A biomimetic ECM structure and its application in the field of skin anti-aging

Abstract

The application belongs to the technical field of daily skin care products, and relates to a kind of biomimetic ECM structure biological agent and its application in the field of skin anti-aging. The application simulates the components of skin natural ECM to prepare a biomimetic ECM structure biological agent, which mainly includes fibronectin rh FN-LN, collagen, glycoprotein, serum albumin, polyamino acid polysaccharide condensate, mannitol, trehalose and auxiliary materials. The auxiliary materials include elastin, decapeptide-4 and the like. The biomimetic ECM structure biological agent of the application is proved to have the effects of repairing, anti-aging and improving skin tightness through elastase inhibition rate test and human skin fibroblast proliferation test.

Description

Technical Field

[0001] This invention belongs to the field of daily skin care product technology, and relates to a biomimetic ECM structure biological agent and its application in the field of skin anti-aging. Background Technology

[0002] The skin consists of the epidermis, dermis, and subcutaneous adipose tissue, and contains appendages such as hair follicles and sweat glands. In the epidermis, keratinocytes constantly undergo metabolism, while hair follicles regenerate periodically. With age, the structure and function of the skin undergo profound changes, including thinning of the epidermis and dermis, loss of elasticity and wrinkling of the dermis, and graying and hair loss. Skin aging is induced by either internal aging (also known as time-related aging) or external aging caused by environmental factors such as air pollution and ultraviolet radiation. The damage theory is a widely accepted mechanism that accelerates skin aging, involving the accumulation of DNA damage caused by DNA replication errors, reactive oxygen species, telomere erosion, and chromosome breaks.

[0003] The extracellular matrix (ECM) is the part of a tissue that exists outside the cells. It forms an intricate 3D network structure, along with an invisible gel-like structure filling this network. The ECM is not merely a simple support structure for tissue cells; it is the microenvironment for cell survival, closely related to cell survival, regeneration, repair, and immune functions. These discoveries have laid the foundation for regenerative medicine and anti-aging. Modern science has also found that changes in the physical properties of the ECM, such as increased stiffness, may lead to the development and progression of diseases. The ECM is dynamic and constantly changing. Although the mechanisms by which each component of the ECM and its interrelationships are still being explored in greater depth, it is currently known to store and regulate growth factors and other bioactive molecules, and to participate in and regulate the mechanical and physiological / biochemical behaviors of tissue cells, including cell growth, differentiation, apoptosis, repair, and regeneration.

[0004] Skincare products with a biomimetic ECM structure can promote skin repair and regeneration by mimicking the components and three-dimensional structure of the skin's natural extracellular matrix. This accelerates the skin tissue repair and regeneration process, replenishes collagen and elastin, reduces wrinkles, improves skin laxity, enhances skin elasticity and firmness, strengthens the skin barrier, and improves water retention. Therefore, this invention aims to provide a biomimetic ECM structure biological agent that offers effective protection for improving skin aging and enhancing skin tissue repair. Summary of the Invention

[0005] Since there are currently no biomimetic ECM structure biological agents that can effectively improve skin aging and enhance the skin tissue repair ability, this invention provides a biomimetic ECM structure biological agent and its application in the field of skin anti-aging.

[0006] To achieve the above objectives, the technical solution of the present invention is implemented as follows:

[0007] In a first aspect, the present invention provides a fibronectin rh FN-LN, the amino acid sequence of which is shown in SEQ ID NO.2.

[0008] Furthermore, the nucleotide sequence of the fibronectin rh FN-LN is shown in SEQ ID NO.1.

[0009] Furthermore, the fibronectin rh FN-LN is a fusion protein of recombinant human fibronectin and the EGF domain of laminin.

[0010] In a second aspect, the present invention provides a composition comprising the fibronectin rh FN-LN.

[0011] Furthermore, the composition is a composition with a biomimetic ECM structure.

