Construction method of GFP (Green Fluorescent Protein) labeled Elizabeth mileli and application of GFP labeled Elizabeth mileli in detection of survival dynamics of intracellular bacteria

By constructing a GFP-labeled strain of Elizabethan mil by transposon insertion technology, the problem of dynamic monitoring of Elizabethan mil infection in macrophages was solved, enabling real-time, in situ tracking of intracellular bacterial survival dynamics and analysis of interaction mechanisms.

CN121472278APending Publication Date: 2026-02-06HUAZHONG AGRI UNIV
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202511434632.3
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-10-09
Publication Date
2026-02-06

AI Technical Summary

Technical Problem

Existing technologies cannot effectively construct GFP-labeled strains of Elizabethan mil, making it difficult to monitor its infection dynamics within macrophages and its interaction mechanisms with host cells in real time.

Method used

An engineered strain of Elizabethan miernea stably expressing green fluorescent protein was constructed using transposon insertion technology. The GFP gene was efficiently integrated and stably expressed by conjugating the recombinant plasmid GFP-pSAM-Spc-Amp-RpsLpro with Elizabethan miernea.

Benefits of technology

It provides a real-time, in-situ visualization research platform that can continuously track the survival status and proliferation dynamics of Elizabethan mil within macrophages, and analyze its survival strategies and anti-killing mechanisms within macrophages.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121472278A_ABST
    Figure CN121472278A_ABST
Patent Text Reader

Abstract

The invention discloses a construction method of GFP (Green Fluorescent Protein) labeled Elizabeth mileli and an application of the GFP labeled Elizabeth mileli in detection of survival dynamics of intracellular bacteria. On the basis of a transposon-mediated random insertion technology, a promoter and a green fluorescent protein gene are integrated into a chromosome of an Elizabingia milieri FL160902 strain, and a transposon mutant strain library marked by GFP is constructed. The GFP high-expression mutant strain is obtained through quantitative screening of a fluorescence microplate reader, and the mutant strain presents a bright and stable green fluorescence signal under a fluorescence detection device. The GFP labeled strain can be applied to an RAW264.7 macrophage infection model, and real-time visual monitoring of intracellular survival and proliferation dynamics of bacteria is realized. According to the invention, an efficient fluorescent protein GFP labeling system of Elizabeth milieri is established, and a key research tool is provided for analyzing the survival dynamic state of Elizabeth milieri in macrophages and an anti-cell killing mechanism of Elizabeth milieri.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The application belongs to the technical field of microorganism detection, and particularly relates to a construction method of GFP-labeled Elizabethkingia miricola and application in detection of intracellular bacteria survival dynamics. BACKGROUND

[0002] Elizabethkingia miricola is the main pathogen of frog meningitis septicemia (commonly known as "crooked head disease"), which can infect various farmed and wild frogs and cause great economic losses. Elizabethkingiamiricola After being infected by Elizabethkingia miricola, frogs can survive in macrophages, but the interaction between the bacteria and macrophages and the mechanism of anti-macrophage killing are still unclear.

[0003] The infection of intracellular bacteria is a continuous, complex and dynamic multi-stage process. Traditional biological research methods rely on static analysis of fixed cell samples, which has inherent limitations: the destructiveness of sample preparation distorts the physiological state of cells; sampling at discrete time points cannot capture the continuous infection dynamics; especially at the single cell level, it is difficult to realize real-time in-situ monitoring of bacterial-host interaction. Bacterial tracking technology labels target pathogenic bacteria with specific markers, providing a key research tool for analyzing the infection process of bacteria in cells and their interaction mechanisms with cells.

[0004] Green fluorescent protein (GFP) has the advantages of high fluorescence stability, wide applicability and real-time detection support, and has become an ideal reporter gene for bacterial labeling. The tracking system based on GFP can visualize the colonization, replication, migration and diffusion process of intracellular bacteria by real-time monitoring of fluorescence signal changes.

