Application of acetylene cytidine in preparation of medicine for resisting porcine epidemic diarrhea virus
By inhibiting the -1 ribosomal frameshift process of PEDV with acetylsalicylate and blocking RNA synthesis, an antiviral drug insensitive to PEDV variants was developed, solving the problem of difficulty in inhibiting PEDV variants in existing technologies and achieving effective inhibition and prevention of multiple genotypes of the virus.
Patent Information
- Application Number
- CN202511807022.3
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-12-03
- Publication Date
- 2026-02-03
AI Technical Summary
Existing technologies are insufficient to effectively suppress variants of porcine epidemic diarrhea virus (PEDV), leading to increased difficulty in prevention and control, and existing vaccines face the challenge of high mutation rates.
Using ethynylcytidine as a nucleoside analog, an antiviral drug against porcine epidemic diarrhea virus (PEDV) was developed by inhibiting the -1 ribosomal frameshift process of PEDV and blocking RNA synthesis.
Ethynylcytidine has a significant inhibitory effect on multiple genotypes of PEDV, especially on the G1a, G1b, G2a, G2b and G2c subgroups. It is not sensitive to viral mutations and can effectively inhibit viral replication and proliferation. It can be used to prepare drugs for the treatment and prevention of porcine epidemic diarrhea.
Smart Images
Figure CN121445756A_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The application belongs to the field of chemical medicine, and particularly relates to application of ethynylcytidine in preparation of a medicine for resisting porcine epidemic diarrhea virus. BACKGROUND
[0002] Porcine epidemic diarrhea virus (PEDV) is a highly infectious coronavirus belonging to the alpha genus of the Coronaviridae family, which mainly infects pigs, especially newborn piglets. The mortality rate of newborn piglets after infection is extremely high, and it often brings huge economic losses to the breeding industry. The genome of PEDV is a single-stranded positive-sense RNA of about 28 kb, which encodes various structural proteins and non-structural proteins. In recent years, PEDV has continuously emerged in variant strains, and the pathogenicity and transmission ability of some strains have significantly increased, making it more difficult to prevent and control. At present, the research on PEDV mainly focuses on viral receptor recognition, immune escape mechanism and vaccine development. Although some candidate vaccines have entered the experimental stage, the high mutation rate of the virus is still the main challenge for prevention and control. Therefore, it is urgent to develop an antiviral drug that is not sensitive to virus variation. SUMMARY
[0003] In view of the above problems in the prior art, the purpose of the present application is to provide application of ethynylcytidine in preparation of a medicine for resisting porcine epidemic diarrhea virus.
[0004] The technical scheme adopted by the present application is as follows:
[0005] Application of ethynylcytidine in preparation of a medicine for resisting porcine epidemic diarrhea virus.
[0006] Ethynylcytidine is a nucleoside analogue that blocks RNA synthesis by inhibiting RNA polymerase and shows anti-tumor activity in various cancer models.
[0007] The molecular formula of ethynylcytidine is: 11 H 13 N3O5;
[0008] The structural formula of ethynylcytidine is:
[0009]
[0010] In an embodiment of the present application, the medicine is a medicine for preventing and / or treating porcine epidemic diarrhea disease caused by porcine epidemic diarrhea virus infection.
[0011] In an embodiment of the present application, the medicine is a medicine for inhibiting replication of porcine epidemic diarrhea virus.
[0012] In an embodiment of the present application, the medicine is a medicine for inhibiting proliferation of porcine epidemic diarrhea virus.
[0013] In an embodiment of the present application, the porcine epidemic diarrhea virus includes one or more genotypes of G1a, G1b, G2a, G2b, and G2c.
[0014] In an embodiment of the present application, the drug includes ethynylcytidine and a pharmaceutically acceptable excipient.
[0015] In an embodiment of the present application, the ethynylcytidine inhibits the replication, proliferation, or prevention of porcine epidemic diarrhea virus by inhibiting the -1 ribosomal frameshifting process of the porcine epidemic diarrhea virus.
[0016] In an embodiment of the present application, the drug is an oral preparation or an injection.
