: 7; the specific nucleotide sequence is CAGAGGTCAACAATGAGGTTAT; GII.4-R, i.e., the downstream primer of GII.4, has the nucleotide sequence shown in SEQ ID NO: 8; the specific nucleotide sequence is CTCCATAGTATTTCACCTGGA; GII.4-Probe, i.e., the GII.4 ...8; the specific nucleotide sequence is CTCCATAGTATTTCACCTGGA; GII.4-Probe, i.e., the GII.4 probe, has the nucleotide sequence shown in SEQ ID NO: 8; the specific nucleotide sequence is CTCCATAGTATTTCACCTGGA; GII.4-Probe, i.e., the GII.4 probe, has the nucleotide sequence shown in SEQ ID NO: 8; the specific nucleotide sequence is CTCCATAGTATTTCACCTGGA; GII.4-Probe, i As shown in NO: 9; the specific nucleotide sequence is TTGTTGGCCCGCTACAGGTGC; the fluorescent probe is an oligonucleotide probe, with a fluorescent group attached to the 5' end and a quenching group attached to the 3' end; the probe for detecting GII.17 has a fluorescent group FAM attached to the 5' end and a quenching group MGB attached to the 3' end; the probe for detecting GII.3 has a fluorescent group VIC attached to the 5' end and a quenching group MGB attached to the 3' end; the probe for detecting GII.4 has a fluorescent group CY5 attached to the 5' end and a quenching group MGB attached to the 3' end.

2. A multiplex fluorescent genotyping kit for circulating norovirus strains, characterized in that, Includes the primer-probe set as described in claim 1.

3. The reagent kit according to claim 2, characterized in that, It also includes multiplex fluorescence detection reagents.

4. A method for preparing a primer-probe working solution comprising the primer-probe set as described in claim 1, characterized in that, The process includes the following steps: 1) Prepare a working concentration of 10 μmol / L by adding RNase-free water to the synthetic dry powder of each primer and probe; 2) Prepare three probe-primer mixtures for detecting GII.17, GII.3 and GII.4 primers and probes respectively according to the volume ratio of upstream primer: downstream primer: probe of 2:2:1; 3) Finally, mix the three probe-primer mixtures in equal volumes to prepare the primer-probe working solution.

Citation Information

Patent Citations

  • Methods for detecting norovirus

    CN110073005A

  • Norovirus GI, GII and GIV nucleic acid genotyping reagent kit and detection method

    CN110273027A