A primer composition and a multiplex PCR detection method for identifying or assisting in identifying zizyphus jujuba mill and its counterfeit

By employing multiple site-specific PCR technology and specific primer combinations, the problem of accurate identification of adulterants of jujube seed was solved, achieving efficient identification of jujube seed, Japanese raisin tree seed, and jujube seed, reducing the false positive rate, and simplifying the operation process.

CN116287360BActive Publication Date: 2026-05-08SHANXI UNIV OF CHINESE MEDICINE
View PDF 1 Cites 0 Cited by

Patent Information

Application Number
CN202210230855.8
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2022-03-09
Publication Date
2026-05-08
Estimated Expiration
2042-03-09

AI Technical Summary

Technical Problem

Existing technologies are insufficient to accurately identify jujube seed and its adulterants, especially Japanese raisin tree seed and jujube seed, and commonly used methods cannot determine the amount of adulteration, resulting in serious adulteration in the jujube seed medicinal material market.

Method used

Multiplex site-specific PCR technology was used to design specific primer combinations (SF1, SR4, HAF1, HAR6, ZMF5, ZMR5). By using multiplex PCR detection, the size of the DNA fragments in the amplified products was used to identify jujube seed, Japanese raisin tree seed, and jujube seed, and to determine the specific adulterant varieties.

Benefits of technology

It enables accurate identification of jujube seed and its adulterants, reduces the false positive rate, improves the specificity and sensitivity of the detection, simplifies the operation process, and is suitable for the development of rapid identification kits.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure BDA0003538215280000051
    Figure BDA0003538215280000051
  • Figure HDA0003538215290000011
    Figure HDA0003538215290000011
  • Figure HDA0003538215290000012
    Figure HDA0003538215290000012
Patent Text Reader

Abstract

The application discloses a primer composition and kit and a multiplex PCR detection method for identifying or assisting in identifying Zizyphus jujuba Mill and its counterfeit products. The primer composition comprises primers SF1, SR4, HAF1, HAR6, ZMF5 and ZMR5. The primer composition can specifically amplify DNA fragments of Zizyphus jujuba Mill, Hovenia acerba Lindl and Zizyphus jujuba var. sativa Mill.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of biotechnology, specifically relating to a primer composition and multiplex PCR detection method for the identification or auxiliary identification of jujube seed and its adulterants (jujube seed and Japanese raisin tree seed). Background Technology

[0002] Sour jujube seed is the dried, mature seed of Ziziphus jujuba Mill. var. spinosa (Bunge) Hu ex HFChou. It is neutral in nature and has a sweet and sour taste. It has sedative, hypnotic, anti-anxiety, antidepressant, and antioxidant effects. As one of the first-choice traditional Chinese medicines for sedation and tranquilization in clinical practice, sour jujube seed has been made into various preparations for clinical use.

[0003] The increasing clinical demand for jujube seed and the limited supply of wild resources have led to a surge in the price of jujube seed medicinal materials, resulting in varying degrees of adulteration with similar-looking counterfeit products. Currently, the main adulterants appearing in the medicinal material market include the seeds of *Hovenia acerba* Lindl. and the jujube kernels of related plants such as *Ziziphus mauritiana* Lam.

[0004] Currently, there are identification methods for authenticating jujube seeds, including source identification, morphological identification, microscopic identification, physicochemical identification, and biological identification. There are also studies on the identification of adulterated powders with different proportions based on hydrogen nuclear magnetic resonance technology. Most of the reported biological identification methods are single-site specific PCR technology, which can only be used to identify authenticity. Summary of the Invention

[0005] In view of the current application status of jujube seed, one of the purposes of this method is to use molecular biology methods to screen specific primers for jujube seed, Japanese raisin tree seed, and jujube seed based on SNP site differences, construct a multi-site specific detection technology, and use the multi-site specific method to detect different adulterants. This can not only distinguish between genuine and counterfeit products, but also accurately identify the specific adulterants, providing a reference for the scientific and comprehensive evaluation of the quality of jujube seed.

[0006] This invention provides a primer composition for the identification or auxiliary identification of jujube seed and its adulterants (jujube seed and Japanese raisin tree seed), comprising primers SF1, SR4, HAF1, HAR6, ZMF5, and ZMR5.

[0007] The primer SF1 is either 1) or 2) as follows:

[0008] 1) is the single-stranded DNA molecule shown in sequence 1;

[0009] 2) Single-stranded DNA molecules obtained by deleting and / or adding and / or altering one or more nucleotides in sequence 1;

[0010] The primer SR4 is either 3) or 4) as follows:

[0011] 3) is the single-stranded DNA molecule shown in sequence 2;

[0012] 4) Single-stranded DNA molecules obtained by deleting and / or adding and / or altering one or more nucleotides in sequence 2;

[0013] The primer HAF1 is as follows (5) or (6):

[0014] 5) is the single-stranded DNA molecule shown in sequence 3;

[0015] 6) Single-stranded DNA molecules obtained by deleting and / or adding and / or altering one or more nucleotides in sequence 3;

[0016] The primer HAR6 is as follows (7) or (8):

[0017] 7) is the single-stranded DNA molecule shown in sequence 4;

[0018] 8) Single-stranded DNA molecules obtained by deleting and / or adding and / or altering one or more nucleotides in sequence 4;

[0019] The primer ZMF5 is as follows (9) or (10):

[0020] 9) is the single-stranded DNA molecule shown in sequence 5;

[0021] 10) Single-stranded DNA molecules obtained by deleting and / or adding and / or altering one or more nucleotides in sequence 5;

[0022] The primer ZMR5 is either 11) or 12) as follows:

[0023] 11) is the single-stranded DNA molecule shown in sequence 6;

[0024] 12) Single-stranded DNA molecules obtained by deleting and / or adding and / or altering one or more nucleotides in sequence 6.

[0025] Optionally, in the above primer composition, the jujube seed-specific primer pair consists of primer SF1 and primer SR4; the Japanese raisin tree seed-specific primer pair consists of primer NAF1 and primer HAR6; and the jujube seed-specific primer pair consists of primer ZMF5 and primer ZMR5.

[0026] Optionally, in the above primer composition, the molar ratio of primer SF1, primer SR4, primer ZMF5, primer ZMR5, primer HAF1 and primer HAR6 is 4:4:4:4:5:5.

