Method for double-target digital detection of Yangtze finless porpoise environmental DNA and application

By designing a dual-target digital detection method and a specific primer-probe combination, and combining it with microdroplet digital PCR technology, the problem of insufficient sensitivity and accuracy of environmental DNA detection in the Yangtze finless porpoise at low concentrations has been solved, thus achieving efficient and accurate monitoring of the Yangtze finless porpoise.

CN121450816BActive Publication Date: 2026-04-17INST OF AQUATIC LIFE ACAD SINICA
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-12-31
Publication Date
2026-04-17

AI Technical Summary

Technical Problem

Existing environmental DNA detection methods for Yangtze finless porpoises lack sufficient sensitivity and accuracy at low concentrations, making it difficult to meet the monitoring needs of rare and endangered species. In particular, the randomness of DNA strand breaks leads to inaccurate test results when the DNA template concentration is low.

Method used

A dual-target digital detection method was adopted, using two pairs of specific primers and probes for PCR amplification, combined with droplet digital PCR technology, to achieve simultaneous identification and accurate copy number quantification of environmental DNA of Yangtze finless porpoises. The optimized pretreatment steps are applicable to water, sediment and biological vector samples.

Benefits of technology

It improves the sensitivity and accuracy of Yangtze finless porpoise detection, can accurately capture trace DNA at extremely low concentrations, has high specificity, avoids interference from other species, is suitable for monitoring various environmental samples, and provides technical support for Yangtze finless porpoise distribution surveys.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121450816B_ABST
    Figure CN121450816B_ABST
Patent Text Reader

Abstract

This invention belongs to the field of biodetection technology, specifically disclosing a method and application for dual-target digital detection of environmental DNA of the Yangtze finless porpoise. This method, through the design of two pairs of specific primer probes, achieves simultaneous identification and precise copy number quantification of two targets in a single reaction system. Compared with single-target detection, it increases the detection rate of Yangtze finless porpoise environmental DNA, exhibiting extremely high species specificity, sensitivity, and accuracy. This invention provides technical support and theoretical basis for conducting surveys on the current distribution status of wild Yangtze finless porpoises, and is of great significance to the conservation of the Yangtze finless porpoise. This method has high specificity and high detection sensitivity, enabling the precise capture of trace amounts of Yangtze finless porpoise environmental DNA. Experimental data show that the limit of detection of this method can reach 0.2 copies / μL, and the detection rate at this concentration is 100%. Even at extremely low concentrations of 0.1 copies / μL, the detection rate is still not less than 80%.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of biological detection technology, specifically relating to a method and application for dual-target digital detection of environmental DNA in Yangtze finless porpoises. Background Technology

[0002] Due to the low density and small biomass of endangered species, the investigation and monitoring of the Yangtze finless porpoise has always been a research challenge. Conventional visual surveys combined with passive acoustic methods to investigate its population and distribution patterns place high demands on personnel and equipment. The Yangtze finless porpoise's small size, short surface time, small group size, and fast swimming speed also pose challenges to traditional monitoring methods. eDNA detection technology, with its advantages of being non-invasive, low-cost, efficient, and accurate, is gradually gaining attention.

[0003] Droplet digital PCR (ddPCR) is a novel method for absolute nucleic acid quantification. ddPCR separates a sample into thousands of droplets and performs independent PCR sub-reactions. Each sub-reaction contains little or no target sequence. After PCR amplification, these droplets produce positive droplets. Poisson statistical analysis is then performed on the proportion of positive droplets to achieve accurate quantification of the target sequence.

[0004] Previous studies on environmental DNA monitoring of the Yangtze finless porpoise have demonstrated the effectiveness of this monitoring technique. However, most existing environmental DNA detection methods for the Yangtze finless porpoise rely on single-site molecular markers. Given the rarity of the Yangtze finless porpoise population, the randomness of DNA strand breaks at low DNA template concentrations reduces the sensitivity and accuracy of single-site amplification-based environmental DNA techniques. Therefore, there is an urgent need to develop a new method to improve the sensitivity and accuracy of environmental DNA detection results for rare and endangered species. Summary of the Invention

[0005] The purpose of this invention is to address the aforementioned shortcomings of the prior art by providing a method and application for dual-target digital detection of environmental DNA in the Yangtze finless porpoise.

[0006] To achieve the above objectives, the present invention adopts the following technical solution:

[0007] The first objective of this invention is to provide a method for digital detection of environmental DNA of the Yangtze finless porpoise using dual targets, comprising the following steps:

[0008] Collect environmental samples and extract environmental DNA;

[0009] Using environmental DNA from environmental samples as a template, PCR amplification was performed using primer and probe combinations;

[0010] The presence of Yangtze finless porpoise DNA in environmental samples can be determined based on the DNA copy number concentration or the Ct value of the fluorescence signal.

[0011] The nucleotide sequence of the primer-probe combination includes a first primer-probe combination and a second primer-probe combination.

[0012] The first primer-probe combination includes:

[0013] The upstream primer has the nucleotide sequence shown in SEQ ID NO.3;

[0014] The downstream primer has the nucleotide sequence shown in SEQ ID NO.4;

[0015] The probe, whose nucleotide sequence is shown in SEQ ID NO.11;

[0016] The second primer-probe combination includes:

[0017] The upstream primer has the nucleotide sequence shown in SEQ ID NO.7;

[0018] The downstream primer, whose nucleotide sequence is shown in SEQ ID NO.8;

[0019] The probe has the nucleotide sequence shown in SEQ ID NO.12.

