SNP isothermal detection method

The ICR-LAMP system enables high-sensitivity and high-specificity detection of SNPs under isothermal conditions, solving the problem of rapid and low-cost SNP detection in resource-scarce areas and emergency medical scenarios in existing technologies, and achieving accurate identification and typing of low-concentration templates.

CN121428069APending Publication Date: 2026-01-30CHENGDU INSTITUTE OF BIOLOGY CHINESE ACADEMY OF SCIENCES
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202511505132.4
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-10-21
Publication Date
2026-01-30

AI Technical Summary

Technical Problem

Existing SNP detection technologies are difficult to implement rapidly, at low cost, and with high specificity in resource-scarce areas and emergency medical settings. Furthermore, existing isothermal nucleic acid amplification technologies have limited SNP resolution capabilities and suffer from issues with method specificity and stability.

Method used

An ICR-LAMP system was constructed to facilitate the synergistic reaction of LAMP and nucleic acid invasion-cleavage reaction (ICR). By designing specific LAMP primers, invasion strands, and fluorescent probes, high sensitivity and specificity of SNP detection were achieved under isothermal conditions. The FEN1 enzyme was used to form a triple-base overlap structure at the SNP site for specific cleavage and signal release.

Benefits of technology

It achieves one-step isothermal SNP detection with high sensitivity and specificity, and can complete the accurate identification and typing of low-concentration templates within 40 minutes. It is suitable for on-site testing, and the equipment is simple and low-cost, making it suitable for the needs of resource-scarce areas.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121428069A_ABST
    Figure CN121428069A_ABST
Patent Text Reader

Abstract

The invention provides an SNP isothermal detection method, and belongs to the technical field of biological detection. According to the method, isothermal amplification and high-specificity allele detection of a nucleic acid template containing SNP sites are realized by constructing an ICR-LAMP system in which LAMP and a nucleic acid intrusive shear reaction (ICR) are subjected to a synergistic reaction in the same reaction tube. The method comprises the following steps: designing an invasion chain, a probe and an LAMP primer by taking an SNP site as a center; the method comprises the following steps: constructing a synergistic reaction system containing DNA polymerase, FEN1 enzyme, dNTPs and a buffer solution; and after reaction under isothermal conditions, SNP typing is carried out by detecting signals released by probe shearing. The method has the advantages of simplicity in operation, low equipment requirement, high reaction speed (within 40 minutes), high sensitivity, high specificity and the like, is suitable for field detection and resource limited scenes, and has good popularization and application prospects.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The present application relates to the technical field of biological detection, in particular to an isothermal detection method of SNP. BACKGROUND

[0002] Single nucleotide polymorphism (SNP) is a single base difference that occurs at a specific genomic location, is prevalent in the population, and has a frequency of more than 1%. As an important biomarker, SNPs have been widely used in many fields, including disease diagnosis and personalized medicine, resistance biological detection, animal and plant breeding, species identification, and authenticity evaluation.

[0003] Common SNP detection techniques mainly include Sanger sequencing, TaqMan probe method, high-resolution melting curve (HRM), and gene chip, etc. However, these methods have obvious limitations: Sanger sequencing is time-consuming and has low throughput; real-time fluorescent PCR methods such as TaqMan require precise thermal cyclers and professional operation; SNP chip-based methods rely on large equipment and are relatively expensive. These technologies are heavily dependent on central laboratory platforms, and it usually takes a long time from sample submission to report, which cannot meet the needs of instant decision-making. Although some point-of-care testing (POCT) devices (such as Spartan RX) have tried to solve this problem, there are still challenges such as limited detection alleles, high equipment cost, and low popularization rate, and most of them still need to be temperature-cycled, which is not truly isothermal and simple to operate, making it difficult to meet the application needs of resource-poor scenes and regions. Therefore, in the context of emergency diagnosis and treatment and primary medical care, developing new SNP detection technologies that are truly suitable for on-site, rapid, low-cost, highly specific, isothermal, and simple to operate is of great significance for improving medical quality and optimizing resource allocation.

[0004] Isothermal nucleic acid amplification techniques developed in recent years, such as loop-mediated isothermal amplification (LAMP) and recombinase polymerase amplification (RPA), have the potential for on-site application, but their SNP discrimination ability is limited. To improve their SNP recognition specificity, various typing strategies have been developed, including allele-specific primer / probe methods, blocking / competition methods, and detection methods combined with Endo IV, 20RNase H2, or CRISPR-Cas enzyme systems. However, these methods still have obvious limitations: the first few methods rely on the poor thermal stability of base pairing, and the high tolerance of DNA polymerase to mismatched base pairs, limiting the specificity of the method and complicating the optimization process; the RNase H2-based method uses RNA-containing primers, which are unstable and prone to false-positive results; the CRISPR-Cas method is limited by the stability of crRNA and the target sequence. These factors have restricted their practical application capabilities. Therefore, there is an urgent need to develop new SNP isothermal detection methods that are suitable for on-site detection, high specificity, and high sensitivity. SUMMARY

[0005] The present application provides a SNP isothermal detection method, in order to achieve this object, the system of ICR-LAMP is constructed, which is the collaborative reaction of LAMP and nucleic acid invasion cleavage reaction (ICR) in the same reaction tube. LAMP amplifies the nucleic acid template (hereinafter referred to as "template") containing SNP site, and ICR specifically detects the alleles in the amplification product of the template. Specifically, it includes the following steps:

[0006] (1) Taking SNP site as the center, designing the complementary strand of the downstream sequence of the target allele as the invasion strand, and the complementary strand of the upstream sequence of the target allele as the probe, fixing the upstream sequence of the complementary sequence of the probe on the template as the F2 or B2 region, and automatically generating other LAMP primers based on this by LAMP primer design software (such as PrimerExplorer V5, https: / / primerexplorer.eiken.co.jp / lampv5e / index.html);

[0007] (2) Constructing the ICR-LAMP collaborative reaction system with the LAMP primers, invasion strands, probes, DNA polymerase, FEN1 enzyme, dNTP and buffer designed in (1);

[0008] (3) Adding the template to be detected to the ICR-LAMP collaborative reaction system constructed in (2), and after isothermal reaction, the signal released by the specific cleavage of the probe can be detected to identify the alleles and genotype; if the signal released by the specific cleavage of the probe is detected, the SNP of the sample to be detected is the target allele; if the signal released by the specific cleavage of the probe is not detected, the SNP of the sample to be detected is the non-target allele.