[0027] The present invention also provides a reagent for the identification or auxiliary identification of jujube seed and its adulterants, comprising the above-mentioned primer composition.

[0028] The present invention also provides a kit for the identification or auxiliary identification of jujube seed and its adulterants, comprising the primer composition described above.

[0029] Optionally, the kit described above also includes a polymerase. The polymerase may be 2x M5 HiPer plusTaq HiFi PCR Mix, M5 Taq DNA Polymerase, M5 Taq HiFi DNA Polymerase, or 2x M5Super FastTaq PCR MasterMix.

[0030] This invention also provides a multiplex PCR detection method for the identification or auxiliary identification of jujube seed and its adulterants, comprising using the above-mentioned primers SF1, SR4, HAF1, HAR6, ZMF5 and ZMR5 to perform multiplex PCR on the genomic DNA of the sample to be tested, and identifying or assisting in the identification of jujube seed and its adulterants based on the multiplex PCR results.

[0031] Alternatively, according to the above-described multiplex PCR detection method,

[0032] The annealing temperature for the multiplex PCR is 62℃-65℃;

[0033] The number of cycles for the multiplex PCR is 23-24;

[0034] The amount of genomic DNA used in the sample to be tested is 1.2-30 ng;

[0035] The molar ratio of primer SF1, primer SR4, primer ZMF5, primer ZMR5, primer HAF1 and primer HAR6 is 4:4:4:4:5:5;

[0036] The concentrations of primers SF1, SR4, ZMF5, and ZMR5 in the multiplex PCR system were all 0.08 μmol·L⁻¹. -1 The concentrations of primers HAF1 and HAR6 in the multiplex PCR system were both 0.1 μmol·L⁻¹. -1 .

[0037] Optionally, based on the above-described multiplex PCR detection method, the multiplex PCR results are used to identify or assist in the identification of whether the amplification product of the multiplex PCR contains DNA fragment A; if it does, the sample to be tested contains or is a candidate for containing jujube seed; if it does not, the sample to be tested does not contain or is a candidate for not containing jujube seed; whether the amplification product of the multiplex PCR contains DNA fragment B; if it does, the sample to be tested contains or is a candidate for containing Japanese raisin tree fruit; if it does not, the sample to be tested does not contain or is a candidate for not containing Japanese raisin tree fruit; whether the amplification product of the multiplex PCR contains DNA fragment C; if it does, the sample to be tested contains or is a candidate for containing jujube seed; if it does not, the sample to be tested does not contain or is a candidate for not containing jujube seed.

[0038] The DNA fragment A is 545-555 bp (e.g., 549 bp); the DNA fragment B is 165-175 bp (e.g., 169 bp); and the DNA fragment C is 385-395 bp (e.g., 389 bp).

[0039] In practical applications, due to different templates, the amplification products may have differences of a few bases, but these all fall within the scope of the corresponding DNA fragments.

[0040] The applications of the aforementioned primer compositions, reagents, and kits also fall within the scope of protection of this invention. Specifically, they can be applied in any of the following ways:

[0041] (1) Identification or auxiliary identification of jujube seed;

[0042] (2) To identify or assist in the identification of jujube seed, Japanese raisin tree seed and jujube seed;

[0043] (3) Identify or assist in identifying whether the sample to be tested is jujube seed, Japanese raisin tree seed, or jujube seed;

[0044] (4) To identify or assist in identifying whether the sample to be tested contains jujube seed, Japanese raisin tree seed or jujube seed;

[0045] (5) Prepare a kit for identifying or assisting in the identification of jujube seed;

[0046] (6) Prepare a kit for identifying or assisting in the identification of Ziziphus jujuba var. spinosa, Raisinia serratifolia, and Ziziphus jujuba var. spinosa;

[0047] (7) Prepare a kit for identifying or assisting in the identification of whether the sample to be tested is jujube seed, Japanese raisin tree seed or jujube seed;

[0048] (8) Prepare a kit for identifying or assisting in the identification of whether a sample contains jujube seed, Japanese raisin tree seed or jujube seed.

[0049] The primer combination described above can specifically amplify DNA fragments from jujube seed, Japanese raisin tree seed, and jujube seed.

[0050] The above detection methods have the advantages of high specificity, high accuracy, and high sensitivity, making them very suitable for widespread application.

[0051] This invention employs multiple site-specific PCR technology and innovatively selects specific primer combinations, which can not only identify genuine and counterfeit jujube seeds, but also accurately determine the specific adulterant varieties.

[0052] This invention addresses the issue of adulteration of Ziziphus jujuba var. spinosa and Japanese raisin tree seeds for the first time. While the commonly used ITS2 assay for Ziziphus jujuba var. spinosa can only detect the presence of genuine Ziziphus jujuba var. spinosa, its specificity is insufficient to accurately prove the presence of adulterants. This invention, based on the ITS sequences of the original plant genes of Ziziphus jujuba var. spinosa, Japanese raisin tree seeds, and Japanese raisin tree seeds, designs and screens site-specific primers for each. Furthermore, by adjusting the PCR reaction system and conditions, a multiplex site-specific PCR detection method is established. This method significantly reduces the false positive rate of PCR, ensuring the accuracy of the results. Moreover, the multiplex site-specific PCR identification method has advantages such as high repeatability, simple operation, and short detection time, requiring less skill from the identification personnel. Therefore, the establishment of this method lays the foundation for the development of rapid identification kits for Ziziphus jujuba var. spinosa, Japanese raisin tree seeds, and Japanese raisin tree seeds. Attached Figure Description

[0053] Figure 1 The graph shows the PCR reaction results at different annealing temperatures.

[0054] Figure 2 The image shows the results of PCR reactions with different cycle numbers.

[0055] Figure 3 The results of PCR experiments with different enzymes are shown in the figure.

[0056] Figure 4 The results of PCR experiments performed using different PCR instruments are shown in the figure.

[0057] Figure 5 The image shows the PCR reaction results for different amounts of DNA template.

[0058] Figure 6 The image shows the results of PCR reactions with different adulteration ratios.

[0059] Figure 7 Partial primer screening results.

[0060] Figure 8 Partial primer screening results.

[0061] Figure 9Partial primer screening results.