[0020] Furthermore, the PCR amplification reaction is droplet digital PCR.

[0021] Furthermore, the 5' end of the probe is modified with a fluorescent reporter group, and the 3' end is modified with a fluorescent quencher group; the fluorescent reporter group is selected from one of FAM, HEX, VIC or ROX, and the fluorescent quencher group is selected from one of BHQ1, BHQ2, TAMRA or MGB.

[0022] Furthermore, the environmental samples are selected from any one of water samples, sediment samples, and biological vector samples.

[0023] Furthermore, a pretreatment step is included before DNA extraction: when the environmental sample is a water sample, it is enriched by filtration using a filter membrane.

[0024] Furthermore, methods for calculating the DNA copy number concentration in environmental samples include: calculating the absolute copy number using a data reading device based on the Poisson distribution statistical formula.

[0025] Furthermore, the limit of detection of the method is 0.15~0.2 copies / μL.

[0026] A second objective of this invention is to provide a primer-probe combination for detecting the Yangtze finless porpoise, the primer-probe combination comprising the aforementioned first primer-probe combination and / or second primer-probe combination, wherein the first primer-probe combination comprises:

[0027] The upstream primer has the nucleotide sequence shown in SEQ ID NO.3;

[0028] The downstream primer has the nucleotide sequence shown in SEQ ID NO.4;

[0029] The probe, whose nucleotide sequence is shown in SEQ ID NO.11;

[0030] The second primer-probe combination includes:

[0031] The upstream primer has the nucleotide sequence shown in SEQ ID NO.7;

[0032] The downstream primer, whose nucleotide sequence is shown in SEQ ID NO.8;

[0033] The probe has the nucleotide sequence shown in SEQ ID NO.12.

[0034] A third objective of this invention is to provide a kit for detecting Yangtze finless porpoises, comprising the aforementioned primer-probe combination and a PCR reaction solution; the PCR reaction solution comprises DNA polymerase, dNTPs, and a reaction buffer.

[0035] A fourth objective of this invention is to provide the application of the above-described method or kit in the protection of the Yangtze finless porpoise, resource surveys, habitat distribution assessments, or monitoring of illegal poaching.

[0036] Compared with the prior art, the beneficial effects of the technical solution provided by the present invention are as follows:

[0037] (1) This invention provides a method for digital detection of environmental DNA of the Yangtze finless porpoise using dual targets. By designing two pairs of specific primer-probe combinations—a first primer-probe combination and a second primer-probe combination—it achieves simultaneous identification and precise copy number quantification of two targets in a single reaction system. Compared with single-target detection, this method increases the detection rate of the Yangtze finless porpoise and exhibits extremely high species specificity, sensitivity, and accuracy. This invention provides technical support and theoretical basis for conducting surveys on the current distribution status of the Yangtze finless porpoise in the wild and is of great significance to the conservation of the Yangtze finless porpoise.

[0038] (2) The method provided by this invention has high detection sensitivity and can accurately capture trace amounts of environmental DNA from Yangtze finless porpoises. Experimental data show that the lowest detection limit of this method can reach 0.2 copies / μL, and the detection rate at this concentration is 100%. Even at an extremely low concentration of 0.1 copies / μL, the detection rate is still not less than 80%.

[0039] (3) The method provided by this invention has high specificity and effectively avoids interference from other species in the environment. This invention uses two pairs of specific primer probes to generate specific amplification curves only for DNA samples of Yangtze finless porpoises, while no amplification signals are generated for closely related species, fish, or environmental background microorganisms that may exist in the same habitat. This effectively solves the false positive problem caused by insufficient primer specificity in eDNA detection, ensuring the single-point and accuracy of the detection results. The two independent sets of highly specific primer combinations provided offer more options for actual detection. For environmental samples from different sources or with different degrees of degradation, technicians can select one or two sets for verification and comparison, further ensuring the specific performance in specific detection scenarios.

[0040] (4) The invention provides optimized pretreatment and extraction processes applicable to various environmental samples such as water bodies, sediments (silt), and biological vectors (leeches). Even if monitoring personnel cannot enter the water, they only need to collect water samples on the water surface to determine whether there is a Yangtze finless porpoise population in the sampling site and its upstream or surrounding waters through eDNA, effectively solving the problem of monitoring blind spots in hidden habitats. Attached Figure Description

[0041] Figure 1 This is a diagram showing the formation of droplets using five single primer pairs in Example 1 of the present invention;

[0042] Figure 2 This is a droplet formation diagram for testing with two primer pairs in Example 2 of the present invention. In the diagram, a is the FAM channel and b is the HEX channel.

[0043] Figure 3 This is a droplet formation diagram for testing with a single primer pair in Example 3 of the present invention. In the diagram, a is the FAM channel and b is the HEX channel.

[0044] Figure 4 This is a droplet generation diagram for specific testing of the dual-target digital standard system in Embodiment 4 of the present invention. In the diagram, a is the FAM channel and b is the HEX channel.

[0045] Figure 5 This is a droplet generation diagram for linear testing of a dual-target digital standard system in Embodiment 5 of the present invention. In the diagram, a is the FAM channel and b is the HEX channel.