[0009] The core components of the LAMP include LAMP primers and DNA polymerase (such as Bst, Bsm series DNA polymerase). The LAMP primers include inner primers, outer primers and loop primers. Two inner primers (FIP / BIP) are essential primers for the LAMP system, FIP is composed of F2 and F1C, which are complementary to F2C region and F1 region of the template, respectively, and BIP is composed of B2 and B1C, which are complementary to B2C region and B1 region of the template, respectively; two outer primers (F3 / B3) and one loop primer (LF or LB) are optional primers, which are determined according to the sensitivity and detection time requirements; the DNA polymerase catalyzes the amplification of the template by the LAMP primers under isothermal conditions.

[0010] The core components of the ICR system include an invading strand, a probe, and the FEN1 enzyme. The probe specifically recognizes and binds to the amplification product, forming a triplet structure together with the invading strand. When the SNP is the target allele, the invading strand, probe, and amplification product form a triplet overlap at the SNP site. FEN1 specifically recognizes the overlap structure, performs specific cleavage of the probe, and releases a detectable signal. When the allele is not the target allele, the invading strand, probe, and amplification product cannot form an overlap structure at the SNP site. FEN1 cannot recognize the overlap structure, cannot perform specific cleavage of the probe, and no detectable signal is released.

[0011] The ICR-LAMP system includes LAMP primers, an invading strand, a probe, DNA polymerase, FEN1 enzyme, dNTPs, and a buffer. The LAMP primer concentrations range from 0.8-1.6 μM for FIP / BIP, 0.1-0.4 μM for F3 / B3, and 0.1-0.8 μM for LF or LB. The invading strand and probe concentrations range from 0.1-0.8 μM, and the dNTP concentrations range from 0.8-1.4 mM. The amounts of DNA polymerase and FEN1 enzyme are based on the recommended dosages of commercially available enzyme products. The core components of the buffer include a pH buffer (e.g., 10-50 mM Tris-HCl, pH range 7.5-9.0) and 2-8 mM MgSO₄. 2+ Salts that provide ionic strength (such as 10-40 mM KCl) and other commonly used enhancement reagents for LAMP amplification.

[0012] The buffer solution (1×) is preferably: 20mM Tris-HCl (pH 8.4, 25℃), 25mM KCl, 5mM MgSO4.

[0013] The DNA polymerase used was, but not limited to, Bst 2.0HS DNA polymerase (catalog number: E103) from Zhuhai Baorui Biotechnology Co., Ltd., and the FEN1 enzyme was, but not limited to, NEB's thermostable FEN1 (catalog number: M0645S).

[0014] The preferred ICR-LAMP system consists of: 1× buffer, 0.8 mM dNTPs, 0.8 μM inner primer FIP / BIP, 0.2 μM outer primer F3 / B3, 0.4 μM loop primer LB or LF, 0.1 μM target allele-specific intrusive strand and probe, 0.8 U DNA polymerase, 9.6 U FEN1 enzyme, template, and water to a final volume of 10 μL.

[0015] The optimal reaction temperature of the ICR-LAMP system is consistent with the optimal activity temperature of DNA polymerase and FEN1 enzyme, preferably 58℃-70℃.

[0016] The ICR-LAMP reaction conditions used in the embodiments of the present application are all 60℃ for 1 hour. According to the results analysis, according to the template concentration, the reaction time can be controlled within 40 minutes.

[0017] The design of the length of the invasion chain and the probe should ensure that it can be stably hybridized with the template at the reaction temperature, and the melting temperature is preferably not lower than the reaction temperature, and more preferably 58-70℃.

[0018] The 3'-end base of the invasion chain is designed to be non-complementary to the target allele.

[0019] The probe includes but is not limited to fluorescent probes. When the probe is a fluorescent probe, the 5'-end is modified with a fluorescent group, and the middle is modified with a quenching group. The 5'-end can also be modified with a quenching group, and the middle is modified with a fluorescent group. The fluorescent group and the quenching group include but are not limited to FAM / TAMRA, ROX / BHQ2 used in the present application. The modification position of the quenching group on the probe is one of the first to sixth bases downstream of the allele-complementary base, preferably one of the second to fourth bases.

[0020] When the ICR-LAMP system with the probe as the fluorescent probe is used for SNP detection, when the target allele is detected, FEN1 specifically cleaves the probe, and the fluorescence signal is enhanced; when the non-target allele is detected, FEN1 cannot specifically cleave the probe, and does not cause the fluorescence signal to be enhanced.

[0021] When the ICR-LAMP system with the probe as the fluorescent probe is used for SNP genotyping, a single-probe system can be used to complete the rapid detection of SNP through one-pot, one-step isothermal reaction. After the reaction is completed, genotyping is performed by fluorescence intensity. The highest fluorescence value corresponds to the target allele homozygote, the intermediate fluorescence value corresponds to the heterozygote, and the low fluorescence value corresponds to the non-target allele homozygote. A double-probe system can also be used. A double-probe system can also be used, which requires two tubes of reaction to detect simultaneously. One tube contains a target allele-specific probe, and the other tube contains a non-target allele-specific probe. Both tubes of reaction detect fluorescence enhancement, and the genotype is the target allele homozygote. One tube of reaction detects fluorescence enhancement, and the other tube of reaction does not detect fluorescence enhancement, and the genotype is the heterozygote. Both tubes of reaction do not detect fluorescence enhancement, and the genotype is the non-target allele homozygote.

[0022] The detectable signal is not limited to fluorescence, but can also be colorimetric, chemiluminescent, electrochemical signal, etc. Correspondingly, the probe can also be designed to produce these types of signals (e.g., with enzyme labels or labels compatible with lateral flow chromatography test strips).

[0023] As used herein, the following words / terminologies have the following meanings, unless otherwise stated.

[0024] Positive strand: also called "coding strand" or "non-transcribed strand". It is the standard reference sequence given in genetic databases (e.g. GenBank). The template sequences provided in the present application are all positive strand sequences.

[0025] Negative strand: also called "template strand" or "antisense strand". It is the complementary strand of the positive strand.

[0026] Allele: in the present application, it specifically refers to different nucleotide variants (e.g. bases A, T, C or G) present at the SNP site; in the present application, the reference to the allele follows the standard naming convention in genetics, i.e. the allele is defined and named by the base on the positive strand of the reference genome, such as for a certain SNP site, the base on the positive strand is A and the base on the negative strand is T, both are described as "A allele".