[0017] Compared with the prior art, the present application has the following beneficial effects:
[0018] There is a ribosomal frameshifting element in the middle of the open reading frame 1 (ORF1) of the PEDV genome, and the virus precisely regulates the expression of the genes in the rear part of the ORF1 through the element, and these genes contain the key component RdRP (RNA-dependent RNA polymerase) of the virus replication complex. Inhibiting ribosomal frameshifting can effectively prevent the amplification of PEDV, so the ribosomal frameshifting element is an ideal target for small molecule drugs, and the ribosomal frameshifting element has the characteristics of low mutation rate, so the inhibitors targeting the element are not sensitive to mutations.
[0019] The present application finds a new use of ethynylcytidine in inhibiting PEDV. Experiments prove that ethynylcytidine has a significant inhibitory and blocking effect on the -1 ribosomal frameshifting process of PEDV, can effectively inhibit the replication of PEDV, and further inhibit the proliferation of PEDV; and it has an inhibitory effect on various genotypes of PEDV, that is, the process of ethynylcytidine inhibiting the proliferation of PEDV is not sensitive to the mutation of PEDV. Therefore, ethynylcytidine can be used for treating and preventing porcine epidemic diarrhea disease caused by PEDV infection, for preparing an anti-PEDV drug, and for preparing a drug for treating and preventing porcine epidemic diarrhea disease caused by PEDV infection, which is a broad-spectrum antiviral drug, not sensitive to the mutation of PEDV, and has a good application prospect.
[0020] PEDV is mainly divided into two genotypes: G1 (classical strain) and G2 (variant strain). Among them, G1 type is further divided into G1a and G1b two subgroups, and G2 type is divided into G2a, G2b and G2c three subgroups. The ethynyl cytidine discovered in the application has a very significant inhibitory effect on the five subgroups of PEDV strains (G1a, G1b, G2a, G2b and G2c). BRIEF DESCRIPTION OF DRAWINGS
[0021] In order to more clearly illustrate the technical solutions of the embodiments of the present application or the prior art, the drawings needed to be used in the embodiment or prior art description will be briefly introduced below.
[0022] Figure 1 The design principle schematic diagram (a), experimental process schematic diagram (b) and experimental results (c) of ethynyl cytidine inhibiting PEDV ribosome frameshifting process in luciferase reporter system.
[0023] Figure 2 The design principle schematic diagram (a), experimental process schematic diagram (b) and experimental results (c) of ethynyl cytidine inhibiting PEDV ribosome frameshifting process in fluorescent protein reporter system.
[0024] Figure 3 The experimental results of different concentrations of ethynyl cytidine on the toxicity of Vero cells and the antiviral activity of PEDV in cells.
[0025] Figure 4 The experimental results of ethynyl cytidine on the inhibition effect of Vero cell CPE (cytopathic effect) caused by PEDV G2c strain.
[0026] Figure 5 The antiviral experimental results of ethynyl cytidine on PEDV (G1a, G1b, G2a, G2b, G2c strains) detected by RT-PCR.
[0027] Figure 6 The antiviral experimental results of ethynyl cytidine on PEDV in vivo. DETAILED DESCRIPTION
[0028] In the following, only certain exemplary embodiments are simply described. As those skilled in the art can recognize, the described embodiments can be modified in various different ways without departing from the spirit or scope of the present application. Therefore, the drawings and the description are considered to be exemplary in nature rather than limiting.
[0029] Embodiment 1
[0030] Evaluation of the inhibitory effect of ethynylcytidine on the -1 Ribosomal Frameshifting process of PEDV (luciferase reporter system).
[0031] 1. Experimental method
[0032] The inhibitory effect of ethynylcytidine on the -1 Ribosomal Frameshifting process of PEDV was studied using in vitro cultured cells. First, a dual luciferase reporter gene lentivirus vector containing the PEDV viral genome slippage sequence was constructed, and the effect of the drug was detected in the pig kidney cell line PK15. The initial screening concentration of the drug was 10 μM.