[0046] Figure 6 This is a droplet formation diagram of the dual-target digital standard system tested at a template concentration of 0.2 copies / μL in Embodiment 6 of the present invention. In the diagram, a is the FAM channel and b is the HEX channel.

[0047] Figure 7 This is a droplet generation diagram of the dual-target digital standard system tested with a template concentration of 0.1 copies / μL in Embodiment 6 of the present invention. In the diagram, a is the FAM channel and b is the HEX channel.

[0048] Figure 8 This is a droplet generation diagram of a dual-target digital standard system with different copy concentrations in Embodiment 7 of the present invention. In the diagram, a is the FAM channel and b is the HEX channel.

[0049] Figure 9 This is a droplet generation diagram for the highest detection limit test of the dual-target digital standard system in Embodiment 7 of the present invention. In the diagram, a is the FAM channel and b is the HEX channel.

[0050] Figure 10 This is a droplet generation diagram of the environmental DNA of the Yangtze finless porpoise in the Wuhan Baiji Dolphin Museum, tested using a dual-target digital standard system in Embodiment 8 of the present invention. In the diagram, a is the FAM channel and b is the HEX channel.

[0051] Figure 11 This is a droplet generation diagram of the Yangtze finless porpoise environmental DNA in water samples 1-15 of the Yangtze River main stream tested using a dual-target digital standard system in Example 9 of the present invention. In the diagram, a is the FAM channel and b is the HEX channel.

[0052] Figure 12 This is a droplet generation diagram of the Yangtze finless porpoise environmental DNA in water samples 16-31 of the Yangtze River main stream tested using a dual-target digital standard system in Example 9 of the present invention. In the diagram, a is the FAM channel and b is the HEX channel.

[0053] Figure 13 This is a droplet generation diagram of the Yangtze finless porpoise environmental DNA in water samples 33-42 of the Yangtze River main stream tested using a dual-target digital standard system in Example 9 of the present invention. In the diagram, a is the FAM channel and b is the HEX channel. Detailed Implementation

[0054] To make the objectives, technical solutions, and advantages of this invention clearer, the specific embodiments and accompanying drawings are described in further detail below. Where specific techniques or conditions are not specified in the embodiments, they are performed according to the techniques or conditions described in the literature in this field or according to the product instructions. Reagents or instruments whose manufacturers are not specified are all commercially available conventional products.

[0055] Definitions and explanations of terms in this invention:

[0056] Environmental DNA (eDNA) refers to total DNA extracted directly from environmental samples (such as water, sediment, soil, air, or biological carriers) without first isolating any specific biological individual from the sample. In this invention, eDNA specifically refers to the genetic material released into the surrounding environment by the Yangtze finless porpoise during its natural activities, the sources of which include, but are not limited to, epidermal mucus, shed skin cells, excrement (feces and urine), reproductive material (sperm and eggs), or degraded carcasses.

[0057] A primer-probe combo refers to a set of oligonucleotide sequences used in PCR amplification reactions, including specific primers and specific probes.

[0058] Specific primers: These include one forward primer and one reverse primer, which can specifically bind to both sides of the target gene (such as the mitochondrial Cytb gene, 12S rRNA gene, or nuclear gene) of the Yangtze finless porpoise, defining the amplification region.

[0059] Specific probe: refers to an oligonucleotide sequence (usually a probe) located between the upstream and downstream primers, with a fluorescent reporter group (such as FAM) labeled at the 5' end and a fluorescent quencher group (such as BHQ1) labeled at the 3' end.

[0060] The “first / second primer-probe combination” mentioned in this invention refers to a set of specific sequences designed for different gene loci of the Yangtze finless porpoise.

[0061] Digital droplet PCR refers to the process of evenly distributing a sample into 20,000 water-in-oil droplets. Each droplet undergoes a PCR reaction independently, with target molecules randomly distributed (0 / 1 / multiple). The method involves detecting the proportion of positive droplets, calculating the absolute copy number using a formula, and finally quantifying unknown templates based on the copy number. In this invention, this technique is used to capture the fluorescent signal generated after primers and probes bind to the eDNA of the Yangtze finless porpoise.

[0062] Copy number concentration refers to the number of target gene fragments per unit volume of environmental sample (the unit is usually copies / μL or copies / L). In this invention, this value is calculated using a data reading device based on the Poisson distribution statistical formula and is used to quantify biomass in the environment.

[0063] A higher copy number indicates a higher concentration of Yangtze finless porpoise DNA in the sample;

[0064] The lower the copy number or the lower the detection limit, the lower the DNA concentration in the sample, or the DNA is absent.

[0065] Environmental samples refer to various media that may contain the eDNA of the target species, including but not limited to:

[0066] Water samples are collected from rivers, lakes, underground rivers, reservoirs, or aquaculture ponds.

[0067] Sediment samples: collected from the bottom of the water body, including silt, gravel, or riverbank soil.

[0068] Biological vector samples: These refer to extracts from organisms that may ingest or come into contact with the body fluids of the Yangtze finless porpoise (such as leeches).

[0069] This invention provides a method for digital detection of environmental DNA of Yangtze finless porpoises using dual targets. This method does not rely on direct observation or capture of biological entities, but is based on the genetic material released by organisms in the environment. The method provided by this invention includes: collecting environmental samples and extracting environmental DNA.