[0027] Upstream sequence: the upstream sequence in the present application refers to the sequence in the 5'-end direction of the reference position.

[0028] Downstream sequence: the downstream sequence in the present application refers to the sequence in the 3'-end direction of the reference position.

[0029] Compared with the prior art, the main advantages of the present application include:

[0030] (1) By creating a new design scheme for LAMP primers, invasion strands and probes, the present application successfully realizes the synergistic work of LAMP and ICR in one reaction tube, and further realizes one-step and isothermal SNP detection. The method has high sensitivity and high specificity, and can accurately identify and genotype SNPs in low concentration templates. At present, there is no one-step isothermal SNP detection method with high sensitivity and high specificity.

[0031] (2) The detection of the target SNP can be completed in 40 minutes by one-step reaction under isothermal conditions, which is simple and rapid; the equipment requirement is simple, the portability is strong; the cost is low. It is very suitable for the development of on-site detection products, especially for the needs of resource-poor areas and scenes.

[0032] (3) Not limited to SNP detection, the method described in the present application can be used as a general nucleic acid isothermal detection method with sequence specificity, which overcomes the serious problem of non-specific amplification of LAMP amplification. BRIEF DESCRIPTION OF DRAWINGS

[0033] Figure 1 is a schematic diagram of the working principle of the specific embodiment 1 nucleic acid invasion cleavage reaction (ICR) specific SNP detection.

[0034] Figure 2 is a schematic diagram of the interaction of primers and ICR components under different spacing conditions in the specific embodiment 1.

[0035] Figure 3 is a schematic diagram of the positioning of the SNP and the ICR invading strand / probe of specific embodiment 1 (A) and (B) is a schematic diagram of the design of LAMP primers, invading strand and probe.

[0036] Figure 4 is a schematic diagram of the working principle of ICR-LAMP for SNP detection of specific embodiment 1.

[0037] Figure 5 is a graph of the results of the specificity investigation of the ICR-LAMP system of specific embodiment 3.

[0038] Figure 6 is a graph of the results of the sensitivity and genotyping ability investigation of the ICR-LAMP system of specific embodiment 4.

[0039] Figure 7 is specific embodiment 5 (A) optimization of the position of the quenching group; (B) optimization of the length of the probe flap; (C) optimization of the amount of invading strand / probe.

[0040] Figure 8 is specific embodiment 5 (A) optimization of the Mg2+concentration; (B) optimization of the KCl concentration.

[0041] Figure 9 is specific embodiment 5 (A) optimization of the amount of FEN1 enzyme; (B) optimization of the amount of Bst DNA polymerase.

[0042] Figure 10 is specific embodiment 6 ICR-LAMP system applied to one-step isothermal detection of CYP2C19*2 (rs4244285, c.681G>A).

[0043] Figure 11 is specific embodiment 7 ICR-LAMP system applied to one-step isothermal detection of MDR1 (rs1045642, c.3435C>T). DETAILED DESCRIPTION

[0044] The present application will be further described by examples in conjunction with the accompanying drawings. Those skilled in the art should understand that these examples are only used to illustrate the present application, and are not used to limit the scope of the present application.

[0045] Example 1, design scheme and working principle of the SNP isothermal detection method described in the present application

[0046] ICR is a structure-specific nucleic acid cleavage reaction, which has very high discrimination ability for single base differences. When used for SNP detection, its working principle is as shown in the accompanying Figure 1As shown: When a target allele-specific fluorescent probe is used to detect a target allele, the invading strand and the probe are complementary to the target sequence, forming a three-base overlap structure at the SNP site. FEN1 specifically recognizes this structure and then specifically cleaves the probe. When the probe is labeled with fluorescent and quenching groups, the probe releases a fluorescent signal after cleavage to report the SNP detection event (see appendix). Figure 1 A). When using a probe to detect non-target alleles, the probe is not complementary to the target sequence at the SNP site, and therefore cannot form an overlap structure, thus failing to be cleaved by FEN1 and release a fluorescent signal (see appendix). Figure 1 B). SNPs can be accurately genotyped by detecting the presence or absence of fluorescence signals. However, its fatal weakness is its extremely low sensitivity; even with cascaded amplification mechanisms, it is difficult to achieve ideal detection capabilities, and the reaction time can be as long as several hours.

[0047] ICR, leveraging the FEN1 enzyme's precise recognition of overlap structures, possesses excellent SNP specificity; LAMP, on the other hand, offers advantages such as ease of operation, low equipment dependence, and high amplification efficiency, making it ideal for on-site detection. Both have similar optimal reaction temperatures (around 60℃), theoretically allowing for the construction of an integrated isothermal detection system to synergistically enhance the specificity and sensitivity of SNP detection, meeting the demands for rapid, accurate, and on-site testing. To meet this need, previous studies have combined LAMP and ICR, generating a large number of SNP-containing amplification products, and then using ICR to achieve high-specificity SNP recognition. However, although both can react isothermally at around 60℃, the actual operation involves a two-step process: after LAMP amplification of the template, a portion of the amplification product is added to the ICR reaction system for SNP detection. This process is cumbersome, time-consuming, and the opening step can easily cause amplicon contamination (Biosensors & Bioelectronics 2017, 90, 388-393). The core contradiction lies in the fact that LAMP relies on strand displacement DNA polymerase for dynamic amplification, while ICR requires the stable formation of an overlap structure on the target sequence for static recognition and cleavage by FEN1. In a coexisting system, primer extension and strand displacement interfere with the formation and stability of the overlap structure, leading to ICR failure. Figure 2 A). To overcome this obstacle, this invention creatively proposes the concept of "spatial separation": rationally setting the spatial distance between primers and SNP sites, and ICR invading strands / probes, so that the static hybridization and cleavage process of ICR is completed before the primers extend to the invading strand, thereby avoiding the influence of primer extension and strand replacement on ICR (Figure 2B).