[0062] Figure 10 The results are for different annealing temperatures of primer set HAF1 / HAR6.

[0063] Figure 11 The results are for different annealing temperatures of primer set SF1 / SR4.

[0064] Figure 12 The results are for different annealing temperatures of primer set ZMF5 / ZMR5. Detailed Implementation

[0065] The present invention will now be described in further detail with reference to specific embodiments. The given embodiments are merely illustrative of the invention and not intended to limit its scope. The embodiments provided below can serve as a guide for further improvements by those skilled in the art and do not constitute a limitation on the invention in any way.

[0066] Unless otherwise specified, the experimental methods used in the following embodiments are conventional methods, performed according to the techniques or conditions described in the literature in this field or according to the product instructions. Unless otherwise specified, the materials and reagents used in the following embodiments are commercially available. Unless otherwise specified, the quantitative experiments in the following embodiments are performed in triplicate, and the results are averaged.

[0067] PCR instrument (Hangzhou Jinglü Scientific Instruments Co., Ltd., model K960; Bio-rad C1000 Touch, USA) TM Thermal Cycler; Bio-rad (USA), model T100 TM Thermal Cycler, FA / 3204B 0.0001 g electronic balance (Shanghai Jingke Tianmei Scientific Instruments Co., Ltd.), high-speed centrifuge (manufactured by Hunan Xiangyi Laboratory Instrument Development Co., Ltd.), constant temperature digital display water bath (Jintan Jierui Electric Co., Ltd.), CENCE centrifuge (Xiangyi H1650); vortex apparatus (MX-S), DYY-8C electrophoresis apparatus (manufactured by Beijing Liuyi Biotechnology Co., Ltd.), gel imaging analysis system (Tanon, Tanon-1600).

[0068] Plant genomic DNA extraction kit (Tiangen Biotech (Beijing) Co., Ltd.), DEPC-treated water (Beijing Solarbio Science & Technology Co., Ltd., batch number: 20210309), 2x M5 HiPer plus Taq HiFi PCR Mix, M5 Taq DNA Polymerase, M5 Taq HiFi DNA Polymerase, 2x M5 Super FastTaq PCR MasterMix (Beijing Polymer Biotechnology Co., Ltd.), M5 dNTPs (Beijing Polymer Biotechnology Co., Ltd., batch number: 20HB0606), 6× DNA loading buffer (Beijing Solarbio Science & Technology Co., Ltd., batch number: 20210623), M5 Hipure Next III Gelred nucleic acid dye (Beijing Polymer Biotechnology Co., Ltd., batch number: 20FB1701), thiol reducing agent (Sangon Biotech (Shanghai) Co., Ltd., batch number: 525K038), M5 DL2000 DNA molecular weight standard (Beijing Polymer Biotechnology Co., Ltd., batch number: 21DB0215).

[0069] The medicinal materials were 20 samples collected from various locations for this experiment, including 10 samples of jujube seed, 5 samples of Japanese raisin tree seed, and 5 samples of jujube seed.

[0070] Example 1: Primer design and synthesis for identifying jujube seed, Japanese raisin tree seed, and jujube seed.

[0071] ITS sequences of Ziziphus jujuba seed, Hovenia dulcis seed, and Ziziphus jujuba seed were retrieved and downloaded from GenBank. The ITS sequences of Ziziphus jujuba seed and its adulterants were analyzed using BioEdit software, and multiple sequence comparisons were performed to identify stable and differentially expressed variant sites. Specific primers for identification were designed using Primer Premier 5.0 software based on these variant sites and then screened (see Example 3 for the screening process). Primer sequences were synthesized by Sangon Biotech Co., Ltd. The screened primer sequences are shown in Table 1.

[0072] Table 1 Primers and PCR reaction conditions

[0073]

[0074] Example 2: Application of primers in the identification of jujube seed

[0075] I. Exploration of Specific Primers

[0076] Genomic DNA was extracted from the fruits of Ziziphus jujuba var. spinosa, Hovenia dulcis, and Ziziphus jujuba var. spinosa, and then added to the following reaction systems for PCR amplification.

[0077] The reaction mixture was 25 μL, including 12.5 μL of 2x M5 HiPer plus Taq HiFi PCR Mix buffer, 0.2 μL each of primers SF1 / SR4 and ZMF5 / ZMR5, and 0.25 μL each of primers HAF1 / HAR6 (10 μmol·L⁻¹). -1 That is, the concentrations of primers SF1, SR4, ZMF5, and ZMR5 in the reaction system are all 0.08 μmol•L. -1 The concentrations of primers HAF1 and HAR6 in the reaction system were both 0.1 μmol·L⁻¹. -1 1.5 μL (30 ng) of genomic DNA, followed by sterile water.

[0078] The PCR reaction conditions were: 94℃ for 5 min, 23 cycles (94℃ for 30 s, 63℃ for 30 s, 72℃ for 30 s), 72℃ for 7 min, and 10℃ for 10 min.

[0079] The PCR amplification products were identified by agarose gel electrophoresis.

[0080] Under the above reaction conditions, in the multiplex PCR amplification results, the jujube seed sample could amplify a 549bp fragment, the counterfeit jujube seed could amplify a 389bp fragment, and the counterfeit Japanese raisin tree seed could amplify a 169bp fragment.

[0081] The PCR reagent for identifying jujube seed consists of 2x M5 HiPer plus Taq HiFi PCR Mix buffer, SF1 / SR4, ZMF5 / ZMR5 and HAF1 / HAR6 forward and reverse primers, and water.

[0082] Kits containing forward and reverse primers SF1 / SR4, HAF1 / HAR6, ZMF5 / ZMR5, or the above-mentioned PCR reagents for identifying jujube seed can be used to identify jujube seed, Japanese raisin tree seed, and jujube seed.

[0083] II. Investigation of Annealing Temperature

[0084] Genomic DNA from Ziziphus jujuba seed, Hovenia dulcis seed, and Ziziphus jujuba seed was added to the following reaction system for multiplex PCR amplification.

[0085] The reaction mixture was 25 μL, including 12.5 μL of 2x M5 HiPer plus Taq HiFi PCR Mix buffer, 0.2 μL each of primers SF1 / SR4 and ZMF5 / ZMR5, and 0.25 μL each of primers HAF1 / HAR6 (10 μmol·L⁻¹). -1 ), 1.5 μL (30 ng) of genomic DNA, and sterile water to make up the difference.