[0070] Using environmental DNA from environmental samples as a template, PCR amplification was performed using primer and probe combinations;

[0071] The presence of Yangtze finless porpoise DNA in environmental samples can be determined based on the DNA copy number concentration or the Ct value of the fluorescence signal.

[0072] The nucleotide sequence of the primer-probe combination includes a first primer-probe combination and a second primer-probe combination.

[0073] The first primer-probe combination includes:

[0074] The upstream primer has the nucleotide sequence shown in SEQ ID NO.3: GTCATAGCCACCGCATTTGT;

[0075] The downstream primer has the nucleotide sequence shown in SEQ ID NO.4: CGCCTCAGATCCACTCCACT;

[0076] The probe, whose nucleotide sequence is shown in SEQ ID NO.11, is CAAGAGGTTTGTGATGACGGTAGCACCTCA;

[0077] The second primer-probe combination includes:

[0078] The upstream primer has the following nucleotide sequence as shown in SEQ ID NO.7: ACGCAAACGGAGCCTCTATG

[0079] The downstream primer has the nucleotide sequence shown in SEQ ID NO.8, CCCTCAGGGTAGAACGTAGC;

[0080] The probe, whose nucleotide sequence is shown in SEQ ID NO.12, is CACATCGGACGTGGCCTGTATTACGG.

[0081] The method provided by this invention can confirm the existence of the Yangtze finless porpoise even at extremely low abundance levels.

[0082] In some embodiments, the “environmental sample” in this invention encompasses all media that the Yangtze finless porpoise may inhabit or pass through, including but not limited to: water samples, sediment samples, and biological vector samples.

[0083] In some embodiments, to ensure the accuracy and robustness of the method, this invention is primarily based on droplet digital PCR (ddPCR), but it can also be applied to real-time quantitative PCR (qPCR). ddPCR performs absolute quantification by dividing the reaction system into tens of thousands of droplets, while qPCR utilizes the accumulation of fluorescence signals to monitor the amplification process in real time, both of which are covered by the scope of this invention.

[0084] In some embodiments, the probe provided by this invention is modified with a fluorescent reporter group (such as FAM, HEX, etc.) at its 5' end and a fluorescent quencher group (such as BHQ1, MGB, etc.) at its 3' end. In the unamplified state, due to the energy transfer effect (FRET), the fluorescence of the reporter group is absorbed by the quencher group, and the instrument cannot detect the signal. During the amplification extension phase, the 5'-3' exonuclease activity of Taq polymerase cleaves the probe, freeing the reporter group and causing it to move away from the quencher group, thereby emitting fluorescence. The fluorescence intensity is strictly proportional to the amount of DNA product generated.

[0085] The optimized method of this invention has a reliable detection limit of 0.15~0.2 copies / μL. At a concentration of 0.2 copies / μL, the detection system can guarantee a 100% detection rate, meaning that even trace amounts of the target in the sample can be detected. Moreover, at an even lower concentration of 0.1 copies / μL, the method of this invention still maintains a detection rate of no less than 80%, indicating that this method is very suitable for detecting highly diluted DNA from Yangtze finless porpoises in open waters in the wild.

[0086] In some embodiments, the present invention can also be manufactured into standardized reagent kits containing premixed primers and probes, DNA polymerase, and reaction buffers, facilitating rapid detection in laboratories or field operations.

[0087] In practical applications, this method can be used in scenarios including but not limited to the protection of Yangtze finless porpoises, resource surveys, habitat distribution assessments, and monitoring of illegal poaching.

[0088] The invention has now been generally described, and will be more readily understood by referring to the following examples, which are provided by way of illustration and not by way of limitation.

[0089] During the research process, primer pairs were screened in this invention, as follows:

[0090] Primer pairs were designed based on the complete cytb gene sequence of the Yangtze finless porpoise obtained from Genbank. Based on specificity experiments and other results, 12 primer pairs were selected, ranging from 76 to 249 base pairs. Based on the experimental results of their time sensitivity and concentration sensitivity, 5 representative primer pairs were selected as shown in Table 1: FP76 primer pairs are SEQ ID NO.1 and SEQ ID NO.2; FP133 primer pairs are SEQ ID NO.3 and SEQ ID NO.4; FP147 primer pairs are SEQ ID NO.5 and SEQ ID NO.6; FP161 primer pairs are SEQ ID NO.7 and SEQ ID NO.8; and FP171 primer pairs are SEQ ID NO.9 and SEQ ID NO.10.

[0091] Table 1. Primer pair information table.

[0092]

[0093] (1) Positive detection: Test whether the selected 5 pairs of primers can amplify the DNA of the target species Yangtze finless porpoise and select 3 pairs of primers with good amplification effect.

[0094] The template used was eDNA extracted from the new baiji dolphin enclosure in Wuhan, Hubei Province (four Yangtze finless porpoises were housed at the time of sampling: M09, M11, F08, and F10). The eDNA was obtained after filtering the water sample. Compared to eDNA extracted from Yangtze River environmental samples, the concentration of eDNA obtained directly under artificial rearing conditions was higher. Therefore, the eDNA was diluted with ddH2O to four ratios: 1:1, 1:10, 1:100, and 1:1000, which were designated as groups A, B, C, and D, respectively.