[0048] Appendix Figure 3Figure A illustrates the localization of the SNP and ICR invasive strand / probe: The SNP is located within the Loop II region, maximally away from the inner primer and foldback sequence in the Loop I region. This allows the invasive strand and probe sufficient time to bind to the sequences flanking the SNP site and initiate the ICR reaction before the primers extend into the Loop II region. As the LAMP amplification reaction progresses, a large number of Loop II regions are generated, providing amplified probe shearing signals for the ICR reaction, thus achieving highly sensitive and specific one-step isothermal SNP detection. Based on this localization design, the design methods for LAMP primers, invasive strands, and probes are detailed in the appendix. Figure 3 As shown in B (using the positive strand as a template): The SNP site is located between the F2 and F1 regions of the LAMP inner primer. Centered on the SNP site, the invading strand is designed as the complementary strand to the downstream sequence of the target allele, with the 3'-terminal base designed to be non-complementary to the target allele. The probe is the complementary strand to the target allele and its upstream sequence. The lengths of the invading strand and probe are designed to ensure stable binding between the invading strand, probe, and template under the reaction temperature conditions, satisfying a Tm value greater than 55℃, preferably 58℃-70℃. The upstream sequence of the probe's complementary sequence on the fixed template is the F2 region of the LAMP inner primer. Subsequently, other LAMP primers are automatically generated using the LAMP primer design software PrimerExplorer V5 (https: / / primerexplorer.eiken.co.jp / lampv5e / index.html). When the probe is a fluorescent probe, the 5'-end is modified with a fluorescent group, and the middle is modified with a quenching group. If the negative strand is used as a template, the SNP site is located between the B2 and B1 regions of the LAMP inner primer. After designing the invading strand and probe, the upstream sequence of the probe complementary sequence on the template is fixed as the B2 region of the LAMP inner primer. The rest is the same as the design method using the positive strand as a template.

[0049] Appendix Figure 4 The diagram illustrates the working principle of the ICR-LAMP probe system designed for wild-type templates to detect SNPs: When detecting wild-type templates, the probe is complementary to the target allele in the LAMP amplification product at the SNP site. The probe binds to the invading strand, forming an overlap structure at the SNP site. FEN1 recognizes this structure and specifically cleaves the probe, resulting in a significantly enhanced fluorescence signal. Conversely, when detecting mutant templates, the probe mismatches with the target allele at the SNP site, failing to form an overlap structure. The probe cannot be cleaved, thus no fluorescence signal enhancement occurs. Based on the difference in fluorescence signal, specific differentiation of SNPs can be achieved.

[0050] Example 2: Construction and Sequence Design of Artificial Plasmid Templates

[0051] Two DNA complementary sequences were artificially designed, and the two complementary sequences had a 3'-A sticky end. One of the sites was selected as a SNP site, and the site was designed to be A, T, C, and G four bases, simulating four alleles. Subsequently, a plasmid template simulating four genotypes was constructed with pEASY-T1 as the carrier. The sequence design was performed by using the LAMP primer, invasion chain, and probe design method described in Example 1. The sequence information is as follows:

[0052] Template sequence (LAMP amplification fragment): The underlined part is the artificially designed sequence inserted into the vector, and the two sides are the vector sequences. A allele template (SEQ ID NO. 1, 5'-3'):

[0053] TAGTAACGGCCGCCAGTGTGCTGGAATTGCCCTT GAAAAGCTGGTGAGTGGATCGTTTG

[0054] AAGCAAAAAGAGTATACAATCCTGTTGATTACGA AAGGGCAATTCTGCAGATATCCATCA

[0055] CACTGGCGGCCGCTCGAGCATGCATCTAGAGGGCCCAATTCGCCCTATAGTGAGTCGTAT

[0056] TACAATTCACTGGCCGTCGTTTTACAACGTCGTGACTGGGAAAACCCTT allele template (SEQ ID NO. 2, 5'-3'):

[0057] TAGTAACGGCCGCCAGTGTGCTGGAATTGCCCTT GAAAAGCTGGTGAGTGGATCGTTTG

[0058] AAGCAAATAGAGTATACAATCCTGTTGATTACGA AAGGGCAATTCTGCAGATATCCATCA

[0059] CACTGGCGGCCGCTCGAGCATGCATCTAGAGGGCCCAATTCGCCCTATAGTGAGTCGTAT

[0060] TACAATTCACTGGCCGTCGTTTTACAACGTCGTGACTGGGAAAACCCTC allele template (SEQ ID NO. 3, 5'-3'):

[0061] TAGTAACGGCCGCCAGTGTGCTGGAATTGCCCTT GAAAAGCTGGTGAGTGGATCGTTTG

[0062] AAGCAAACAGAGTATACAATCCTGTTGATTACGAAAGGGCAATTCTGCAGATATCCATCA

[0063] CACTGGCGGCCGCTCGAGCATGCATCTAGAGGGCCCAATTCGCCCTATAGTGAGTCGTAT

[0064] TACAATTCACTGGCCGTCGTTTTACAACGTCGTGACTGGGAAAACCCTG allele template (SEQ ID NO. 4, 5'-3'):

[0065] TAGTAACGGCCGCCAGTGTGCTGGAATTGCCCTT GAAAAGCTGGTGAGTGGATCGTTTG

[0066] AAGCAAAGAGAGTATACAATCCTGTTGATTACGA AAGGGCAATTCTGCAGATATCCATCA

[0067] CACTGGCGGCCGCTCGAGCATGCATCTAGAGGGCCCAATTCGCCCTATAGTGAGTCGTAT

[0068] TACAATTCACTGGCCGTCGTTTTACAACGTCGTGACTGGGAAAACCCTLAMP primer sequence:

[0069] Outer primer PF3 (SEQ ID NO.5, 5'-3'):

[0070] TAGTAACGGCCGCCAGTG

[0071] Outer primer PB3 (SEQ ID NO.6, 5'-3'):

[0072] AGGGTTTTCCCAGTCACGA

[0073] Inner primer PFIP (SEQ ID NO.7, 5'-3'):

[0074] TTGCCCTTTCGTAATCAACA TGGAATTGCCCTTGAAAAG

[0075] Inner primer PBIP (SEQ ID NO.8, 5'-3'):

[0076] GCCGCTCGAGCATGCATCTA AAAACGACGGCCAGTGAAT

[0077] Loop primer PLB (SEQ ID NO. 9, 5'-3'):

[0078] GGCCCAATTCGCCCTATA

[0079] Invader strand sequence: 3'-terminal green base is not complementary to the target allele, forms an overlap structure with the probe and the target allele.