[0012] Furthermore, the composition of the biomimetic ECM structure comprises fibronectin rh FN-LN, collagen, glycoprotein, serum albumin, polyamino acid polysaccharide condensate, mannitol, and trehalose.

[0013] Furthermore, the mass ratio of fibronectin rh FN-LN, collagen, glycoprotein, serum albumin, polyamino acid polysaccharide condensate, mannitol, and trehalose is 6-10:3-7:1-7:0.1-0.8:0.5-3:0.2-1:2-5.

[0014] Furthermore, the mass ratio of fibronectin rh FN-LN, collagen, glycoprotein, serum albumin, polyamino acid polysaccharide condensate, mannitol, and trehalose is 7-9:4-6:3-6:0.3-0.7:1-2:0.4-0.8:3-4.

[0015] Furthermore, the mass ratio of fibronectin rh FN-LN, collagen, glycoprotein, serum albumin, polyamino acid polysaccharide condensate, mannitol, and trehalose is 8:5:4:0.5:1.5:0.6:3.5.

[0016] Furthermore, the collagen is selected from the group consisting of type I, type III, type IV, type V, type VI, type IX, type XII and type XVII.

[0017] Furthermore, the collagen is type I, type III, or type XVII.

[0018] Furthermore, the mass ratio of type I, type III, and type XVII of the collagen is 1:2:2.

[0019] Thirdly, the present invention provides a biomimetic ECM structure biological agent comprising fibronectin rh FN-LN, collagen, glycoprotein, serum albumin, polyamino acid polysaccharide condensate, mannitol, trehalose, and excipients.

[0020] Furthermore, the total amount of fibronectin rh FN-LN, collagen, glycoprotein, serum albumin, polyamino acid polysaccharide condensate, mannitol, and trehalose added to the biological agent is 0.1-20%; preferably 0.5-15%; more preferably 1-10%.

[0021] Furthermore, the mass ratio of fibronectin rh FN-LN, collagen, glycoprotein, serum albumin, polyamino acid polysaccharide condensate, mannitol, and trehalose is 6-10:3-7:1-7:0.1-0.8:0.5-3:0.2-1:2-5.

[0022] Furthermore, the mass ratio of fibronectin rh FN-LN, collagen, glycoprotein, serum albumin, polyamino acid polysaccharide condensate, mannitol, and trehalose is 7-9:4-6:3-6:0.3-0.7:1-2:0.4-0.8:3-4.

[0023] Furthermore, the mass ratio of fibronectin rh FN-LN, collagen, glycoprotein, serum albumin, polyamino acid polysaccharide condensate, mannitol, and trehalose is 8:5:4:0.5:1.5:0.6:3.5.

[0024] Furthermore, the collagen is selected from the group consisting of type I, type III, type IV, type V, type VI, type IX, type XII and type XVII.

[0025] Furthermore, the collagen is type I, type III, or type XVII.

[0026] Furthermore, the mass ratio of type I, type III, and type XVII of the collagen is 1:2:2.

[0027] Furthermore, the excipients are selected from one or more of elastin, decapeptide-4, sodium chloride, glycerol, 1,2-hexanediol, 1,2-pentanediol, and purified water.

[0028] Fourthly, the present invention provides the use of a composition with a biomimetic ECM structure in the preparation of a skin anti-aging formulation, the composition comprising the fibronectin rh FN-LN.

[0029] Furthermore, the composition of the biomimetic ECM structure includes fibronectin rh FN-LN, collagen, glycoprotein, serum albumin, polyamino acid polysaccharide condensate, mannitol, and trehalose.

[0030] Furthermore, the mass ratio of fibronectin rh FN-LN, collagen, glycoprotein, serum albumin, polyamino acid polysaccharide condensate, mannitol, and trehalose is 6-10:3-7:1-7:0.1-0.8:0.5-3:0.2-1:2-5.

[0031] Furthermore, the collagen is type I, type III, or type XVII.

[0032] Furthermore, the mass ratio of type I, type III, and type XVII of the collagen is 1:2:2.