[0005] Although GFP labeling technology has been widely used in the study of various pathogenic bacteria, a GFP-labeled strain of Elizabethkingia miricola has not been successfully constructed. Due to the lack of a corresponding fluorescently labeled strain, it is difficult to explore the infection dynamic process of the bacteria in macrophages through direct technical means, and it is also impossible to monitor the interaction mechanism between the bacteria and host cells in real time. Therefore, establishing an efficient GFP labeling technology for Elizabethkingia miricola provides an important research tool for monitoring the survival dynamics and colonization characteristics of the bacteria in macrophages, and lays a scientific foundation for analyzing the immune evasion mechanism of Elizabethkingia miricola and developing prevention and control strategies. SUMMARY

[0006] The present application aims to construct an Elizabethkingia miricola engineering strain stably expressing green fluorescent protein, which provides a visual research tool for analyzing the survival dynamics and anti-cell killing mechanism of the bacteria in macrophages.

[0007] An object of the present application is to provide a method for constructing GFP-labeled Mycobacterium iranicum. The method is based on transposon insertion technology, has the characteristics of simple and efficient operation process and high transformation efficiency, and can obtain a single clone strain with stable high expression of GFP through screening. The genetically engineered strain has excellent genetic stability, and the GFP expression unit can be stably inherited without continuous antibiotic selection pressure, significantly reducing the complexity and cost of long-term experiments.

[0008] Another object of the present application is to provide an application of GFP-labeled Mycobacterium iranicum in detecting intracellular bacterial survival dynamics. This application is particularly suitable for real-time, in-situ visualization monitoring of the dynamic processes of intracellular survival, replication and spread of Mycobacterium iranicum in a macrophage model. This technology overcomes the limitations of traditional detection methods (such as colony counting method and electron microscope observation) which are strongly destructive, have discrete sampling points and cannot continuously track bacterial dynamic changes at the single cell level. It provides an intuitive visualization research platform for in-depth analysis of the survival strategy of Mycobacterium iranicum in macrophages and the potential molecular mechanisms of its resistance to macrophage killing.

[0009] The technical solution of the present application is a method for constructing GFP-labeled Mycobacterium iranicum, comprising the following steps: 1. Construction of recombinant plasmid GFP-pSAM-Spc-Amp-RpsLpro; 1.1. Using plasmid GFP-PUC-SP as a template, primer Pro- gfp -F / R is used to amplify the promoter- gfp fusion fragment; 1.2. According to the multiple cloning site of pSAM-Spc-Amp-RpsLpro, the plasmid pSAM-Spc-Amp-RpsLpro is digested with restriction enzyme XbaI to obtain a linearized vector; 1.3. The linearized vector obtained in step 1.2 and the promoter- gfp fusion fragment obtained in step 1.1 are ligated by homologous recombination enzyme to transform competent cells, and positive clones containing the recombinant plasmid GFP-pSAM-Spc-Amp-RpsLpro are screened to obtain the E. coli S17-1 λpir strain, and the recombinant plasmid GFP-pSAM-Spc-Amp-RpsLpro is extracted.

[0010] Preferably, the promoter- gfp fusion fragment obtained in step 1.1 is ligated with the linearized vector obtained in step 1.2 to transform competent cells E. coliS17-1 λpir, which was identified after being cultured in a BHI plate containing 100 μg / mL ampicillin at 37°C for 16 h, was used as the positive clone.

[0011] 2. The recombinant plasmid GFR-pSAM-Spc-Amp-RpsLpro obtained in step 1 was introduced into the Elizabethkingia miricola strain by conjugation transfer to obtain a GFR-labeled transposon mutant strain library. Specifically, the recombinant plasmid GFR-pSAM-Spc-Amp-RpsLpro obtained in step 1 was used as the donor bacteria, and the Elizabethkingia miricola was used as the donor bacteria for conjugation transfer. E. coli S17-1 λpir was used as the donor bacteria, and the Elizabethkingia miricola was used as the donor bacteria for conjugation transfer, and a GFR-labeled transposon mutant strain library was obtained by random insertion of the transposon into the strain genome.