[0033] 1.1. Luciferase reporter gene vector construction
[0034] (1) Synthesize the PEDV virus -1 Ribosomal Frameshift slippage region gene sequence (synthesize 5 strains of frameshift elements: G1a, G1b, G2a, G2b, G2c, respectively). Double enzyme digestion was performed on the lentivirus backbone vector, and the enzyme digestion site was selected as EcoRI + BamHI. The enzyme digestion conditions were 37°C for 15 minutes. After enzyme digestion, the enzyme digestion product was recovered by nucleic acid electrophoresis. For the synthesized PEDV virus -1 Ribosomal Frameshift slippage region gene sequence, first denature at 95°C for 10 minutes, then anneal at 72°C for 30 seconds. Then mix the annealing product with the enzyme digestion product at a ratio of 3:1, and add 10 microliters of T4 ligase to the above mixture and incubate at 16°C in a constant temperature metal bath for 16 hours. Transform competent cells with the plasmid: Take competent cells from the -80°C freezer, thaw on ice, and then add 10 microliters of plasmid (plasmid is a lentivirus vector containing the PEDV virus -1 Ribosomal Frameshift slippage region gene sequence) to 100 microliters of competent cells. Mix the plasmid and mix on ice for 30 minutes. Then place the mixture of competent cells and plasmid in a 42°C water bath for 90 seconds. After heat shock, cool the mixture of competent cells and plasmid on ice for 10 seconds. Transfer the cooled mixture to a solid LB plate and evenly spread the liquid on the surface of the solid LB medium with a glass rod. Then invert the solid LB medium and incubate at 37°C in an incubator for 16 hours. After incubation, pick a single colony with a pipette tip and inoculate liquid LB medium. Incubate at 37°C on a shaker for 8 hours, then send to a commercial company for sequencing. The single colony with correct sequencing results was expanded and plasmid extraction was performed.
[0035] (2) Construct Renilla luciferase to the upstream of -1 Ribosomal Frameshift region and construct Firefly luciferase to the downstream of -1 Ribosomal Frameshift region by homologous recombination.
[0036] The specific method is as follows: the Renilla luciferase and Firefly luciferase gene sequences are amplified by PCR method, and homologous arms are added to the upstream and downstream of the sequences. Perform PCR on the vector obtained in step (1) to obtain a linearized vector. Nucleic acid electrophoresis and gel recovery are performed to obtain Renilla luciferase and Firefly luciferase gel recovery products and linearized vector gel recovery products. Homologous recombination: mix the Renilla luciferase and Firefly luciferase recovery products with the linearized vector recovery product at a mass ratio of 3:1, and add 2 microliters of homologous recombination enzyme, and react at 37°C for 15 minutes.
[0037] (3) Transform the competent cells with the plasmid, select single clones and sequence, and amplify and extract the plasmid from the virus backbone vector with correct sequencing. The transformation of competent cells and the extraction step are synchronized with step (1).
[0038] 1.2. Establishment of luciferase reporter gene screening cell system
[0039] (1) Mix the virus backbone vector containing double luciferase and -1 Ribosomal Frameshift region, PMD2.G, and pspax2 packaging vector at a volume ratio of 4:2:1 with PEI (polyethyleneimine), add 70 microliters of PEI per 35 microliters of DNA, and transfect 293T cells.
[0040] (2) Collect the 293T cell culture supernatant after transfection of the virus plasmid for 48h and 72h, centrifuge at 12000g for 10min, remove the cell impurities, and collect the lentivirus particles by cesium chloride gradient centrifugation.
[0041] (3) Add the lentivirus particles to PK15 cells, and after 7 days of infection, select positive cells by Puro. Digest the cells with trypsin to prepare a single cell suspension, and sort the single clones by flow cytometry.
[0042] (4) Genotype the cultured single clone cells, and expand the positive clones to obtain PK15 cells containing -1 Ribosomal Frameshift region (CMV-Renilla-framshift-Firefly).
[0043] 1.3. Drug screening based on luciferase reporter gene
[0044] (1) Five types of PK15 cells containing -1 Ribosomal Frameshift region were mixed and cultured in a 96-well plate at a ratio of 1:1:1:1:1. After 24 hours, different test compounds (control group: DMSO; experimental group: acetylsine) were added to the plate, and the drug concentration was 10 μM.