[0095] The reaction system for positive detection includes: 10 μL of QX200 ddPCR EvaGreen Supermix, 2 μL of F (10 μM), 2 μL of R (10 μM), 2 μL of eDNA template, and sterile enzyme-free water to a final volume of 20 μL.

[0096] Mix all components thoroughly by vortexing and place in a PCR instrument. PCR amplification program: 95℃ pre-denaturation for 10 min; 94.0℃ denaturation for 30 s, 57.4 / 59.4℃ annealing for 1 min, 39 cycles; 90℃ for 5 min. Annealing temperatures are shown in Table 2.

[0097] Table 2. Annealing temperature table.

[0098]

[0099] Test results: such as Figure 1 As shown, it can be seen that the clustering of positive and negative droplet signals is relatively clear when using primer pairs FP133, FP147, and FP161 in groups A, B, C, and D.

[0100] The pCYTB-454 plasmid sequence used in this embodiment is shown in SEQ ID NO.13, with the 5' restriction site being EcoRI and the 3' restriction site being BamHI.

[0101] Example 1

[0102] Single primer pair test.

[0103] The test primer amplification results were investigated to determine if there was a good linear correlation between the concentration of Yangtze finless porpoise eDNA copy number.

[0104] Plasmid generation: Plasmids are circular supercoiled DNA molecules, which are not conducive to subsequent PCR amplification. Therefore, the plasmids need to be digested with enzymes to convert them into linear molecules. EcoRI restriction endonucleases were selected based on the plasmid sequence, and the digestion method was performed according to the manufacturer's instructions. The digestion system was prepared as follows (20 μL system) as shown in Table 3:

[0105] Table 3. Enzyme digestion system.

[0106]

[0107] Enzyme digestion was performed on a standard PCR instrument under the following conditions: 37℃ for 60 min; 60℃ for 20 min. The plasmid concentration was approximately 80 ng / μL ≈ 2 × 10⁻⁶. 10 The plasmid concentration after enzyme digestion is approximately 2 × 10^6 copies / μL. 9 copies / μL, diluted 1×10 using plasmid dilution buffer. 5 This amount was used for subsequent testing, at which point the theoretical plasmid concentration was approximately 2 × 10⁻⁶. 4 copies / μL.

[0108] In this test, the pCYTB-454 plasmid template, with a theoretical concentration of approximately 20,000 copies / μL, was serially diluted 10-fold (using 10 ng / μL salmon sperm DNA as the dilution buffer to minimize template loss during dilution) as the template. A total of five gradients were performed (20,000, 2,000, 200, 20, and 2), with five replicates for each gradient. The primer pairs used were FP133, FP147, and FP161.

[0109] The reaction system for the test included: 10 μL of 3× Maxuseful Buffer, 0.5 μL of Taq enzyme, 1.2 μL of F (10 μM), 1.2 μL of R (10 μM), 0.6 μL of P (10 μM), 5 μL of eDNA template, and sterile enzyme-free water to a final volume of 30 μL.

[0110] Mix all components thoroughly by shaking and place in a PCR instrument. PCR amplification program: 50℃ curing for 5 min; 95℃ pre-denaturation for 5 min; 95.0℃ denaturation for 10 s, 61 / 64℃ annealing for 45 s, cycle 45 times. Annealing temperatures are shown in Table 4.

[0111] Table 4. Annealing Temperature Table.

[0112]

[0113] The test results are shown in Table 5.

[0114] Table 5. Results of single primer pair tests.

[0115]

[0116] Example 2

[0117] Primer pair combination test.

[0118] The FP133 primers from Example 1 were combined with the FP147 and FP161 primer pairs to construct a dual ddPCR detection system and to confirm whether there was any cross-interference between the two systems.

[0119] In this test, the pCYTB-454 plasmid template with a theoretical concentration of approximately 20,000 copies / μL was serially diluted 10-fold (the diluent was 10 ng / μL salmon sperm DNA to reduce template loss during the dilution process) as the template. A total of 5 gradients were performed (20,000, 2,000, 200, 20, and 2, respectively), and 5 replicates were made for each gradient.

[0120] The single reaction system for detection includes: 10 μL of 3× Maxuseful Buffer, 0.5 μL of Taq enzyme, 1.2 μL of F (10 μM), 1.2 μL of R (10 μM), 0.6 μL of P (10 μM), 5 μL of eDNA template, and sterile enzyme-free water to a final volume of 30 μL.

[0121] The combined reaction system for detection includes: 10 μL of 3× Maxuseful Buffer, 0.5 μL of Taq enzyme, 1.2 μL of F1 (10 μM), 1.2 μL of R1 (10 μM), 0.6 μL of P1 (10 μM), 1.2 μL of F2 (10 μM), 1.2 μL of R2 (10 μM), 0.6 μL of P2 (10 μM), 5 μL of eDNA template, and sterile enzyme-free water to a final volume of 30 μL.

[0122] Mix all components thoroughly by shaking and place in a PCR instrument. PCR amplification program: 50℃ curing for 5 min; 95℃ pre-denaturation for 5 min; 95.0℃ denaturation for 10 s, annealing at 61 / 63 / 64℃ for 45 s, cycled 45 times. Annealing temperatures are shown in Table 6.

[0123] Table 6. Annealing Temperature Table.