[0012] Specifically, 2.1. The donor bacteria and the recipient bacteria were cultured overnight to the logarithmic phase. 2.2. The donor bacteria and the recipient bacteria were mixed at a volume ratio of 1:1 to 4:1: preferably, the volume ratio was 2:1; 0.5-2 mL of the donor bacteria and 0.5 mL of the recipient bacteria were taken in a sterile centrifuge tube, centrifuged at 5000 r / min for 5 min, the supernatant was discarded, 100 μL of BHI was added to resuspend the bacterial cells, and the mixed bacterial solution was dropped on a BHI plate with a nitrocellulose membrane, which was cultured at 37°C for 24 h. 2.3. The bacterial lawn on the membrane was washed with BHI liquid medium, and was plated on a BHI plate containing 100 μg / mL spectinomycin and 50 μg / mL meropenem to screen positive conjugants (i.e., transposon insertion mutant strains). 2.4. The positive conjugants obtained in step 2.3 were picked for bacterial liquid PCR verification, and primers Pro-F / R were used for verification. gfp Double primers Pro-F / R and Pro-F / R were used for Elizabethkingia miricola species identification to obtain GFR-labeled Elizabethkingia miricola mutant strains. ureG PNGase F Double primers Pro-F / R and Pro-F / R were used for Elizabethkingia miricola species identification to obtain GFR-labeled Elizabethkingia miricola mutant strains.

[0013] 3. Fluorescent signal detection and screening of GFR-labeled Elizabethkingia miricola mutant strains 3.1. Each GFR-labeled Elizabethkingia miricola mutant strain obtained in step 2 was cultured overnight at 37°C at 200 r / min to the logarithmic growth phase. 3.2. Each GFR-labeled Elizabethkingia miricola mutant strain was washed with sterile PBS buffer for 3 times, and was inoculated into PBS buffer at a ratio of 1:100, and the bacterial suspension was vortexed to obtain a fluorescent intensity sample. ​3.3. 200 μL of each bacterial suspension was added to a sterilized 96-well plate, and the fluorescence intensity of each mutant strain suspension was detected using a microplate reader; preferably, the excitation wavelength was set to 488 nm, the emission wavelength was set to 532 nm, and PBS buffer was used as a negative control; 3.4. The relative fluorescence value of each mutant strain was analyzed, and the fluorescence signal of the GFP-labeled Myroides luteus was observed using a fluorescence device; the mutant strain with the highest relative fluorescence value was 6.31 x 10 3 , and this strain was the GFP-labeled Myroides luteus.

[0014] Preferably, the Myroides luteus described above is Myroides luteus strain FL160902.

[0015] Preferably, the PCR amplification conditions in step 1.1 are as follows: 94°C pre-denaturation for 5 min; 94°C denaturation for 30 s, 55°C annealing for 40 s, 72°C extension for 60 s, 30 cycles; finally, 72°C extension for 10 min; and 16°C incubation.

[0016] Preferably, the enzyme digestion system in step 1.2 is as follows: Enzyme digestion system Volume 10 x Quick Cut buffer 3 μL pSAM-Spc-Amp-RpsLpro 1 μg Quick Cut XbaI 1 μL ddH2O to 30 μL Enzyme digestion reaction conditions: 37°C for 30 min.

[0017] Preferably, the ligation system in step 1.3 is as follows: Ligation system Volume 2 x MultiF Seamless Assembly Mix 10 μL Linearized pSAM-Spc-Amp-RpsLpro 150 ng Pro-gfp 50 ng ddH2O to 20 μL Recombination reaction conditions: 50°C for 30 min.