[0086] The PCR reaction was carried out under the following different annealing temperatures: 62℃, 63℃, 64℃, and 65℃.

[0087] The PCR reaction conditions were: 94℃ for 5 min, 23 cycles (94℃ for 30 s, annealing temperature (62℃, 63℃, 64℃ or 65℃) for 30 s, 72℃ for 30 s), 72℃ for 7 min, 10℃ for 10 min.

[0088] The PCR amplification products were identified by agarose gel electrophoresis.

[0089] The results are as follows Figure 1 As shown, M represents the M5 DL2000bp DNA Marker; from left to right, the annealing temperatures are 62℃, 63℃, 64℃, and 65℃; 1, 2, 7, 8, 13, 14, 19, and 20 represent jujube seed, 3, 4, 9, 10, 15, 16, 21, and 22 represent jujube seed, and 5, 6, 11, 12, 17, 18, 23, and 24 represent jujube seed; it can be seen that the specific band brightness of jujube seed is significantly reduced at annealing temperatures of 64℃ and 65℃. To ensure the reproducibility of the PCR reaction, an annealing temperature of 63℃ is preferred.

[0090] III. Examination of Repeating Numbers

[0091] Genomic DNA from Ziziphus jujuba seed, Hovenia dulcis seed, and Ziziphus jujuba seed was added to the following reaction system for multiplex PCR amplification.

[0092] The reaction mixture was 25 μL, including 12.5 μL of 2x M5 HiPer plus Taq HiFi PCR Mix buffer, 0.2 μL each of primers SF1 / SR4 and ZMF5 / ZMR5, and 0.25 μL each of primers HAF1 / HAR6 (10 μmol·L⁻¹). -1 ), 1.5 μL (30 ng) of genomic DNA, and sterile water to make up the difference.

[0093] The PCR reaction was carried out under the following conditions with different cycle numbers n: 21, 22, 23, and 24.

[0094] The PCR reaction conditions were: 94℃ for 5 min, n cycles (94℃ for 30 s, 63℃ for 30 s, 72℃ for 30 s), 72℃ for 7 min, and 10℃ for 10 min.

[0095] The PCR amplification products were identified by agarose gel electrophoresis.

[0096] The results are as follows Figure 2As shown, M represents the M5 DL2000bp DNA Marker; from left to right, the number of cycles are 21, 22, 23, and 24; 1, 2, 7, 8, 13, 14, 19, and 20 represent genuine jujube seed; 3, 4, 9, 10, 15, 16, 21, and 22 represent Japanese raisin tree fruit; and 5, 6, 11, 12, 17, 18, 23, and 24 represent processed jujube seed. It can be seen that the jujube seed band exhibits slight tailing at 22 cycles. The specific band brightness of jujube seed, Japanese raisin tree fruit, and processed jujube seed is significantly enhanced at 23-24 cycles. Therefore, to ensure the brightness of the specific product bands, a lower number of cycles is chosen to reduce the possibility of product contamination. Thus, 23 cycles are preferred.

[0097] IV. Broad-spectrum activity of DNA polymerase

[0098] Genomic DNA from Ziziphus jujuba seed, Hovenia dulcis seed, and Ziziphus jujuba seed was added to the following reaction system for multiplex PCR amplification.

[0099] The reactions were carried out under the following PCR reaction conditions with different polymerases, including 2x M5 HiPer plusTaq HiFi PCR Mix, M5 Taq DNA Polymerase, M5 Taq HiFi DNA Polymerase, and 2x M5 SuperFastTaq PCR Master Mix.

[0100] 2x M5 HiPer plus Taq HiFi PCR Mix: The reaction volume is 25 μL, including 12.5 μL of 2x M5HiPer plus Taq HiFi PCR Mix buffer, 0.2 μL each of primers SF1 / SR4 and ZMF5 / ZMR5, and 0.25 μL each of primers HAF1 / HAR6 (10 μmol·L⁻¹). -1 ), 1.5 μL (30 ng) of genomic DNA, and sterile water to make up the difference.

[0101] M5 Taq DNA Polymerase: The reaction system is 25 μL, including 2.5 μL 10x M5 Taq PCR Buffer, 0.5 μL dNTPs, 0.5 μL M5 Taq DNA Polymerase, 0.2 μL each of primers SF1 / SR4 and ZMF5 / ZMR5, 0.25 μL each of primers HAF1 / HAR6 (10 μmol·L⁻¹), 1.5 μL (30 ng) genomic DNA, and sterile water to make up the difference.

[0102] M5 Taq HiFi DNA Polymerase: The reaction system is 25 μL, including 2.5 μL 10x Taq HiFi PCR Buffer, 0.5 μL dNTPs, 0.3 μL M5 Taq HiFi DNA Polymerase, 0.2 μL each of primers SF1 / SR4 and ZMF5 / ZMR5, 0.25 μL each of primers HAF1 / HAR6 (10 μmol·L⁻¹), 1.5 μL (30 ng) genomic DNA, and sterile water to make up the difference.

[0103] 2x M5 Super FastTaq PCR Master Mix: The reaction volume is 25 μL, including 12.5 μL of 2x M5 Super FastTaq PCR Master Mix, 0.2 μL each of primers SF1 / SR4 and ZMF5 / ZMR5, and 0.25 μL each of primers HAF1 / HAR6 (10 μmol·L⁻¹). -1 ), 1.5 μL (30 ng) of genomic DNA, and sterile water to make up the difference.

[0104] The PCR amplification reaction conditions were as follows: 94℃ for 5 min, 23 cycles (94℃ for 30 s, 63℃ for 30 s, 72℃ for 30 s), 72℃ for 7 min, and 10℃ for 10 min.

[0105] The PCR amplification products were identified by agarose gel electrophoresis.