[0080] Invader strand sequence common to allele A, allele T, allele G template IvG (SEQ ID NO. 10, 5'-3'): TCGTAATCAACAGGATTGTATACTCTG

[0081] Invader strand sequence specific to allele C IvC (SEQ ID NO. 11, 5'-3'):

[0082] TCGTAATCAACAGGATTGTATACTCTC

[0083] Probe sequence: red base is the base complementary to the target allele on the probe

[0084] Probe sequence specific to allele A PPbA (SEQ ID NO. 12, 5'-3'):

[0085] FAM-TCAGTT / iTAMdT / TGCTTCAAACGATCCACTCACCAGCTTTTCGA

[0086] Probe sequence specific to allele T PPbT (SEQ ID NO. 13, 5'-3'):

[0087] FAM-TCAGAT / iTAMdT / TGCTTCAAACGATCCACTCACCAGCTTTTCGA

[0088] Probe sequence specific to allele C PPbC (SEQ ID NO. 14, 5'-3'):

[0089] FAM-TCAGGT / iTAMdT / TGCTTCAAACGATCCACTCACCAGCTTTTCGA

[0090] Probe sequence specific to allele G PPbG (SEQ ID NO. 15, 5'-3'):

[0091] FAM-TCAGCT / iTAMdT / TGCTTCAAACGATCCACTCACCAGCTTTTCGA

[0092] Example 3, ICR-LAMP detection system specificity investigation

[0093] The LAMP primers designed in Example 2 and the invasion strands and probes corresponding to the A, T, C, and G four alleles were used to construct four allele-specific ICR-LAMP detection systems (10 μL) as follows:

[0094] (1) A allele-specific ICR-LAMP detection system: 1x buffer, 0.8 mM dNTPs, 0.8 μM PFIP / PBIP, 0.2 μM PF3 / PB3, 0.4 μM PLB, 0.1 μM PIvG, 0.1 μM PPbA, 0.8 U DNA polymerase, 16 U FEN1 enzyme, add template, and make up to 10 μL with water.

[0095] (2) T allele-specific ICR-LAMP detection system: 1x buffer, 0.8 mM dNTPs, 0.8 μM PFIP / PBIP, 0.2 μM PF3 / PB3, 0.4 μM PLB, 0.1 μM PIvG, 0.1 μM PPbT, 0.8 U DNA polymerase, 9.6 U FEN1 enzyme, add template, and make up to 10 μL with water.

[0096] (3) C allele-specific ICR-LAMP detection system: 1x buffer, 0.8 mM dNTPs, 0.8 μM PFIP / PBIP, 0.2 μM PF3 / PB3, 0.4 μM PLB, 0.1 μM PIvC, 0.1 μM PPbC, 0.8 U DNA polymerase, 9.6 U FEN1 enzyme, add template, and make up to 10 μL with water.

[0097] (4) G allele-specific ICR-LAMP detection system: 1x buffer, 0.8 mM dNTPs, 0.8 μM PFIP / PBIP, 0.2 μM PF3 / PB3, 0.4 μM PLB, 0.1 μM PIvG, 0.1 μM PPbG, 0.8 U DNA polymerase, 9.6 U FEN1 enzyme, add template, and make up to 10 μL with water.

[0098] The four allele-specific ICR-LAMP detection systems described above were used to detect the four allele templates, and the final concentration of the template was 1x10 5 copies / μL, and the reaction was carried out at 60°C for 1 hour. The real-time fluorescence quantification curve was collected, and the specificity of each system was investigated. The results are shown in the accompanying Figure 5 figure. Only when the target allele was detected could a significantly enhanced fluorescence signal be obtained, and when a non-target allele was detected, the fluorescence signal was very low, which was the background signal produced by the hybridization and stretching of the probe and the template.

[0099] The preferred buffer solution in Example 1 of this invention is: 20mM Tris-HCl (pH 8.4), 25mM KCl, and 5mM MgSO4.

[0100] The DNA polymerase used in the embodiments of the present invention is, but is not limited to, Bst2.0HS DNA polymerase (catalog number: E103) from Zhuhai Baorui Biotechnology Co., Ltd., and the FEN1 enzyme is, but is not limited to, NEB's thermostable FEN1 (catalog number: M0645S).

[0101] In all embodiments of the present invention, the reaction conditions were 60°C for 1 hour.

[0102] Unless otherwise specified, in the embodiments of this invention using artificially synthesized plasmids as templates, the template concentration in the ICR-LAMP system is 1×10⁻⁶. 5 Copy / μL.

[0103] Example 4: Sensitivity and typing capability of the ICR-LAMP detection system

[0104] The A allele template constructed in Example 2 simulated wild-type homozygotes, the G allele template simulated mutant homozygotes, and an equal mixture of A and G allele templates simulated heterozygotes. The template stock solutions of the three genotypes were serially diluted to prepare samples with a concentration of 10... 6 10 5 10 4 10 3 10 2 Template copies / μL were used. The A allele-specific detection system and G allele-specific detection system constructed in Example 2 were used to detect the serially diluted templates of the three genotypes. The results are shown in the appendix. Figure 6 As shown, both systems detected a final concentration of 10 copies / μL for all three genotypes. Furthermore, a single probe system can directly distinguish the three genotypes based on fluorescence intensity: the highest fluorescence corresponds to homozygous target alleles, medium fluorescence to heterozygous alleles, and the lowest fluorescence to homozygous non-target alleles. This method requires only one reaction tube, one probe, and one isothermal step, making it simple, rapid, and low-cost.

[0105] Example 5: Optimization of ICR-LAMP Detection System Conditions

[0106] (1) Modification site of quenching group

[0107] Four probes were designed based on the A allele template constructed in Example 2. Quenching groups were modified onto the 1st, 2nd, 3rd, and 6th bases downstream of the base (red T) complementary to the target allele on the probes, as shown in the following sequences:

[0108] PbAQ1 (SEQ ID NO.16, 5'-3'): The quenching group is located at the first base downstream of T.

[0109] FAM-TTGCTCAGT / iTAMdT / TTGCTTCAAACGATCCACTCACCAGCTTTTCGA

[0110] PbAQ2 (SEQ ID NO.17, 5'-3'): The quenching group is located at the second base downstream of T.

[0111] FAM-TTGCTCAGTT / iTAMdT / TGCTTCAAACGATCCACTCACCAGCTTTTCGA

[0112] PbAQ3 (SEQ ID NO.18, 5'-3'): The quenching group is located 3 bases downstream of T.

[0113] FAM-TTGCTCAGTTTT / iTAMdT / GCTTCAAACGATCCACTCACCAGCTTTTCGA

[0114] PbAQ6 (SEQ ID NO.19, 5'-3'): The quenching group is located 6 bases downstream of T.