[0033] Furthermore, the amount of the biomimetic ECM structure composition added to the skin anti-aging preparation is 0.1-20%; preferably 0.5-15%; more preferably 1-10%.

[0034] Furthermore, the skin anti-aging preparation also contains excipients.

[0035] Furthermore, the excipients are selected from one or more of elastin, decapeptide-4, sodium chloride, glycerol, 1,2-hexanediol, 1,2-pentanediol, and purified water.

[0036] Fifthly, the present invention provides the use of a composition with a biomimetic ECM structure in the preparation of skin repair and / or skin tightening formulations, the composition comprising the fibronectin rh FN-LN.

[0037] Furthermore, the composition of the biomimetic ECM structure includes fibronectin rh FN-LN, collagen, glycoprotein, serum albumin, polyamino acid polysaccharide condensate, mannitol, and trehalose.

[0038] Furthermore, the mass ratio of fibronectin rh FN-LN, collagen, glycoprotein, serum albumin, polyamino acid polysaccharide condensate, mannitol, and trehalose is 6-10:3-7:1-7:0.1-0.8:0.5-3:0.2-1:2-5.

[0039] Furthermore, the amino acid sequence of the fibronectin rh FN-LN is shown in SEQ ID NO.2.

[0040] Furthermore, the nucleotide sequence of the fibronectin rh FN-LN is shown in SEQ ID NO.1.

[0041] Furthermore, the biomimetic ECM structure composition is added to skin repair and / or skin firming preparations at an amount of 0.1-20%; preferably 0.5-15%; more preferably 1-10%.

[0042] Furthermore, the skin repair and / or skin firming formulation also contains excipients.

[0043] Furthermore, the excipients are selected from one or more of elastin, decapeptide-4, sodium chloride, glycerol, 1,2-hexanediol, 1,2-pentanediol, and purified water.

[0044] The beneficial technical effects of this invention are as follows: the recombinant human fibronectin and the fibronectin rh FN-LN of the laminin EGF domain exhibit high repair potential in cell scratch healing ability. The fibronectin rh FN-LN is combined with collagen, glycoprotein, serum albumin, polyamino acid polysaccharide condensate, mannitol, and trehalose to obtain a composition with a biomimetic ECM structure. The efficacy of repair, anti-aging, and skin firmness improvement is confirmed by elastase inhibition rate test and human skin fibroblast proliferation experiment. Attached Figure Description

[0045] Figure 1 Cell scratch healing rate.

[0046] Figure 2 Elastase inhibition rate.

[0047] Figure 3 Human skin fibroblast proliferation rate. Detailed Implementation

[0048] To better understand the technical content of this invention, the invention will be further described and explained below in conjunction with specific embodiments. Obviously, the embodiments described below are only some embodiments of this invention, and not all embodiments. Based on the embodiments of this invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of this invention.

[0049] Example 1: Preparation method of fibronectin rhFN-LN

[0050] S1. Nucleotide sequence of the synthetic fusion protein: The nucleotide sequence of the artificially synthesized fusion protein (rh FN-LN) of recombinant human fibronectin and laminin EGF domain was optimized for host cell expression codons. The optimized nucleotide sequence is shown in SEQ ID NO.1 and the amino acid sequence is shown in SEQ ID NO.2.

[0051] S2. Construction of recombinant plasmid: XhoI and XbaI restriction sites were added to the 5' and 3' ends of the synthesized rh FN-LN nucleotide sequence, respectively. The expression vector pPICZαA was digested with XhoI and XbaI and recovered. The recovered fragments were ligated with the synthetic product using T4 DNA ligase to construct the recombinant plasmid pPICZαA-rh FN-LN.

[0052] S3. Transform the recombinant plasmid into the host cell: Linearize the recombinant plasmid pPICZαA-rh FN-LN with SalI enzyme, and after recovery, mix it with Pichia pastoris X33 competent cells at a ratio of recombinant plasmid:host cell = 1 μg: 8 μL. Transfer the mixture to a pre-cooled electroporation cuvette, electroporate for 10 ms, add pre-cooled sorbitol solution (1.0 mol / L), mix well, spread on YPD medium, and incubate upside down until a single colony grows on the medium.