[0124]

[0125] Test results: Single primer pairs and primer pair combinations of FP133 and FP147, for example... Figure 2 As shown, single primer pairs and primer pair combinations of FP133 and FP161 are shown in the figure. Figure 3 As shown, when FP133 and FP161 were tested together, there was no cross-interference, the signal clusters were clear, and the plasmid determination results of the combined system were consistent with those of the single system. However, when FP133 and FP147 were tested together, the dispersion of the positive signal in the HEX channel increased, and the overall plasmid determination results of the combined system were lower than those of the single system. Therefore, FP133 interfered with the positive signal of FP147.

[0126] Example 3

[0127] This embodiment provides a method for dual-target digital detection of environmental DNA in Yangtze finless porpoises, including the following steps:

[0128] S1. Plasmid digestion: Plasmids are circular supercoiled DNA molecules, which are not conducive to subsequent PCR amplification. Therefore, the plasmids need to be digested with enzymes to convert them into linear molecules. EcoRI restriction endonuclease was selected based on the plasmid sequence, and the digestion method was performed according to the manufacturer's instructions. The digestion system (20 μL system) was prepared as in Example 1.

[0129] Enzyme digestion was performed on a standard PCR instrument under the following conditions: 37℃ for 60 min; 60℃ for 20 min. The plasmid concentration was approximately 80 ng / μL ≈ 2 × 10⁻⁶. 10 The plasmid concentration after enzyme digestion is approximately 2 × 10^6 copies / μL. 9 copies / μL, diluted 1×10 using plasmid dilution buffer. 5 This amount was used for subsequent testing, at which point the theoretical plasmid concentration was approximately 2 × 10⁻⁶. 4 copies / μL.

[0130] S2.ddPCR amplification: PCR amplification was performed using the plasmid as a template. The optimal annealing temperature and probe concentration for the standard system were explored.

[0131] The reaction system using the optimal annealing temperature of the FP133 exploration system in Example 1 included: 10 μL of 3× Maxuseful Buffer, 0.5 μL of Taq enzyme, 1.2 μL of F1 (10 μM), 1.2 μL of R1 (10 μM), 0.6 μL of P1 (10 μM), 5 μL of plasmid template, and sterile enzyme-free water to a final volume of 30 μL. The components were vortexed and mixed thoroughly before being placed in a PCR instrument. The PCR amplification program was as follows: 50℃ curing for 5 min; 95℃ pre-denaturation for 5 min; 95.0℃ denaturation for 10 s; annealing at 61℃ / 62℃ / 63℃ / 64℃ / 65℃ for 45 s, repeated 45 times. The FP161 exploration system in Example 1 was used in the same manner. Specific results are shown in Table 7. Since there were no significant differences in signal and copy number among the systems, the group with the best reproducibility was selected as the optimal annealing temperature for each system. The optimal annealing temperature for both the FP133 and FP161 exploration systems was 64℃.

[0132] Table 7. Annealing temperature screening results.

[0133]

[0134] The reaction system for exploring the optimal probe concentration included: 10 μL of 3× Maxuseful Buffer, 0.5 μL of Taq enzyme, 1.2 μL of F1 (10 μM), 1.2 μL of R1 (10 μM), 0.3 μL / 0.6 μL / 0.9 μL / 1.2 μL of P1 (10 μM), 5 μL of plasmid template, and sterile enzyme-free water to a final volume of 30 μL. All components were vortexed and mixed thoroughly before being placed in a PCR instrument. The PCR amplification program was: 50℃ curing for 5 min; 95℃ pre-denaturation for 5 min; 95.0℃ denaturation for 10 s, 64℃ annealing for 45 s, for a total of 45 cycles. The results of probe concentration screening are shown in Table 8. For each system, the overall signal strength increased with increasing probe concentration, while the signal-to-noise ratio decreased. Considering factors such as copy number, repeatability, and the number of raindrops between positive and negative signals, the optimal probe concentration for each system was 200 nM.

[0135] Table 8. Results of probe concentration screening.

[0136]

[0137] S3. Data Reading: Read the amplification products. After reading, calculate the copy number concentration on the analysis software to determine the optimal annealing temperature and probe concentration for the standard system. The dual-target digital standard system consists of the following reaction system for ddPCR amplification: 10 μL of 3× Maxuseful Buffer, 0.5 μL of Taq enzyme, 1.2 μL of F1 (10 μM), 1.2 μL of R1 (10 μM), 0.6 μL of P1 (10 μM), 1.2 μL of F2 (10 μM), 1.2 μL of R2 (10 μM), 0.6 μL of P2 (10 μM), 5 μL of plasmid template, and sterile, enzyme-free water to a final volume of 30 μL. Mix all components thoroughly by vortexing and place in the PCR instrument. PCR amplification program: 50℃ curing for 5 min; 95℃ pre-denaturation for 5 min; 95.0℃ denaturation for 10 s, 64℃ annealing for 45 s, repeated 45 times.

[0138] Example 4

[0139] Specificity test.

[0140] Nucleic acid was extracted from 12 aquatic animals (as shown in Table 9) that are co-located or closely related to the Yangtze finless porpoise as templates, with a nucleic acid input of 20 ng per test. The FP133+FP161 combination was used, and the combined reaction system and conditions were the same as in Example 2.

[0141] Table 9. Information on Aquatic Animals.