[0045] (2) After culturing for 8 hours, the cells were lysed, and firefly luciferase substrate was added to the lysate. After 0.5 hours, the luminescence value was detected by an enzyme-linked immunosorbent assay (ELISA) reader.
[0046] (3) Add the Renaissance luciferase substrate and detect the luminescence value using an enzyme-linked immunosorbent assay (ELISA) reader.
[0047] (4) The ratio of firefly luciferase to Renilla luciferase is used as a reference for the -1 Ribosomal Frameshift efficiency. A larger ratio indicates a higher -1 Ribosomal Frameshift efficiency, and a lower ratio indicates a lower -1 Ribosomal Frameshift efficiency. In other words, a lower ratio indicates a higher efficiency of the drug in inhibiting the -1 Ribosomal Frameshift process, and a better ability to inhibit the -1 Ribosomal Frameshift process.
[0048] 2. Experimental Results
[0049] Experimental results are as follows Figure 1 As shown, Figure 1 This document presents a schematic diagram of the design principle, experimental procedure, and experimental results for the inhibition of PEDV ribosomal frameshifting by acetylglucosine in a luciferase reporter system. Specifically, Figure 1 In the 'a' section, the reporter gene design scheme is as follows: when ribosome frameshift occurs normally, both the reporter genes Renilla and Firefly are expressed. However, when ribosome frameshift is blocked, the reporter gene Renilla is expressed, while Firefly is not expressed. Figure 1 The workflow of the multivariate mixed screening reporter system is as follows: First, the reporter vector is stably integrated into the host cell (porcine kidney cell line PK15) via a lentiviral vector. The mixed system of 5 positive monoclonal cells is then treated with compounds (control group: DMSO; experimental group: cytidine). The effect of the compounds on the PEDV ribosome frameshift process is determined by a dual-luciferase reporter gene assay kit and an enzyme-linked immunosorbent assay (ELISA) reader. Figure 1 In the image, 'c' represents the results of the luciferase reporter gene screening experiment. (From...) Figure 1As can be seen in Table C, 10 μΜ of ethynylcytidine has a significant inhibitory effect on the -1 Ribosomal Frameshifting process of PEDV (G1a, G1b, G2a, G2b, G2c strains) (* indicates P<0.05).
[0050] Example 2
[0051] Evaluation of the inhibitory effect of ethynylcytidine on the -1 Ribosomal Frameshifting process of PEDV (fluorescent protein reporter system).
[0052] 1. Experimental method
[0053] 1.1. Construction of fluorescent protein reporter vector
[0054] (1) Synthesis of PEDV virus -1 Ribosomal Frameshift sliding region gene sequence (synthesis of 5 strains of frameshift elements: G1a, G1b, G2a, G2b, G2c respectively). Double enzyme digestion was performed on the lentivirus backbone vector, and the enzyme digestion site was selected as EcoRI + BamHI. The enzyme digestion conditions were 37°C for 15 minutes. After enzyme digestion, the enzyme digestion product was recovered by nucleic acid electrophoresis. For the synthesized PEDV virus -1 Ribosomal Frameshift sliding region gene sequence, first denature at 95°C for 10 minutes, then anneal at 72°C for 30 seconds. Then mix the annealing product with the enzyme digestion product at a ratio of 3:1, and add 10 microliters of T4 ligase to the above mixture and incubate at 16°C in a constant temperature metal bath for 16 hours. Transform competent cells with the plasmid: Take competent cells from the -80°C freezer, thaw on ice, and then add 10 microliters of plasmid (plasmid is a lentivirus vector carrying the PEDV virus -1 Ribosomal Frameshift sliding region gene sequence) to 100 microliters of competent cells. Mix the plasmid and mix on ice for 30 minutes, then heat shock the mixture of competent cells and plasmid in a 42°C water bath for 90 seconds. After heat shock, cool the mixture of competent cells and plasmid on ice for 10 seconds. Transfer the cooled mixture to a solid LB plate and evenly spread the liquid on the surface of the solid LB medium with a glass rod. Then invert the solid LB medium and incubate in a 37°C incubator for 16 hours. After incubation, pick a single colony with a pipette tip and inoculate liquid LB medium. Incubate at 37°C on a shaker for 8 hours, then send to a commercial company for sequencing. Perform large-scale culture of the single colony with correct sequencing results and perform plasmid extraction.