[0053] S4. Screening of recombinant expression bacteria: Using clones on YPD plates as templates, add 0.5 μL each of upstream and downstream primers (primer F: cattctcgagatgtgtgactgcgatcctg; primer R: catttctagaaggtttgtcaatttcggtcctg) at a concentration of 10 μM at both ends, premix the enzyme with Premix Taq™ (TaKaRa Taq™ Version 2.0plus dye), add water to a total volume of 20 μL, and amplify the target fragment according to the PCR reaction conditions (denaturation at 95℃ for 10 min followed by cycling, cycling parameters: denaturation at 95℃ for 60 s, annealing at 55℃ for 30 s, extension at 70℃ for 45 s, 32 cycles).

[0054] S5. Expression of fusion protein: The screened positive transformant strains were inoculated into BMGY medium and cultured at 30℃ and 220 rpm for 24 h. The resulting seed culture was then inoculated into a fermenter containing BMGY medium and cultured for another 24 h at 30℃ and pH 6.0. When the glycerol in the medium was depleted and the dissolved oxygen in the fermenter increased, methanol was added for induction. After 72 h of induction, the fermenter was removed from the fermenter.

[0055] S6. Purification of recombinant human fibronectin rhFN-LN: After centrifugation of the fermentation broth, the precipitate was discarded and the supernatant was collected. The affinity chromatography column was pre-equilibrated with equilibration buffer. The recombinant fusion protein carrying the His-tag was separated and purified by nickel column affinity chromatography. The recombinant fusion protein was then eluted with 3 column volumes of elution buffer, and the eluent was collected. The molecular weight of the recombinant fusion protein was verified by SDS-PAGE protein gel chromatography. After successful verification, the purified fusion protein sample was desalted using a G25 column to obtain high-purity fibronectin rhFN-LN with a molecular weight of 23.7 g / mol.

[0056] Example 2: Preparation method of recombinant human fibronectin (rhFN)

[0057] The nucleotide sequence of the artificially synthesized recombinant human fibronectin is shown in SEQ ID NO.3 (CN110590939A). Recombinant human fibronectin rhFN was expressed using a construction method similar to that in Example 1.

[0058] Example 3: Test of Cellular Wound Healing Capacity

[0059] Draw horizontal lines on the back of a six-well plate using a marker, with a distance of 0.5 cm between each line. Draw five horizontal lines per well, with the central line being the same length as the diameter of the six-well plate. Trypsinize HaCaT cells to prepare a cell suspension. After cell counting, seed the cells, ensuring a consistent seeding density across all wells. The principle for cell seeding density is that the confluence rate reaches 100% overnight. Once the cells have confluently grown to the bottom of the plate, use a 100 μL pipette tip perpendicular to the wells and the horizontal lines to create cell scratches, ensuring the scratches intersect the marking lines perpendicularly and that the scratch width is consistent across all wells. Aspirate the original culture medium, wash the cells with PBS to remove scratched cells and debris, and then add low-serum culture medium (1% serum concentration) containing 15 ng / mL rhFN-LN or rhFN. A blank control group (low-serum culture medium only) is also included. Incubate the plates for 24 hours, then remove them and photograph the data. Calculate the cell scratch healing rate.

[0060] Scratch healing rate = The results are shown in Table 1.

[0061] Table 1. Cell scratch healing rate (n=4)

[0062] Group Cell scratch healing rate (%) Blank control 40.75±5.12 rhFN 73.16±4.93 rh FN-LN 84.09±5.38

[0063] The cell scratch assay can reflect the self-repair ability in wound healing. The test results showed that the rh FN-LN group had a higher scratch healing rate than the rhFN group (p<0.01), indicating that fibronectin rh FN-LN has a higher repair potential in cells or tissues.