[0142]

[0143] Test results: such as Figure 4 As shown. When the nucleic acid input was 20 ng, samples 1-11 showed no abnormal signals, indicating good specificity; sample 12 showed all positive signals. Sample 12 is an Indo-Pacific finless porpoise, a marine finless porpoise species closely related to the Yangtze finless porpoise in evolution. Its mitochondrial genome is highly similar to that of the Yangtze finless porpoise, but their habitats are different, so it can be disregarded.

[0144] Example 5

[0145] Linearity test.

[0146] The test primer pair combination amplification results were investigated to determine if there was a good linear correlation between the amplification results and the eDNA copy number concentration of the Yangtze finless porpoise.

[0147] In this test, the pCYTB-454 plasmid template with a theoretical concentration of approximately 20,000 copies / μL was serially diluted 10-fold (the diluent was 10 ng / μL salmon sperm DNA to reduce template loss during the dilution process) as the template. A total of 5 gradients were performed (20,000, 2,000, 200, 20, and 2, respectively), and 5 replicates were made for each gradient.

[0148] The FP133 and FP161 were used in combination, and the combined reaction system and conditions were the same as in Example 2. The statistical data are shown in Table 10.

[0149] Test results: such as Figure 5 As shown, the linear correlation coefficients of the system are all greater than 0.999, indicating good linearity; the coefficients of variation of the system are all less than 5% when the plasmid template concentration is about 20,000 copies / μL, indicating good repeatability.

[0150] Table 10. Statistical table of linear test data.

[0151]

[0152] Example 6

[0153] System minimum detection limit test.

[0154] In this test, eDNA extracted from Yangtze River water samples was used as the template stock solution. After ddPCR determination, salmon sperm DNA was successively diluted to 0.9, 0.3, 0.2, and 0.1 copies / μL with 10 ng / μL for ddPCR limit of detection test. Each gradient was performed in 20 replicates.

[0155] The FP133+FP161 combination was used, and the combined reaction system and combined reaction conditions were consistent with the dual-target digital standard system in Example 2.

[0156] Test Results: One-dimensional scatter plots were used to examine the limit of detection (LOD) of the dual-target digitization method at template concentrations of 0.9 copies / μL, 0.3 copies / μL, 0.2 copies / μL, and 0.1 copies / μL, respectively. (See attached image.) Figure 6 and Figure 7 As shown, a copy number ≥ 0.1 in any FAM or HEX channel is considered a detection; the detection rate is 100% when the sample concentration is 0.9, 0.3, or 0.2 copies / μL; and the detection rate is 80% when the sample concentration is 0.1 copies / μL.

[0157] Example 7

[0158] The system's highest detection limit test.

[0159] In this test, a high-concentration linearized pCYTB-454 plasmid was used as the template stock solution, and 10 ng / μL salmon sperm DNA was used as the diluent. The solution was diluted sequentially to 50,000, 5,000, 500, 50, 5, and 0.5 copies / μL to identify the concentration range exceeding the detection limit, and then the highest detection limit was further confirmed.

[0160] Test results: such as Figure 8 and Figure 9 As shown, when 5 μL of template is loaded into a 30 μL system, the limit of detection for the dual-target system is approximately 25,000 copies / μL.

[0161] Example 8

[0162] The water samples from the Wuhan Baiji Dolphin Museum were analyzed using a dual-target digital method, employing a combination of FP133 and FP161. The steps included:

[0163] S1. Water sample extraction: Water samples were filtered using a mixed cellulose microporous membrane. After filtration, the membrane was placed in a sterile cryovial containing 95% ethanol fixative and stored at -20°C until DNA extraction.

[0164] S2. eDNA extraction:

[0165] DNA extraction was performed using the DNeasy Blood and Tissue Kit (Qiagen, Hilden, Germany). Preparatory work before extraction included: a. All centrifugation steps were performed at room temperature (15°C). a. Perform the following steps at 25℃: b. Dissolve the precipitate in Buffer AL and Buffer ATL; c. Add ethanol to Buffer AW1 and Buffer AW2; d. Preheat the water bath to 56℃; e. Perform all operations in a clean bench (sterilize with UV light for half an hour before the experiment); f. Sterilize and dry the scissors, forceps, and pipette tips in advance.

[0166] (1) Use tweezers to pick up the filter membrane and place it on aluminum foil until it is dry;

[0167] (2) Transfer the remaining liquid to a 2mL centrifuge tube, centrifuge at 15000g for 2min, discard the supernatant, and air bath at 56℃ to remove residual ethanol;

[0168] (3) Cut the dried filter membrane from (1) into small pieces and put it into the centrifuge tube from step (2);

[0169] (4) Add 180 μL Buffer ATL and 20 μL Proteinase K, vortex and then air bath at 56°C for 1-2 hours. Vortex multiple times during the process.

[0170] (5) After vortexing for 15 seconds, add 200 μL of Buffer AL, mix well, and incubate in an air bath at 56°C for 10 minutes.