[0115] FAM-TTGCTCAGTTTTGC / iTAMdT / TCAAACGATCCACTCACCAGCTTTTCGA

[0116] The probes in the A allele-specific detection system constructed in Example 2 were replaced with the four probes described above, and the A allele template (wild type, W) and the G allele template (mutant, M) were detected respectively. The results are shown in the appendix. Figure 7 As shown in Figure A, the quencher group modification exhibits significant differentiation at all four positions, with RFU being the most prominent. W / RFU M Based on the value (the ratio of the highest fluorescence value of the wild-type template system to the highest fluorescence value of the mutant template system), the quenching groups modified at the 2nd and 3rd bases are preferred.

[0117] (2) Length of the Flap sequence at the 5' end of the probe

[0118] Three probes were designed based on the A allele template constructed in Example 2. Flap sequences of 2, 4, and 6 bases respectively were designed at the 5' end of the red T (the bases on the probe that are complementary to the target allele). The probe sequences are as follows:

[0119] PbAQ2 (SEQ ID NO.17, 5'-3'): Flap length is 8nt

[0120] FAM-TTGCTCAGTT / iTAMdT / TGCTTCAAACGATCCACTCACCAGCTTTTCGA

[0121] PbAF6 (SEQ ID NO. 19, 5'-3'): flap length is 6 nt

[0122] FAM-GCTCAGTT / iTAMdT / TGCTTCAAACGATCCACTCACCAGCTTTTCGA

[0123] PbA (SEQ ID NO. 12, 5'-3'): flap length is 4 nt

[0124] FAM-TCAGTT / iTAMdT / TGCTTCAAACGATCCACTCACCAGCTTTTCGA

[0125] PbAF2 (SEQ ID NO. 20, 5'-3'): flap length is 2 nt

[0126] FAM-AGTT / iTAMdT / TGCTTCAAACGATCCACTCACCAGCTTTTCGA

[0127] The probes in the A allele-specific detection system constructed in Example 2 were replaced by the above four probes, and the A allele template (wild type, W) and the G allele template (mutant, M) were detected, respectively, and the results are shown in FIG. B. It can be seen that the probes with different lengths of flaps can produce detectable significant fluorescence difference, and the RFU Figure 7 B. The RFU W / RFU M value as the basis, and the flap length of 4 nt is preferred.

[0128] (3) Invader strand and probe amount

[0129] Based on the A allele-specific detection system constructed in Example 2 (the amount of invader strand and probe is 0.1 μM), the amount of invader strand and probe was further increased to 0.3 μM, 0.5 μM. The A allele template (wild type, W) and the G allele template (mutant, M) were detected by three systems, respectively, and the results are shown in FIG. C. It can be seen that there are significant fluorescence differences in three groups of reactions, and when the amount of invader strand and probe is increased to 0.5 μM, compared with the 0.3 μM system, the fluorescence discrimination effect does not have significant gain. Therefore, the amount of invader strand and probe can be preferably 0.3 μM. But considering the cost, the amount of invader strand and probe is actually selected to be 0.1 μM. Figure 7 ​

[0130] (4) Mg 2+ concentration and KCl concentration

[0131] Based on the A allele specific detection system constructed in Example 2, the effects of Mg 2+ concentrations of 4 mM, 5 mM, and 6 mM on the discrimination of A allele templates (wild type, W) and G allele templates (mutant type, M) were investigated, and the results are shown in FIG. 2A. As can be seen, all three Mg Figure 8 concentrations can significantly discriminate the SNP, but as the Mg 2+ concentration increases, the time at which exponential amplification begins is later, 5 mM Mg 2+ achieves the highest fluorescence value. Taking into account the exponential amplification efficiency and cost, 5 mM Mg 2+ is preferred. 2+ Based on the A allele specific detection system constructed in Example 2, the effects of KCl concentrations of 15 mM, 25 mM, and 35 mM on the discrimination of A allele templates (wild type, W) and G allele templates (mutant type, M) were investigated, and the results are shown in FIG. 2B. As can be seen, when KCl is increased to 35 mM, the fluorescence value of the target allele is significantly reduced, and the difference from the background fluorescence value of the non-target allele is reduced. In comparison, when KCl is 15 mM or 25 mM, both can significantly discriminate the SNP, and KCl 25 mM is preferred as the actual concentration. Figure 8

[0132] (5) FEN1 enzyme amount, DNA polymerase

[0133] Based on the A allele specific detection system constructed in Example 2, the effects of FEN1 enzyme amounts of 3.2 U, 9.6 U, and 16 U on the discrimination of A allele templates (wild type, W) and G allele templates (mutant type, M) were investigated, and the results are shown in FIG. 3A. All three enzyme amounts can achieve significant discrimination effects, but when the enzyme amount is 16 U, there is no significant gain compared to 9.6 U enzyme amount; when the enzyme amount is 3.2 U, the exponential amplification efficiency is significantly reduced, and it takes a long time for the fluorescence value to reach the plateau. Taking into account the exponential amplification efficiency and cost, 9.6 U FEN1 enzyme amount is preferred. Figure 9 Based on the A allele specific detection system constructed in Example 2, the effects of Bst2.0 HSDNA polymerase amounts of 0.8 U, 1.2 U, 1.6 U, and 2.4 U on the discrimination of A allele templates (wild type, W) and G allele templates (mutant type, M) were investigated, and the results are shown in FIG. 3B. Except for the enzyme amount of 2.4 U, which significantly reduces the plateau fluorescence value, the effects of the other three enzyme amounts are not significantly different, and the lowest enzyme amount of 0.8 U is preferred.