[0106] The results are as follows Figure 3 As shown, M represents the M5 DL2000bp DNA Marker; 1, 2, 7, 8, 13, 14, 19, and 20 represent Ziziphus jujuba var. spinosa seeds; 3, 4, 9, 10, 15, 16, 21, and 22 represent Hovenia dulcis seeds; and 5, 6, 11, 12, 17, 18, 23, and 24 represent Ziziphus jujuba var. spinosa seeds. Reaction systems 1-6 contain 2x M5 HiPer plus Taq HiFi PCR Mix; reaction systems 7-12 contain M5 Taq DNA Polymerase; reaction systems 13-18 contain M5 Taq HiFi DNA Polymerase; and reaction systems 19-24 contain 2x M5 SuperFastTaq PCR Master Mix. It can be seen that, except for enzyme M5 Taq DNA Polymerase, all others can amplify specific bands for jujube seed, Japanese raisin tree seed, and jujube seed. The enzyme 2x M5 Super FastTaq PCR Master Mix showed a false positive band for jujube seed in the jujube seed amplification results, indicating that this enzyme has the possibility of false positive results. If this enzyme is used for identification, the detection method needs to be adjusted.

[0107] V. Broad-spectrum PCR instrument

[0108] Genomic DNA from Ziziphus jujuba seed, Hovenia dulcis seed, and Ziziphus jujuba seed was added to the following reaction system for multiplex PCR amplification.

[0109] The reaction mixture was 25 μL, including 12.5 μL of 2x M5 HiPer plus Taq HiFi PCR Mix buffer, 0.2 μL each of primers SF1 / SR4 and ZMF5 / ZMR5, and 0.25 μL each of primers HAF1 / HAR6 (10 μmol·L⁻¹). -1 ), 1.5 μL (30 ng) of genomic DNA, and sterile water to make up the difference.

[0110] The PCR amplification reaction conditions were as follows: 94℃ for 5 min, 23 cycles (94℃ for 30 s, 63℃ for 30 s, 72℃ for 30 s), 72℃ for 7 min, and 10℃ for 10 min.

[0111] Three different PCR instruments were used for PCR amplification: Hangzhou Jinglü Scientific Instruments Co., Ltd., model K960; and Bio-rad C1000 Touch (USA). TM Thermal Cycler; Bio-rad (USA), model T100 TM ThermalCycler and multiple experiments using the same instrument.

[0112] The PCR amplification products were identified by agarose gel electrophoresis.

[0113] The results are as follows Figure 4 As shown, M represents the M5 DL2000bp DNA Marker; 1, 2, 7, 8, 13, and 14 are genuine Ziziphus jujuba seeds; 3, 4, 9, 10, 15, and 16 are Hovenia dulcis seeds; 5, 6, 11, 12, 17, and 18 are Ziziphus jujuba seeds; K960 is the PCR instrument used (Hangzhou Jinglü Scientific Instruments Co., Ltd., model K960), and C1000 Touch is the instrument used. TM To use a PCR instrument (Bio-Rad C1000Touch, USA) TM Thermal Cycler, T100 TM To use a PCR instrument (Bio-Rad T100, USA) TM (ThermalCycler). The results showed that the amplification results of different PCR instruments could distinguish between Ziziphus jujuba var. spinosa, Hovenia dulcis, and Ziziphus jujuba var. spinosa, indicating that the PCR instrument does not affect the identification of Ziziphus jujuba var. spinosa and its adulterants.

[0114] VI. Sensitivity Testing

[0115] Genomic DNA from Ziziphus jujuba seed, Hovenia dulcis seed, and Ziziphus jujuba seed was added to the following reaction system for multiplex PCR amplification.

[0116] The reaction mixture was 25 μL, including 12.5 μL of 2x M5 HiPer plus Taq HiFi PCR Mix buffer, 0.2 μL each of primers SF1 / SR4 and ZMF5 / ZMR5, and 0.25 μL each of primers HAF1 / HAR6 (10 μmol·L⁻¹). -1 ), 1.5 μL of genomic DNA, and sterile water to make up the difference.

[0117] The genomic DNA contents were 30, 6, 1.2, and 0.24 ng, respectively.

[0118] The PCR amplification reaction conditions were as follows: 94℃ for 5 min, 23 cycles (94℃ for 30 s, 63℃ for 30 s, 72℃ for 30 s), 72℃ for 7 min, and 10℃ for 10 min.

[0119] The PCR amplification products were identified by agarose gel electrophoresis.

[0120] The results are as follows Figure 5 As shown, M is the M5 DL2000bp DNA Marker; 1, 2, 7, 8, 13, 14, 19, 20 are Ziziphus jujuba seeds, 3, 4, 9, 10, 15, 16, 21, 22 are Hovenia dulcis seeds, and 5, 6, 11, 12, 17, 18, 23, 24 are Ziziphus jujuba seeds; the DNA template amounts from left to right are 30, 6, 1.2, and 0.24 ng, respectively. The results showed that the sensitivity of the jujube seed-specific primer pair in this method reached 0.24 ng, confirming that the specific band could be amplified with jujube seed DNA template amounts ranging from 0.24 to 30 ng. No band appeared with jujube seed DNA content of 0.24 ng, indicating that the sensitivity of the specific primer pair reached 1.2 ng, confirming that the jujube seed DNA template amount range in this method was 1.2-30 ng. Similarly, the sensitivity of the jujube seed-specific primer pair reached 0.24 ng, confirming that the jujube seed DNA template amount range in this method was 0.24-30 ng.

[0121] VII. Detection Limit for Adulteration

[0122] Samples were prepared by mixing jujube seed, Japanese raisin tree seed, and jujube seed in different proportions to test the ability of multiple site-specific PCR reactions to identify adulterated samples.

[0123] Take 1g each of Hovenia dulcis seed powder and Ziziphus jujuba seed powder and mix them thoroughly to obtain a mixture. Mix different amounts of this mixture with Ziziphus jujuba seed powder to obtain the following concentrations: 0% (Hovenia dulcis seed 50mg, Ziziphus jujuba seed 50mg), 1% (Ziziphus jujuba seed 1mg, Hovenia dulcis seed 49.5mg, Ziziphus jujuba seed 49.5mg), 2% (Ziziphus jujuba seed 2mg, Hovenia dulcis seed 49mg, Ziziphus jujuba seed 49mg), and 5% (Ziziphus jujuba seed 5mg, Hovenia dulcis seed 47.5mg, Ziziphus jujuba ... Mixed samples were prepared using the following concentrations: 7.5 mg, 10% (10 mg of Ziziphus jujuba seed, 45 mg of Hovenia dulcis seed, and 45 mg of Ziziphus jujuba seed), 20% (20 mg of Ziziphus jujuba seed, 40 mg of Hovenia dulcis seed, and 40 mg of Ziziphus jujuba seed), 50% (50 mg of Ziziphus jujuba seed, 25 mg of Hovenia dulcis seed, and 25 mg of Ziziphus jujuba seed), and 100% (100 mg of Ziziphus jujuba seed). Mixed samples containing different proportions of Hovenia dulcis seed powder and Ziziphus jujuba seed powder were also prepared using the same method. Genomic DNA was extracted from the mixed samples using a plant genomic DNA extraction kit.