[0055] (2) Construct ubiquitin-green fluorescent protein (Ub-GFP) to the upstream of -1 Ribosomal Frameshift region and red fluorescent protein (RFP) to the downstream of -1 Frameshift region by homologous recombination.
[0056] The specific method is as follows: the Ub-GFP and RFP gene sequences are amplified by PCR method, and homologous arms are added to the upstream and downstream of the sequences. The vector obtained in step (1) is subjected to PCR to obtain a linearized vector. Nucleic acid electrophoresis and gel recovery are performed to obtain Ub-GFP and RFP gel recovery products and linearized vector gel recovery products. Homologous recombination: mix the Ub-GFP and RFP gel recovery products with the linearized vector gel recovery products at a mass ratio of 3:1, and add 2 microliters of homologous recombination enzyme, and react at 37°C for 15 minutes.
[0057] (3) Transform the competent cells with the plasmid, select single clones and sequence, and amplify and extract the plasmid of the virus backbone vector with correct sequencing. The transformation of competent cells and the extraction step are synchronized with step (1).
[0058] 1.2. Establishment of fluorescent protein reporter gene screening cell system
[0059] (1) Mix the virus backbone vector containing double fluorescent proteins and -1 Ribosomal Frameshift region, PMD2.G, and pspax2 packaging vector at a volume ratio of 4:2:1 with PEI, add 70 microliters of PEI per 35 microliters of DNA, and transfect 293T cells.
[0060] (2) Collect the 293T cell culture supernatant after transfection of the virus plasmid for 48h and 72h, centrifuge at 12000g for 10min, remove the cell impurities, and collect the lentivirus particles by cesium chloride gradient centrifugation.
[0061] (3) Add the lentivirus particles to PK15 cells, and after 7 days of infection, select positive cells by Puro. Digest the cells to prepare a single cell suspension, and sort the single clones by flow cytometry.
[0062] (4) Genotype the cultured single clone cells, and expand the positive clones to obtain PK15 cells containing -1 Ribosomal Frameshift region (CMV-Ub-GFP-framshift-RFP).
[0063] 1.3. Drug screening based on fluorescent protein reporter gene
[0064] (1) Five PK15 fluorescent protein reporter gene cells containing -1 Ribosomal Frameshift region were mixed and cultured in a 96-well plate at a ratio of 1:1:1:1:1. After the cells were plated for 24 hours, different test compounds (control group: DMSO; experimental group: acetylsalicylate) were added to the plates. The drug concentration was 10 μM for all groups, and autofluorescent compounds were excluded.
[0065] (2) After culturing for 8 hours, MG132 was added, and after culturing for 4 hours, the changes in fluorescence signal were observed under a high-content fluorescence microscope.
[0066] (3) The ratio of RFP to GFP is used as a reference for the efficiency of -1 Ribosomal Frameshift. The larger the ratio, the higher the efficiency of -1 Ribosomal Frameshift; the lower the ratio, the lower the efficiency of -1 Ribosomal Frameshift. In other words, the lower the ratio, the higher the efficiency of the drug in inhibiting the -1 Ribosomal Frameshift process, and the better it can inhibit the -1 Ribosomal Frameshift process.