[0134] Figure 9

[0135] ​​​Example 6, ICR-LAMP system applied to one-step isothermal detection of CYP2C19*2 (rs4244285, c.681G>A) SNP related to Clopidogrel drug metabolism

[0136] The CYP2C19*2 (rs4244285, c.681G>A) reference sequence was retrieved from the GenBank database, and the LAMP primer, invasion chain, and probe sequence were designed using the design method described in Example 1 with the negative strand as the template. The sequence information is as follows: LAMP amplification fragment: red base is allele

[0137] Wild-type C19*2W (SEQ ID NO. 21, 5'-3'):

[0138] GTCAGAATTTTCTTTCTCAAATCTTGTATAATCAGAGAATTACTACACATGTACAATAAAAATTTCCCCATCAAGATATACAATATATTTTATTTATATTTATAGTTTTAAATTACAACCAGAGCTTGGCATATTGTATCTATACCTTTATTAAATGCTTTTAATTTAATAAATTATTGTTTTCTCTTAGATATGCAATAATTTTCCCACTATCATTGATTATTTCCCGGGAACCCATAACAAATTACTTAAAAACCTTGCTTTTATGGAAAGTGATATTTTGGAGAAAGTAAAAGAACACCAAGAATCG

[0139] Mutant C19*2M (SEQ ID NO. 22, 5'-3'):

[0140] GTCAGAATTTTCTTTCTCAAATCTTGTATAATCAGAGAATTACTACACATGTACAATAAAAATTTCCCCATCAAGATATACAATATATTTTATTTATATTTATAGTTTTAAATTACAACCAGAGCTTGGCATATTGTATCTATACCTTTATTAAATGCTTTTAATTTAATAAATTATTGTTTTCTCTTAGATATGCAATAATTTTCCCACTATCATTGATTATTTCCCAGGAACCCATAACAAATTACTTAAAAACCTTGCTTTTATGGAAAGTGATATTTTGGAGAAAGTAAAAGAACACCAAGAATCG

[0141] LAMP primers

[0142] Outer primer CF3 (SEQ ID NO. 23, 5'-3'):

[0143] GTCAGAATTTTCTTTCTCAA

[0144] Outer primer CB3 (SEQ ID NO. 24, 5'-3'):

[0145] CGATTCTTGGTGTTCTT

[0146] Inner primer CFIP (SEQ ID NO. 25, 5'-3'):

[0147] TGCCAAGCTCTGGTTGTAATTTAAAACTATCTTGTATAATCAGAGAATTACTACACATG

[0148] Inner primer CBIP (SEQ ID NO. 26, 5'-3'):

[0149] GTTTTCTCTTAGATATGCAATAATTTTCCCTTCTCCAAAATATCACTTTCCATAAAA

[0150] Loop primer CLF (SEQ ID NO. 27, 5'-3'):

[0151] CTTGATGGGGAAATTTTTATTGT

[0152] Invading strand CIvT (SEQ ID NO. 28, 5'-3'):

[0153] GCAATAATTTTCCCACTATCATTGATTATTTCCCT

[0154] Probe

[0155] G allele-specific probe CPbG (SEQ ID NO. 29, 5'-3'):

[0156] ROX-AAAGGGGAA / iBHQ2dT / CCATAACAAATTACTTAAAAACCTTGC

[0157] A allele-specific probe CPbA (SEQ ID NO. 30, 5'-3'):

[0158] ROX- AAAGAGGAA / iBHQ2dT / CCATAACAAATTACTTAAAAACCTTGC

[0159] Based on the allele-specific detection system constructed in Example 2, the LAMP primers, invasion strands and probes were replaced by CYP2C19*2 (rs4244285, c.681G>A) specific sequences to construct G allele-specific detection system and A allele-specific detection system, respectively.

[0160] G allele-specific detection system: 1x buffer, 0.8 mM dNTPs, 0.8 μΜ CFIP / CBIP, 0.2 μΜ CF3 / CB3, 0.4 μΜ CLF, 0.1 μΜ CIvG, 0.1 μΜ CPbG, 0.8 U DNA polymerase, 9.6 U FEN1 enzyme, 10 ng human saliva genomic DNA was added, and water was added to 10 μL.

[0161] A allele-specific detection system: 1x buffer, 0.8 mM dNTPs, 0.8 μΜ CFIP / CBIP, 0.2 μΜ CF3 / CB3, 0.4 μΜ CLF, 0.1 μΜ CIvT, 0.1 μΜ CPbA, 0.8 U DNA polymerase, 9.6 U FEN1 enzyme, 10 ng human saliva genomic DNA was added, and water was added to 10 μL.

[0162] The above G allele-specific detection system and A allele-specific detection system were used to detect three genotypes of human saliva genomic DNA, and the results are shown in Figures 1A and 1B. Figure 10 A shows significant specificity, and can be genotyped by a single probe system according to fluorescence intensity.

[0163] The G allele-specific detection system was used to detect 13 samples of human saliva genomic DNA, and the results are shown in Figure 2A. Figure 10 B shows that the fluorescence intensity is clustered into three clusters, corresponding to three genotypes, which are completely consistent with the genotypes identified by sequencing, fully demonstrating the accuracy and reliability of the method.

[0164] Example 7, ICR-LAMP system applied to one-step isothermal detection of SNP MDR1 (rs1045642, c.3435C>T) related to clopidogrel drug metabolism

[0165] The MDR1 (rs1045642, c.3435C>T) reference sequence was retrieved from the GenBank database, and the LAMP primers, invasion strands and probes were designed according to the design method described in Example 1 using the positive strand as the template. The sequence information is as follows: LAMP amplification fragment: red base is allele

[0166] Wild-type MDRW (SEQ ID NO. 31, 5'-3'):

[0167] GTTTGACTGCAGCATTGCTGAGAACATTGCCTATGGAGACAACAGCCGGGTGGTGTCAC

[0168] AGGAAGAGATCGTGAGGGCAGCAAAGGAGGCCAACATACATGCCTTCATCGAGTCACT

[0169] GCCTAATGTAAGTCTCTCTTCAAATAAACAGCCTGGGAGCATGTGGCAGCCTCTCTGGCC

[0170] TATAGTTTGATTTATAAGGGGCTGGTCTCCCAGAAGTGAAGAGAAATTAGCAACCAAATC

[0171] ACACCCTTAC

[0172] Mutant MDRM (SEQ ID NO. 32, 5'-3'):

[0173] GTTTGACTGCAGCATTGCTGAGAACATTGCCTATGGAGACAACAGCCGGGTGGTGTCAC

[0174] AGGAAGAGATTGTGAGGGCAGCAAAGGAGGCCAACATACATGCCTTCATCGAGTCACT

[0175] GCCTAATGTAAGTCTCTCTTCAAATAAACAGCCTGGGAGCATGTGGCAGCCTCTCTGGCC

[0176] TATAGTTTGATTTATAAGGGGCTGGTCTCCCAGAAGTGAAGAGAAATTAGCAACCAAATC

[0177] ACACCCTTACLAMP primer

[0178] Outer primer MF3 (SEQ ID NO. 33, 5'-3'):