[0124] The reaction system consisted of 25 μL, including 12.5 μL of 2x M5 HiPer plus Taq HiFi PCR Mix buffer, 0.2 μL each of primers SF1 / SR4 and ZMF5 / ZMR5, 0.25 μL each of primers HAF1 / HAR6 (10 μmol·L⁻¹), 1.5 μL (30 ng) of genomic DNA, and sterile water to make up the volume.

[0125] The PCR amplification reaction conditions were as follows: 94℃ for 5 min, 23 cycles (94℃ for 30 s, 63℃ for 30 s, 72℃ for 30 s), 72℃ for 7 min, and 10℃ for 10 min.

[0126] The PCR amplification products were identified by agarose gel electrophoresis.

[0127] The results are as follows Figure 6As shown, M is the M5 DL2000 DNA Marker, 8 is jujube seed, 16 is Japanese raisin tree seed, 24 is jujube seed, and 1-7, 9-15, and 17-23 are mixed samples of jujube seed, Japanese raisin tree seed, and jujube seed in different proportions. The ratios of jujube seed, Japanese raisin tree seed, and jujube seed for grades 1-7 are as follows: 1: 0%: 50%: 50%; 2: 1%: 49.5%: 49.5%; 3: 2%: 49%: 49%; 4: 5%: 47.5%: 47.5%; 5: 10%: 45%: 45%; 6: 20%: 40%: 40%; 7: 50%: 25%: 25%. The ratios of Japanese raisin tree seed, jujube seed, and jujube seed for grades 9-15 are as follows: 9: 0%: 50%: 50%; 10: 1%: 49.5%: 49.5%; 11: 2%: 49%: 49%; 12: 10%: 49%: 49%; 12: 10%: 49%: 49%; 13: 10%: 49%: 49%; 14: 10%: 49%: 49%; 15: 10%: 49%: 49%; 16: 10%: 49%: 49%; 17: 10%: 49%: 49%; 18: 10%: 49%: 49%; 19: 10%: 49%: 49%; 10: 10%: 49.5%: 49.5%; 11: 2%: 49%: 49%; 12: 10%: 10%: 49%: 49%; 12: 10%: 10%: 49%: The specific ratios of Ziziphus jujuba seed, Hovenia dulcis seed, and Ziziphus jujuba seed for samples 17-23 are as follows: 17: 0%: 50%: 50%; 18: 1%: 49.5%: 49.5%; 19: 2%: 49%: 49%; 20: 5%: 47.5%: 47.5%; 21: 10%: 45%: 45%; 22: 20%: 40%: 40%; 23: 50%: 25%: 25%. Ziziphus jujuba seed-specific bands were observed in samples 2-7, Hovenia dulcis seed-specific bands were observed in samples 14 and 15, and Ziziphus jujuba seed-specific bands were observed in samples 19-23. The results showed that adulteration with more than 1% (1 mg of jujube seed, 49.5 mg of Japanese raisin tree fruit, and 49.5 mg of jujube seed) of jujube seed, more than 20% (40 mg of jujube seed, 20 mg of Japanese raisin tree fruit, and 40 mg of jujube seed) of Japanese raisin tree fruit, or more than 2% (49 mg of jujube seed, 49 mg of Japanese raisin tree fruit, and 2 mg of jujube seed) of jujube seed was detectable. Therefore, the detection limits for adulteration of jujube seed, Japanese raisin tree fruit, and jujube seed in multiplex PCR were determined to be 1% (1 mg of jujube seed, 49.5 mg of Japanese raisin tree fruit, and 49.5 mg of jujube seed), 20% (40 mg of jujube seed, 20 mg of Japanese raisin tree fruit, and 40 mg of jujube seed), and 2% (49 mg of jujube seed, 49 mg of Japanese raisin tree fruit, and 2 mg of jujube seed).

[0128] Example 3: Screening of initial primers and annealing temperature

[0129] By comparing the differences in SNP sites of the ITS sequences of Ziziphus jujuba seed, Hovenia dulcis seed, and Ziziphus jujuba seed, a large number of primers were designed and screened experimentally to obtain primers with specificity.

[0130] 1. Screening of specific primers for jujube seed

[0131] The reaction system consisted of 25 μL, including 12.5 μL of 2x M5 HiPer plus Taq HiFi PCR Mix buffer, 0.5 μL each of forward and reverse primers, 1.5 μL (30 ng) of genomic DNA from Ziziphus jujuba seed, Hovenia dulcis seed, or Ziziphus jujuba seed, and sterile water to make up the volume.

[0132] The PCR amplification reaction conditions were as follows: 94℃ for 5 min, 35 cycles (94℃ for 30 s, 55℃ for 15 s, 72℃ for 30 s), 72℃ for 7 min, and 10℃ for 10 min.

[0133] SR1: GGGCGCAACTTGCGTTCAAAA;

[0134] SR2: CCCTCTTCGCCTCGAGGTC;

[0135] SR3: GCATTTCGGCCAGCCGCGG.

[0136] The PCR amplification products were identified by agarose gel electrophoresis.

[0137] Some primer screening results can be found in Figure 7 M represents the M5 DL2000 DNA Marker. Templates 1, 5, 9, and 13 are genomic DNA from Ziziphus jujuba var. spinosa; templates 2, 6, 10, and 14 are genomic DNA from Hovenia dulcis; templates 3, 7, 11, and 15 are genomic DNA from Ziziphus jujuba var. spinosa; and templates 4, 8, 12, and 16 are blank controls. Primers used for 1-4 are SF1 / SR1; primers used for 5-8 are SF1 / SR2; primers used for 9-12 are SF1 / SR3; and primers used for 13-16 are SF1 / SR4.