[0171] (6) Add 200 μL of ethanol (96%-100%) and vortex until homogeneous;

[0172] (7) Transfer the mixture to the DNeasy Mini spin column using a pipette, centrifuge at 6000×g (8000rpm) for 1min, and discard the filtrate and collection tube;

[0173] (8) Place the spin column in a new collection tube, add 500uL Buffer AW1, centrifuge at 6000×g (8000rpm) for 1min, and discard the filtrate and collection tube;

[0174] (9) Place the spin column in a new collection tube, add 500uL Buffer AW2, centrifuge at 20000×g for 3min, and discard the filtrate and collection tube;

[0175] (10) Place the spin column in a new centrifuge tube, add 45 μL ddH2O to the DNeasy Mini spin column to elute the DNA, and centrifuge at 36000×g for 1 min at room temperature;

[0176] (11) The result is the target DNA.

[0177] S3.ddPCR amplification: PCR amplification is performed using an eDNA sample as a template.

[0178] Configure the dual-target PCR system: The reaction system for ddPCR amplification includes: 10 μL of 3× Maxuseful Buffer, 0.5 μL of Taq enzyme, 1.2 μL of F1 (10 μM), 1.2 μL of R1 (10 μM), 0.6 μL of P1 (10 μM), 1.2 μL of F2 (10 μM), 1.2 μL of R2 (10 μM), 0.6 μL of P2 (10 μM), 5 μL of eDNA template, and sterile enzyme-free water to a final volume of 30 μL.

[0179] Shake all components to mix well and place in a PCR instrument. PCR amplification program: 50℃ curing for 5 min; 95℃ pre-denaturation for 5 min; 95.0℃ denaturation for 10 s, 64℃ annealing for 45 s, cycle 45 times.

[0180] S4. Data Reading: Read the amplification products and obtain the copy number concentration on the analysis software after reading, thereby obtaining the DNA copy number concentration of Yangtze finless porpoise in the water sample of Wuhan Baiji Dolphinarium.

[0181] Test results: such as Figure 10 As shown, when 2 μL of template was loaded into a 30 μL system, the number of Yangtze finless porpoise eDNA copies in the water sample from the Wuhan Baiji Dolphin Museum detected by the dual-target system was approximately 15,000 copies / μL.

[0182] Example 9

[0183] The dual-target digital method was used to detect water samples from the main stream of the Yangtze River. The FP133+FP161 combination was used. The combined reaction system and combined reaction conditions were the same as in Example 2, and the operation steps were the same as in Example 7.

[0184] Test results: such as Figure 11 , Figure 12 and 13 As shown in the figure, PTC is the positive control and NTC is the blank control. It can be seen that the dual-target system detected all 39 water samples from the main stream of the Yangtze River as positive, and the detection rate of Yangtze finless porpoises was 100%. The detection of Yangtze finless porpoises in samples 16 and 36 relied on the mutual complementarity of the two targets, which shows that the dual-target digital system has the advantage of higher sensitivity in application.

[0185] Where there is no conflict, the above embodiments and features described herein can be combined with each other.

[0186] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of the present invention should be included within the protection scope of the present invention.

Claims

1. A method for detecting Yangtze finless porpoise environmental DNA by double-target digitalization, characterized in that, Includes the following steps: Collect environmental samples and extract environmental DNA; Using environmental DNA from environmental samples as a template, droplet digital PCR amplification was performed in a single reaction system using a combination of first and second primers and probes. Based on the fluorescence signal generated by droplet digital PCR, the absolute copy number is calculated using the Poisson distribution statistical formula through a data reading device to determine whether there is Yangtze finless porpoise DNA in the sample. The first primer-probe combination includes: The upstream primer has the nucleotide sequence shown in SEQ ID NO.3; The downstream primer has the nucleotide sequence shown in SEQ ID NO.4; The probe, whose nucleotide sequence is shown in SEQ ID NO.11; The second primer-probe combination includes: The upstream primer has the nucleotide sequence shown in SEQ ID NO.7; The downstream primer, whose nucleotide sequence is shown in SEQ ID NO.8; The probe, whose nucleotide sequence is shown in SEQ ID NO.12; The annealing temperature for the droplet digital PCR amplification was 64°C, and the final concentration of each probe in the single reaction system was 200 nM.

2. The method of claim 1, wherein, The probes in the primer-probe combination are modified with a fluorescent reporter group at the 5' end and a fluorescent quencher group at the 3' end; the fluorescent reporter group is selected from FAM, HEX, VIC or ROX, and the fluorescent quencher group is selected from BHQ1, BHQ2, TAMRA or MGB.

3. The method of claim 1, wherein, The environmental samples are selected from any one of the following: water samples, sediment samples, and biological vector samples.

4. The method of claim 3, wherein, Before DNA extraction, a pretreatment step is also included: when the environmental sample is a water sample, it is enriched by filtration using a filter membrane.

5. The method according to claim 1, characterized in that, The method has a detection rate of 100% when the template concentration is 0.2 copies / μL, and a detection rate of not less than 80% when the concentration is 0.1 copies / μL.

6. A primer-probe combination for detecting Yangtze finless porpoises, characterized in that, The primer-probe combination comprises the first primer-probe combination as described in claim 1 and / or the second primer-probe combination.

7. A reagent kit for detecting Yangtze finless porpoises, characterized in that, It comprises the primer-probe combination of claim 6, and a PCR reaction solution; the PCR reaction solution comprises DNA polymerase, dNTPs, and reaction buffer.

8. The application of the method of any one of claims 1-5 or the kit of claim 7 in the survey of Yangtze finless porpoise resources, habitat distribution assessment or illegal poaching monitoring.