[0064] Example 4 Preparation of working solution

[0065] Structurally, the ECM in the dermis mainly consists of three parts: structural proteins, linking / adhesive proteins, and an amorphous gel-like structure. The structural proteins are primarily collagen and elastin, the linking / adhesive proteins are mainly fibronectin and laminin, and the amorphous gel-like structure contains a large amount of proteoglycans, glycoproteins, aminopolysaccharides, proteases, and bioactive molecules. This study aims to mimic the components of the skin's natural ECM to prepare biomimetic ECM structures.

[0066] The biomimetic ECM structure composition comprises fibronectin rh FN-LN, collagen, glycoprotein, serum albumin, polyamino acid polysaccharide condensate, mannitol, and trehalose. The mass ratio of fibronectin rh FN-LN, collagen, glycoprotein, serum albumin, polyamino acid polysaccharide condensate, mannitol, and trehalose is 8:5:4:0.5:1.5:0.6:3.5; wherein the collagen is composed of type I, type III, and type XVII collagen in a mass ratio of 1:2:2. Each component of the biomimetic ECM structure composition is weighed according to the mass ratio and dissolved in 0.1 mol / L acetic acid solution to prepare a 1.0 mg / mL working solution for later use.

[0067] The control composition was prepared according to the above method, except that recombinant human fibronectin (rh FN) prepared in Example 2 was used instead of fibronectin rh FN-LN. Each component was weighed according to the mass ratio and dissolved in 0.1 mol / L acetic acid solution to prepare a 1.0 mg / mL control working solution for later use.

[0068] Example 5: Elastase Inhibition Rate Test

[0069] The experimental principle of elastase inhibition is that porcine pancreatic elastase undergoes a catalytic reaction with its substrate. The absorbance changes after the addition of the active substance, and the magnitude of this change reflects the inhibition rate of the elastase inhibitor. This experiment followed the laboratory method (HMC-WI-028 elastase inhibition rate), comparing the elastase inhibition rate results of the test group and the negative group to evaluate the anti-wrinkle effect of the biomimetic ECM structure composition. The test results are shown in Table 2.

[0070] Negative group: Dilute 0.1 mol / L acetic acid solution to a concentration of 10% (v / v) with PBS buffer;

[0071] Positive group: Prepare 0.5% (m / v) EGCG solution using PBS buffer;

[0072] Test group: The working solution prepared in Example 4 was diluted to a concentration of 10% (v / v) with PBS buffer;

[0073] Control group: The control working solution prepared in Example 4 was diluted with PBS buffer to a concentration of 10% (v / v).

[0074] Table 2. Elastase inhibition rate (n=6)

[0075] Group Elastase inhibition rate (%) negative group -2.191±3.857 positive group 86.724±6.103 Test group 73.088±5.981 control group 64.415±6.343

[0076] Elastase inhibition rate assay is an authoritative in vitro test for characterizing the anti-wrinkle efficacy of cosmetics. The test results show that the composition with the biomimetic ECM structure of this invention can significantly inhibit elastase, with an inhibition rate as high as 73.08%, which is statistically different from the control group (P<0.01), confirming the anti-wrinkle efficacy of the composition with the biomimetic ECM structure. Using skincare products containing the composition with the biomimetic ECM structure of this invention can delay aging and reduce wrinkles.

[0077] Example 6: Human skin fibroblast proliferation assay

[0078] Human skin fibroblasts (HSF cells) are a crucial cell type in the skin. Their primary function is to synthesize and secrete structural proteins such as collagen and elastin, providing the skin with strength and elasticity. HSF cells also participate in the skin's wound repair process; when the skin is injured, fibroblasts proliferate and migrate to the site of injury, participating in the formation and repair of new tissue. The repair and firming effects of the biomimetic ECM structure composition of this invention were evaluated using an HSF cell proliferation assay.