[0018] The primers used in the above method are as follows: Primer Sequence (5'-3') Pro-gfp-F CTTTTAAAACTACTGTCTAGACGGGTCCCTTGCCACA Pro-gfp-R TCCCTACTCTCGCATTCTAGACTCGTCGTGCCCTCTA ureG-F TCTGGAAAACGTGCTGCTAA ureG-R TGTGGGTTCTGGTAAAACTGC PNGase F-F GACAGGATCTGGGTCTGGTA PNGase F-R CTTTGGCTGCTTCCTTCC The application also provides a GFP-labeled Elizabethkingia miricola for use in a macrophage infection model; comprising the following steps: (1) culturing the GFP-labeled Elizabethkingia miricola to the logarithmic growth phase, washing it three times with a PBS buffer, and preparing a bacterial suspension; (2) infecting macrophage RAW264.7 with the bacterial suspension obtained in step (1) at a multiplicity of infection of 20:1, washing it three times with PBS after 2 hours of infection, adding DMEM medium containing 10% FBS and 500 μg / mL gentamicin for 1 hour to remove extracellular non-integrated bacteria, at which time it is defined as 0 hours after infection; thereafter, the infected cells are continuously cultured in a medium containing 50 μg / mL gentamicin; (3) using a live cell time-lapse microscopy system to monitor and record the spatiotemporal distribution and proliferation of the bacteria in the macrophages within 24 hours after infection, and as the intracellular survival time is prolonged, the fluorescence signal of the Elizabethkingia miricola gradually increases, and bacterial clusters are formed at 24 hours.

[0019] Compared with the prior art, the application has the following advantages and effects: 1. The genetically stable engineering bacteria: the GFP expression frame is stably inserted into the chromosome of Elizabethkingia miricola by a chromosome integration method. This method effectively avoids the inherent defects of a plasmid-based labeling system, such as plasmid loss and genetic instability, and ensures long-term, stable genetic and expression of the GFP label during bacterial cell division and continuous passage.

[0020] 2. Efficient and simple construction method: the transposon-mediated chromosome integration technology is used to realize efficient integration of the GFP gene. This method has the advantages of simple operation, high integration efficiency, and short construction cycle. It also has wide applicability and can be applied to other species of Elizabethkingia.

[0021] 3. Support for long-period dynamic observation: the labeling based on chromosome integration does not need to rely on antibiotics to maintain its stability. This feature greatly facilitates long-period research in complex physiological environments (such as macrophage infection models), effectively eliminates the interference of exogenous antibiotics on the physiological state of host cells or bacteria themselves, and ensures the authenticity of the observation results.

[0022] 4. Efficient tool for analyzing the survival dynamics of intracellular bacteria: The GFP-labeled strain constructed by the present application provides a key platform for real-time, in situ study of the interaction mechanism of M. mirabilis and macrophages. It can accurately and continuously track the survival status and proliferation dynamics of bacteria in macrophages, laying a technical foundation for exploring the pathogenic mechanism of M. mirabilis. BRIEF DESCRIPTION OF DRAWINGS

[0023] Figure 1 Figure 1 is a map of the recombinant plasmid GFP-pSAM-Spc-Amp-RpsLpro. Figure 2 Figure 2 is a PCR identification diagram of 85 GFP-labeled mutant strains; wherein, A: pro- gfp gene primer verification; B: M. mirabilis double PCR identification; lanes 1-12 are GFP random insertion mutant strains, lane 13 (NC) is a positive control, and lane 14 (NP) is a negative control; Figure 3 Figure 3 is a fluorescence intensity analysis diagram of 85 GFP-labeled mutant strains. Figure 4 Figure 4 is a fluorescence flashlight and fluorescence microscope observation of the GFP-labeled strain; wherein, A: wild strain FL160902; B: GFP-labeled strain; C: white light channel; D: fluorescence channel. Figure 5 Figure 5 is a fluorescence microscopic dynamic observation of the GFP-labeled strain in macrophages. DETAILED DESCRIPTION

[0024] The present application uses M. mirabilis FL160902 as an example to further illustrate the present application; M. mirabilis FL160902 source: preserved in the Aquatic Animal Disease Prevention and Health Aquaculture Laboratory of Huazhong Agricultural University; Whole genome information has been published: Hu Rixue. Identification, molecular epidemiology and carbapenemase diversity of frog Elizabethkingia [D]. Hubei: Huazhong Agricultural University, 2020.

[0025] E. coli S17-1 λpir source: purchased from Weidi Biological Company.

[0026] Plasmid GFP-PUC-SP source: synthesized by Shenguo Bioengineering Co., Ltd.; wherein, PUC-SP is a commercial cloning plasmid provided by Shenguo Bioengineering Co., Ltd.; the GFP sequence is shown as SEQ ID NO. 2; the plasmid is synthesized by Shenguo Bioengineering Co., Ltd. by connecting the GFP sequence to the commercial plasmid PUC-SP, and the GFP fragment will be amplified using this plasmid as a template in the future.