[0067] 2. Experimental Results
[0068] Experimental results are as follows Figure 2 As shown, Figure 2 This document presents a schematic diagram illustrating the design principle, experimental procedure, and experimental results of ethynylcytidine's inhibition of PEDV ribosomal frameshifting in a fluorescent protein reporter system. Specifically, Figure 2 In the design scheme of the fluorescent protein reporter system, when the ribosome is frameshifted, both the reporter genes GFP and RFP are expressed. When the ribosome frameshift is blocked, the reporter gene GFP is expressed, but RFP is not expressed. Figure 2 The workflow of the multi-stage mixed screening fluorescent protein reporter system is as follows: First, the reporter vector is stably integrated into the host cell (PK15 cell) via a lentiviral vector. Positive monoclonal cells are then treated with compounds (control group: DMSO; experimental group: cytidine). Fluorescence images are obtained using a high-content fluorescence microscope, and the inhibitory effect of the compounds on the PEDV ribosome frameshift process is determined by fluorescence signal analysis. Figure 2 In the figure, c represents the experimental results of the fluorescent protein reporter system. Figure 2 As shown in Figure c, 10 μM cytidine significantly inhibited the -1 ribosome frameshifting process of PEDV (G1a, G1b, G2a, G2b, and G2c strains) (* indicates P < 0.05).
[0069] Example 3
[0070] Evaluation of the antiviral activity and cytotoxicity of ethynylcytidine in vitro
[0071] 1. Experimental method
[0072] The experiment was carried out under P2 laboratory conditions, and PEDV virus (G2c strain) was cultured in Vero (African green monkey kidney) cells, and trypsin was added to promote virus adsorption. After 2 hours of infection, the normal culture medium was replaced, and ethynylcytidine was added at a concentration of 0.01, 0.0625, 0.125, 0.25, 0.5, 1, 2, 5, 10, 20, 40, and 80 μM, and the lesions were observed after 48 hours. The level of virus replication was detected using fluorescent quantitative PCR. The relationship between drug concentration and virus inhibition rate was calculated, and the virus inhibition rate EC 50 was obtained by fitting the curve. The cells were treated with drugs at a concentration of 0.01, 0.0625, 0.125, 0.25, 0.5, 1, 2, 5, 10, 20, 40, and 80 μM, and the cell activity was determined by CCK8 experiment. The cytotoxicity rate CC 50 was obtained by fitting the curve. The calculation of the selectivity index SI is CC 50 / EC 50 .
[0073] 2. Experimental results
[0074] The experimental results are shown in Figure 3 . The toxicity index CC 50 of ethynylcytidine in Vero cells was 3.27 μM, i.e., the half-cell toxicity concentration (CC 50 ) of ethynylcytidine on Vero cells was 3.27 μM; ethynylcytidine had an inhibitory effect on the -1 Ribosomal Frameshifting process of PEDV, and the half-effective concentration (EC 50 ) was 0.24 μM; the selectivity index SI was 13.63, and an SI value greater than 5.00 indicated that the drug was effective and had high safety, and the larger the value, the wider the safety range of the drug.
[0075] Example 4
[0076] Evaluation of the antiviral effect of ethynylcytidine in cultured cells in vitro.
[0077] 1. Experimental method
[0078] The experiment was carried out under P2 laboratory conditions, and PEDV virus (G2c strain) was cultured in Vero (African green monkey kidney) cells, and trypsin was added to promote virus adsorption. After 2 hours of infection, the normal culture medium was replaced, and the compound (DMSO or ethynylcytidine) was added at a concentration of 1 μM, and photographs were taken under a bright field microscope after 48 hours.
[0079] 2. Experimental results
[0080] The experimental results are shown in Table 1. Figure 4 As shown in Table 1, the Vero cells without PEDV infection grew well without cytopathic effect (CPE) caused by virus infection. After PEDV infection, the solvent treatment group (DMSO) showed a large amount of CPE and the cell state was very poor, while the CPE of the ethynylcytidine treatment group was significantly reduced and the cell state was close to that of the group without PEDV infection. This indicates that ethynylcytidine has a significant inhibitory effect on the Vero cell CPE caused by PEDV G2c strain.
[0081] Example 5
[0082] The antiviral effect of ethynylcytidine on different strains (G1a, G1b, G2a, G2b, G2c) of PEDV was evaluated.