[0138] The results showed that the reverse primer SR4 was more specific than SR1-SR3, therefore the specific primer pair for jujube seed was selected as SF1 / SR4.

[0139] 2. Screening of specific primers for jujube seed

[0140] The reaction system is the same as in step 1.

[0141] The PCR amplification reaction conditions were: 94℃ for 5 min, 36 cycles (94℃ for 30 s, 60℃ for 30 s, 72℃ for 30 s), 72℃ for 7 min, and 10℃ for 10 min.

[0142] ZMF4: GGGGGTTGCATCCCACGCA;

[0143] ZMR4:CCCTCTTCCCTTCCGAGGCG;

[0144] ZMR6:GCGTTGGAGACGCCGCATCC.

[0145] The PCR amplification products were identified by agarose gel electrophoresis.

[0146] Some primer screening results can be found in Figure 8 M represents the M5 DL2000 DNA Marker. Templates 1, 5, 9, 13, 17, and 21 are genomic DNA from Ziziphus jujuba var. spinosa; templates 2, 6, 10, 14, 18, and 22 are genomic DNA from Raisinia serratifolia; templates 3, 7, 11, 15, 19, and 23 are genomic DNA from Ziziphus jujuba var. spinosa; and templates 4, 8, 12, 16, 20, and 24 are blank controls. Primers used for templates 1-4 are ZMF4 / ZMR4; primers used for 5-8 are ZMF4 / ZMR5; primers used for 9-12 are ZMF4 / ZMR6; primers used for 13-16 are ZMF5 / ZMR4; primers used for 17-20 are ZMF5 / ZMR5; and primers used for 21-24 are ZMF5 / ZMR6.

[0147] Based on the results comparison and subsequent annealing temperature exploration, the specific primer pair for jujube seed was selected as ZMF5 / ZMR5.

[0148] 3. Screening of primers specific to Hovenia dulcis

[0149] The reaction system is the same as in step 1.

[0150] The PCR amplification reaction conditions were: 94℃ for 5 min, 36 cycles (94℃ for 30 s, 60℃ for 30 s, 72℃ for 30 s), 72℃ for 7 min, and 10℃ for 10 min.

[0151] HAR1: GCGCAACTTGCGTTCAAAGAT;

[0152] HAR2: CGGCACGCATCGCCGAGGACT;

[0153] HAR3: CACCGACTGTTACGGCACCGCA;

[0154] HAR4:GGCGCATTGGGGTTCCTCGAT;

[0155] HAR5: CGTTGGAGACGCCGCAGCA.

[0156] The PCR amplification products were identified by agarose gel electrophoresis.

[0157] Some primer screening results can be found in Figure 9M represents the M5 DL2000 DNA Marker. Templates 1, 5, 9, 13, 17, and 21 are genomic DNA from Ziziphus jujuba var. spinosa; templates 2, 6, 10, 14, 18, and 22 are genomic DNA from Hovenia dulcis; templates 3, 7, 11, 15, 19, and 23 are genomic DNA from Ziziphus jujuba var. spinosa; and templates 4, 8, 12, 16, 20, and 24 are blank controls. Primers used for 1-4 are HAF1 / HAR1; primers used for 5-8 are HAF1 / HAR2; primers used for 9-12 are HAF1 / HAR3; primers used for 13-16 are HAF1 / HAR4; primers used for 17-20 are HAF1 / HAR5; and primers used for 21-24 are HAF1 / HAR6.

[0158] Based on the results comparison and subsequent annealing temperature exploration, the specific primer pair for Hovenia dulcis was selected as HAF1 / HAR6.

[0159] 4. Screening of initial annealing temperatures

[0160] In the initial stage, the annealing temperatures of individual primers were screened at 60℃, 62℃, 64℃, and 66℃.

[0161] The reaction system consisted of 25 μL, including 12.5 μL of 2x M5 HiPer plus Taq HiFi PCR Mix buffer, 0.5 μL each of forward and reverse primers, 1.5 μL (30 ng) of genomic DNA from Ziziphus jujuba seed, Hovenia dulcis seed, or Ziziphus jujuba seed, and sterile water to make up the volume.

[0162] The PCR amplification reaction conditions were as follows: 94℃ for 5 min, 35 cycles (94℃ for 30 s, annealing temperature (60℃, 62℃, 64℃ or 66℃) for 15 s, 72℃ for 30 s), 72℃ for 7 min, 10℃ for 10 min.

[0163] The PCR amplification products were identified by agarose gel electrophoresis.

[0164] Annealing temperature screening results are as follows Figure 10 , 11 As shown in Figures 1 and 12.

[0165] Figure 10 The results of different annealing temperatures for primer set HAF1 / HAR6 are shown below: 1-4 at 62℃; 5-8 at 63℃; 9-12 at 64℃; 13-16 at 65℃; 17-20 at 66℃; M is M5 DL2000 DNA Marker; 1, 5, 9, 13, and 17 are Ziziphus jujuba seeds; 2, 6, 10, 14, and 18 are Hovenia dulcis seeds; 3, 7, 11, 15, and 19 are Ziziphus jujuba seeds; and 4, 8, 12, 16, and 20 are blank controls.

[0166] Figure 11The results of different annealing temperatures for primer set SF1 / SR4 are shown below: 1-4 at 62℃; 5-8 at 63℃; 9-12 at 64℃; 13-16 at 65℃; 17-20 at 66℃; M is M5 DL2000 DNA Marker; 1, 5, 9, 13, and 17 are Ziziphus jujuba seeds; 2, 6, 10, 14, and 18 are Hovenia dulcis seeds; 3, 7, 11, 15, and 19 are Ziziphus jujuba seeds; 4, 8, 12, 16, and 20 are blank controls.

[0167] Figure 12 The results of different annealing temperatures for primer group ZMF5 / ZMR5 are shown below: 1-4 at 62℃; 5-8 at 63℃; 9-12 at 64℃; 13-16 at 65℃; 17-20 at 66℃; M represents M5 DL2000 DNA Marker; 1, 5, 9, 13, and 17 represent Ziziphus jujuba var. spinosa seeds; 2, 6, 10, 14, and 18 represent Hovenia dulcis seeds; 3, 7, 11, 15, and 19 represent Ziziphus jujuba var. spinosa seeds; and 4, 8, 12, 16, and 20 represent blank controls.