[0179] GTTTGACTGCAGCATT

[0180] Outer primer MB3 (SEQ ID NO. 34, 5'-3'):

[0181] GTAAGGGTGTGATTTGGTT

[0182] Inner primer MFIP (SEQ ID NO. 35, 5'-3'):

[0183] GAAGGCATGTATGTTGGCCT CATTGCCTATGGAGACAACAGC

[0184] Inner primer MBIP (SEQ ID NO. 36, 5'-3'):

[0185] GAGTCACTGCCTAATGTAAGTCTCTCTTCA TCTTCACTTCTGGGAGACCA

[0186] Loop primer MLB (SEQ ID NO. 37, 5'-3'):

[0187] ACAGCCTGGGAGCATGTG

[0188] Invader strand MIvT (SEQ ID NO. 38, 5'-3'):

[0189] CCTCCTTTGCTGCCCTCACT

[0190] Probe

[0191] C allele-specific probe MPbC (SEQ ID NO. 39, 5'-3'):

[0192] FAM-AATAGATC / iTAMdT / CTTCCTGTGACACCACCCGG

[0193] T allele-specific probe MPbT (SEQ ID NO. 40, 5'-3'):

[0194] FAM-AATAAATC / iTAMdT / CTTCCTGTGACACCACCCGG

[0195] Based on the allele-specific detection system constructed in Example 2, the LAMP primers, invader strand and probe were replaced by the sequences specific to MDR1 (rs1045642, c.3435C>T), and C allele-specific detection system and T allele-specific detection system were constructed, respectively.

[0196] C allele-specific detection system: 1x buffer, 0.8 mM dNTPs, 0.8 μM MFIP / MBIP, 0.2 μM MF3 / MB3, 0.4 μM MLB, 0.1 μM MIvT, 0.1 μM MPbC, 0.8 U DNA polymerase, 9.6 U FEN1 enzyme, 10 ng human saliva genomic DNA was added, and water was added to 10 μL.

[0197] T allele-specific detection system: 1x buffer, 0.8 mM dNTPs, 0.8 μM MFIP / MBIP, 0.2 μM MF3 / MB3, 0.4 μM MLB, 0.1 μM MIvT, 0.1 μM MPbT, 0.8 U DNA polymerase, 9.6 U FEN1 enzyme, 10 ng human saliva genomic DNA was added, and water was added to 10 μL.

[0198] The above C allele-specific detection system and T allele-specific detection system were used to detect three genotypes of human saliva genomic DNA, and the results are shown in Figures 1A and 1B. Figure 11 As shown in Figures 1A and 1B, significant specificity was exhibited, and genotyping could be performed by a single probe system according to fluorescence intensity.

[0199] The C allele-specific detection system was used to detect 13 samples of human saliva genomic DNA, and the results are shown in Figure 2B. According to fluorescence intensity, three clusters were formed, corresponding to three genotypes, respectively, which were completely consistent with the genotypes identified by sequencing, fully demonstrating the accuracy and reliability of the method. Figure 11 As shown in Figures 1A and 1B, significant specificity was exhibited, and genotyping could be performed by a single probe system according to fluorescence intensity.

Claims

1. A SNP isothermal detection method, characterized in that, The method comprises the following steps: (1) providing an ICR-LAMP synergistic reaction system, which comprises LAMP primers, an invasion strand, a probe, an isothermal DNA polymerase, a FEN1 enzyme, dNTPs, and a buffer; (2) adding a sample to be tested as a template into the ICR-LAMP synergistic reaction system to perform isothermal amplification reaction; (3) performing allele identification and genotyping by detecting whether the probe is cleaved to release a signal; In the step (1), the design method of the LAMP primers, the invasion strand, and the probe comprises: taking the SNP site as the center, designing the invasion strand as the complementary strand of the downstream sequence of the target allele, and the 3'-end base of the invasion strand is not complementary to the target allele; designing the probe as the complementary strand of the target allele and the upstream sequence thereof; fixing the upstream sequence of the probe complementary sequence on the template as the F2 region or the B2 region of the LAMP inner primer, and generating a complete LAMP primer set accordingly.

2. The method of claim 1, wherein, The probe is a signal probe, preferably a fluorescent probe.

3. The method according to claim 1 or 2, characterized in that, The 5'-end of the fluorescent probe is modified with a fluorescent reporter group, and the middle region is modified with a quenching group; the modification position of the quenching group is located at the 1st to 6th nucleotides downstream of the base complementary to the target allele on the probe, preferably the 2nd to 4th nucleotides. In the ICR-LAMP synergistic reaction system, the concentration ranges of the components are as follows:

4. The method of claim 1, wherein, LAMP inner primer FIP / BIP: 0.8-1.6 μM; LAMP outer primer F3 / B3: 0.1-0.4 μM; LAMP loop primer LF or LB: 0.1-0.8 μM; Invasion strand and probe: 0.1-0.8 μM; dNTPs: 0.8-1.4 mM. The buffer comprises:

5. The method of claim 1, wherein, a pH buffer with a concentration of 10-50 mM and a pH range of 7.5-9.0; a salt for providing ionic strength with a concentration of 10-40 mM; and Mg 2+ at a concentration of 2-8 mM; optionally, other LAMP amplification commonly used enhancers. The buffer is 20 mM Tris-HCl (pH 8.4), 25 mM KCl, and 5 mM MgSO4.

6. The method of claim 5, wherein, The temperature of the isothermal amplification reaction is 58-70°C, preferably 60°C; and the reaction time is 10-60 minutes, preferably 20-40 minutes.

7. The method of claim 1, wherein, In the step (3), a single-probe system is used for genotyping, and the genotypes are distinguished by the intensity of the end-point fluorescent signal: the highest fluorescent intensity corresponds to the homozygote of the target allele, the intermediate fluorescent intensity corresponds to the heterozygote, and the lowest fluorescent intensity corresponds to the homozygote of the non-target allele.

8. The method of claim 1, wherein, In the step (3), a double-probe system is used for genotyping, and two tubes of reaction are used for simultaneous detection, one containing a target allele-specific probe and the other containing a non-target allele-specific probe, and the genotypes are judged by the combination of the signals in the two tubes of reaction.

9. The method of claim 1, wherein, ​ 10. A kit for SNP allele detection, characterized by, A kit comprising components for carrying out the method of any one of claims 1-9. A kit comprising components for carrying out the method of any one of claims 1-9.