[0083] 1. Experimental method
[0084] The experiment was carried out under P2 laboratory conditions, and PEDV virus (G1a, G1b, G2a, G2b, G2c strain) was cultured in Vero (African green monkey kidney) cells, and trypsin was added to promote virus adsorption. After 2 hours of infection, normal culture medium was replaced and ethynylcytidine was added at a concentration of 1 μM. After 48 hours, the virus replication level was detected by fluorescence quantitative PCR.
[0085] The qPCR primers are as follows:
[0086] PEDV M-F GGTTGCTACTGGCGTACAGGTA,
[0087] PEDV M-R GAAGCATTGACTGAACGACCAACA;
[0088] GAPDH-F GAAGGTGAAGGTCGGAGTCA,
[0089] GAPDH-R CATGTAAACCATGTAGTTGAGGTC.
[0090] 2. Experimental results
[0091] The experimental results are shown in Table 2. Figure 5 Figure 5 The results of the RT-PCR detection of the antiviral effect of ethynylcytidine on G1a, G1b, G2a, G2b, and G2c strains of PEDV are shown in Table 2. Figure 5 As can be seen, acetylcysteine has extremely significant antiviral effect on G1a, G1b, G2a, G2b and G2c strains of PEDV (*** represents P<0.001), indicating that acetylcysteine has broad-spectrum antiviral effect on PEDV.
[0092] Example 6
[0093] The antiviral effect of acetylcysteine on PEDV in vivo was evaluated.
[0094] 1. Experimental method
[0095] Acetylcysteine (as a drug) was dissolved in normal saline, 21-day-old PEDV antibody-negative weaned piglets (10 per group) were selected and divided into experimental group (infection + drug treatment), positive control group (infection + DMSO) and negative control group (without infection), and after 7 days of pre-feeding, 10.0 TCID50 (half of the tissue culture infective dose) of PEDV-G2c strain was orally inoculated; the administration method was intramuscular injection, the dose was 10 mg / kg of body weight; once a day, the diarrhea score, body temperature and feed intake were recorded, the empty stomach tissue was collected 7 days after infection to detect the viral load, and biosafety measures were implemented throughout the experiment (glutaraldehyde disinfection, protective clothing operation).
[0096] 2. Experimental results
[0097] The experimental results are shown in Figure 6 , Figure 6 The viral load of empty stomach tissue of the experimental group and the positive control group is shown in Figure 6 As can be seen, acetylcysteine has extremely significant antiviral effect on PEDV (*** represents P<0.001).
Claims
1. Application of acetylgynyl cytidine in the preparation of drugs against porcine epidemic diarrhea virus.
2. The application of acetylcytidine according to claim 1 in the preparation of drugs against porcine epidemic diarrhea virus, characterized in that, The drug is a drug for the prevention and / or treatment of porcine epidemic diarrhea caused by porcine epidemic diarrhea virus infection.
3. The application of acetylcytidine according to claim 1 in the preparation of drugs against porcine epidemic diarrhea virus, characterized in that, The drug is used to inhibit the replication of porcine epidemic diarrhea virus.
4. The application of acetylcytidine according to claim 1 in the preparation of drugs against porcine epidemic diarrhea virus, characterized in that, The drug is used to inhibit the proliferation of porcine epidemic diarrhea virus.
5. The application of acetylcytidine according to claim 1 in the preparation of drugs against porcine epidemic diarrhea virus, characterized in that, The porcine epidemic diarrhea virus includes one or more genotypes of the strains G1a, G1b, G2a, G2b, and G2c.
6. The application of acetylcytidine according to claim 1 in the preparation of drugs against porcine epidemic diarrhea virus, characterized in that, The drug comprises acetylcytidine and pharmaceutically acceptable excipients.
7. The use of acetylgynyl cytidine according to any one of claims 1 to 6 in the preparation of a drug for treating porcine epidemic diarrhea virus, characterized in that, The acetylgynyl cytidine inhibits the replication and proliferation of porcine epidemic diarrhea virus (PEDV) or prevents PEDV by inhibiting the -1 ribosomal frameshift process of PEDV.
8. The use of acetylgynyl cytidine according to any one of claims 1, 2, or 6 in the preparation of a drug for treating porcine epidemic diarrhea virus, characterized in that, The drug is an oral preparation or an injection.