[0168] The results showed that the primer bands were weakest at 66℃, so the annealing temperature of 66℃ was excluded, and the annealing temperature range was narrowed to 62℃-65℃.

[0169] The present invention has been described in detail above. For those skilled in the art, the invention can be practiced in a wide range of ways with equivalent parameters, concentrations, and conditions without departing from its spirit and scope, and without requiring unnecessary experiments. Although specific embodiments have been given, it should be understood that further modifications can be made to the invention. In summary, according to the principles of the invention, this application is intended to include any changes, uses, or improvements to the invention, including changes made using conventional techniques known in the art that depart from the scope disclosed herein. Some of the essential features can be applied within the scope of the following appended claims. sequence list <110> Shanxi University of Traditional Chinese Medicine <120> A primer composition and multiplex PCR detection method for the identification or auxiliary identification of jujube seed and its adulterants. <160> 6 <170> SIPOSequenceListing 1.0 <210> 1 <211> twenty one <212> DNA <213> Artificial Sequence <400> 1 cctgtgtccc ggagccttcc t 21 <210> 2 <211> twenty one <212> DNA <213> Artificial Sequence <400> 2 ggtctctgta gggccgcgac a 21 <210> 3 <211> twenty two <212> DNA <213> Artificial Sequence <400> 3 aatcccgtga accatcgaat ct 22 <210> 4 <211> twenty one <212> DNA <213> Artificial Sequence <400> 4 cgcatttcgg ccaaccgctc g 21 <210> 5 <211> 20 <212> DNA <213> Artificial Sequence <400> 5 gtgcgtcgta ttctgtctta 20 <210> 6 <211> twenty one <212> DNA <213> Artificial Sequence <400> 6 tccgcgacgc attggggtct t 21

Claims

1. A primer composition for the identification or auxiliary identification of jujube seed and its adulterants, characterized in that: Including primers SF1, SR4, HAF1, HAR6, ZMF5, and ZMR5. The primer SF1 is a single-stranded DNA molecule as shown in sequence 1; The primer SR4 is a single-stranded DNA molecule as shown in sequence 2; The primer HAF1 is a single-stranded DNA molecule as shown in sequence 3; The primer HAR6 is a single-stranded DNA molecule as shown in sequence 4; The primer ZMF5 is a single-stranded DNA molecule as shown in sequence 5; The primer ZMR5 is a single-stranded DNA molecule as shown in sequence 6.

2. The primer composition according to claim 1, characterized in that: In the primer composition, the molar ratio of primer SF1, primer SR4, primer ZMF5, primer ZMR5, primer HAF1 and primer HAR6 is 4:4:4:4:5:

5.

3. A reagent for the identification or auxiliary identification of jujube seed and its adulterants, characterized in that: Includes the primer composition of claim 1.

4. A reagent kit for the identification or auxiliary identification of jujube seed and its adulterants, characterized in that: Includes the primer composition of claim 1.

5. The reagent kit according to claim 4, characterized in that: It also includes polymerase.

6. A multiplex PCR detection method for the identification or auxiliary identification of jujube seed and its adulterants, characterized in that: The method includes performing multiplex PCR on the genomic DNA of the sample to be tested using the primers SF1, SR4, HAF1, HAR6, ZMF5, and ZMR5 described in claim 1, and identifying or assisting in the identification of the authenticity of jujube seed based on the multiplex PCR results; the adulterant is Japanese raisin tree seed and / or jujube seed. The authenticity of jujube seed is determined by whether the amplification product of the multiplex PCR contains DNA fragment A; if it does, the sample to be tested contains or is a candidate to contain jujube seed. If it is not present, then the sample to be tested does not contain or is a candidate for containing jujube seed; whether the amplification product of the multiplex PCR contains DNA fragment B; if it contains B, then the sample to be tested contains or is a candidate for containing Japanese raisin tree seed; if it does not contain B, then the sample to be tested does not contain or is a candidate for containing Japanese raisin tree seed; whether the amplification product of the multiplex PCR contains DNA fragment C; if it contains C, then the sample to be tested contains or is a candidate for containing jujube seed; if it does not contain C, then the sample to be tested does not contain or is a candidate for containing jujube seed. The DNA fragment A is 549 bp in size; the DNA fragment B is 169 bp in size; and the DNA fragment C is 389 bp in size.

7. The multiplex PCR detection method according to claim 6, characterized in that: The annealing temperature for the multiplex PCR is 62℃-65℃; The number of cycles for the multiplex PCR is 23-24; The amount of genomic DNA used in the sample to be tested is 1.2-30 ng; The molar ratio of primer SF1, primer SR4, primer ZMF5, primer ZMR5, primer HAF1 and primer HAR6 is 4:4:4:4:5:5; The concentrations of primers SF1, SR4, ZMF5, and ZMR5 in the multiplex PCR system were all 0.08 μmol·L⁻¹. -1 The concentrations of primers HAF1 and HAR6 in the multiplex PCR system were both 0.1 μmol·L⁻¹. -1 .

8. The use of the primer composition of claim 1 or 2, the reagent of claim 3, or the kit of claim 4 or 5 in any of the following: (1) Identification or auxiliary identification of jujube seed; (2) To identify or assist in the identification of jujube seed, Japanese raisin tree seed and jujube seed; (3) Identify or assist in identifying whether the sample to be tested is jujube seed, Japanese raisin tree seed, or jujube seed; (4) To identify or assist in identifying whether the sample to be tested contains jujube seed, Japanese raisin tree seed or jujube seed; (5) Prepare a kit for identifying or assisting in the identification of jujube seed; (6) Prepare a kit for identifying or assisting in the identification of jujube seed, Japanese raisin tree seed and jujube seed; (7) Prepare a kit for identifying or assisting in the identification of whether the sample to be tested is jujube seed, Japanese raisin tree seed or jujube seed; (8) Prepare a kit for identifying or assisting in the identification of whether a sample contains jujube seed, Japanese raisin tree seed or jujube seed.

Citation Information

Patent Citations

  • KR20240164675A