[0079] Well-grown primary human skin fibroblasts (purchased from Stemer (Shanghai) Biotechnology Co., Ltd., catalog number STM-CE-1005) were selected, digested, and cultured in complete cell culture medium (DMEM medium containing 10% FBS) to prepare approximately 2×10⁶ cells / year. 4 Cells were seeded at a density of 150 μL / mL into 96-well plates, with 150 μL of sterile PBS added to each well. The plates were incubated for 24 h, after which cell confluence should reach approximately 30%. The culture medium was then aspirated, and the plates were replaced and sample added according to Table 3. The plates were incubated for another 48 h. After 48 h, the 96-well plates were removed, and the MTT assay was used to detect cell proliferation. The absorbance at 490 nm was read using a microplate reader, and the cell proliferation rate was calculated. Results are shown in [Table 3]. Figure 3 .

[0080] Table 3 Grouping of Liquid Replacement and Sampling

[0081] Grouping Solution replacement and sample addition treatment Blank group Complete cell culture medium + 0.1 mol / L acetic acid solution to a final concentration of 0.5%. High concentration test group Complete cell culture medium + working solution of Example 4 with a final concentration of 1.0% Low concentration test group Complete cell culture medium + working solution of Example 4 with a final concentration of 0.5% Control group Complete cell culture medium + control working solution of Example 4 at a final concentration of 0.5%.

[0082] Based on in vitro testing results of the repair and firming effects of human skin fibroblast proliferation, the composition with the biomimetic ECM structure of this invention can significantly promote HSF cell proliferation, and the proliferation effect is positively correlated with the dosage, confirming the repair and firming effects of the composition with the biomimetic ECM structure. Skincare products containing the composition with the biomimetic ECM structure of this invention can promote repair and improve skin elasticity and firmness.

[0083] The above description, in conjunction with specific preferred embodiments, provides a further detailed explanation of the present invention. It should not be construed that the specific implementation of the present invention is limited to these descriptions. For those skilled in the art, various simple deductions or substitutions can be made without departing from the concept of the present invention, and all such modifications and substitutions should be considered within the scope of protection of the present invention.

Claims

1. A recombinant human fibronectin (rh FN-LN) comprising, The amino acid sequence of the fibronectin is shown as SEQ ID NO.

2.

2. The fibronectin rh FN-LN of claim 1, wherein, The nucleotide sequence of the fibronectin is shown as SEQ ID NO.

1.

3. A composition of biomimetic ECM structure, characterized in that, The composition comprises fibronectin rh FN-LN, and the amino acid sequence of the fibronectin rh FN-LN is shown as SEQ ID NO.

2.

4. The composition of claim 3, wherein the composition of the biomimetic ECM structure comprises fibronectin rh FN-LN, collagen, glycoprotein, serum albumin, polyamino acid polysaccharide condensate, mannitol, and trehalose.

5. The composition of claim 4, wherein The mass ratio of the fibronectin rh FN-LN, collagen, glycoprotein, serum albumin, polyamino acid polysaccharide condensate, mannitol, and trehalose is 6-10:3-7:1-7:0.1-0.8:0.5-3:0.2-1:2-5.

6. The composition of claim 5, wherein, The collagen is selected from the group consisting of type I, type III, type IV, type V, type VI, type IX, type XII, and type XVII.

7. A biomimetic ECM structure characterized in that, The composition comprises fibronectin rh FN-LN, collagen, glycoprotein, serum albumin, polyamino acid polysaccharide condensate, mannitol, trehalose, and adjuvant, and the amino acid sequence of the fibronectin rh FN-LN is shown as SEQ ID NO.

2.

8. The biological agent of claim 7, wherein the adjuvant is selected from one or more of elastin, decapeptide-4, sodium chloride, glycerol, 1,2-hexanediol, 1,2-pentanediol, and purified water.

9. Use of the composition of the biomimetic ECM structure of claim 3 in the preparation of a skin anti-aging agent.

10. Use of the composition of the biomimetic ECM structure of claim 3 in the preparation of a skin repair and / or skin tightening agent.

Images