[0027] The suicide plasmid pSAM-Spc-Amp-RpsLpro is derived from Deng Xiaojian, "Construction and Biological Characteristics of OMP85 and OMP76 Gene-Deleted Strains of Riemerella anatipestifer" [D]. Hubei: Huazhong Agricultural University, 2020. It was kindly provided by Associate Professor Zhou Zutao of Huazhong Agricultural University, and its complete genome sequence is SEQ ID NO.3.

[0028] Brain Heart Infusion (BHI) medium was purchased from Qingdao Haibo Company; agar powder was purchased from Bioroxx AG, Germany.

[0029] BHI liquid culture medium: Dissolve 38.5 g of BHI powder in 800 mL of distilled water, bring the volume up to 1 L, dispense into containers, and autoclave at 121 °C for 25 min. BHI solid medium: 1.5% agar powder is added to its liquid medium, and then it is sterilized by high temperature and high pressure steam.

[0030] Example 1: This embodiment provides a method for GFP-labeled Elizabethan mil, specifically including the following steps: 1. Construction of recombinant plasmid GFP-pSAM-Spc-Amp-RpsLpro The suicide plasmid pSAM-Spc-Amp-RpsLpro, containing transposons, was selected as a vector. The promoter and green fluorescent protein gene were cloned into this vector, and the construction method is as follows: (1.1) Using plasmid GFP-PUC-SP as a template, primer Pro- gfp -F / R, amplification yields the promoter- gfp Fusion fragments, amplified fragments purified using a gel extraction kit; (1.2) Based on the multiple cloning restriction site of pSAM-Spc-Amp-RpsLpro, the plasmid pSAM-Spc-Amp-RpsLpro was digested with the restriction endonuclease XbaI to obtain the linearized vector. (1.3) The promoter obtained in step (1.1) - gfp The fusion fragment was ligated to the linearized vector obtained in step (1.2) and transformed into competent cells. E. coli S17-1 λpir was spread onto BHI plates containing 100 μg / mL ampicillin and incubated at 37°C for 16 h. Primers Pro- were used. gfp PCR identification was performed using the -F / R method, and positive clones were screened to obtain those containing the recombinant plasmid GFP-pSAM-Spc-Amp-RpsLpro. E. coli The S17-1 λpir strain was used to extract the recombinant plasmid GFP-pSAM-Spc-Amp-RpsLpro.

[0031] The recombinant plasmid map is shown in Fig. 1. Figure 1

[0032] The primers used are as follows: Primer Sequence (5'-3') Pro-gfp-F CTTTTAAAACTACTGTCTAGACGGGTCCCTTGCCACA Pro-gfp-R TCCCTACTCTCGCATTCTAGACTCGTCGTGCCCTCTA ureG-F TCTGGAAAACGTGCTGCTAA ureG-R TGTGGGTTCTGGTAAAACTGC PNGase F-F GACAGGATCTGGGTCTGGTA PNGase F-R CTTTGGCTGCTTCCTTCC The PCR amplification conditions in step (1.1) are as follows: pre-denaturation at 94℃ for 5 min; denaturation at 94℃ for 30 s, annealing at 55℃ for 40 s, extension at 72℃ for 60 s, 30 cycles; final extension at 72℃ for 10 min; and incubation at 16℃.

[0033] The enzyme digestion system in step (1.2) is as follows: Enzyme digestion system Volume 10×Quick Cut buffer 3 μL pSAM-Spc-Amp-RpsLpro 1 μg Quick Cut XbaI 1 μL ddH2O to 30 μL The enzyme digestion reaction conditions are as follows: enzyme digestion at 37℃ for 30 min.

[0034] The ligation system in step (1.3) is as follows: Ligation system Volume 2×MultiF Seamless Assembly Mix 10 μL Linearized pSAM-Spc-Amp-RpsLpro 150 ng Pro-gfp 50 ng ddH2O to 20 μL The recombination reaction conditions are as follows: recombination at 50℃ for 30 min.

[0035] ​2. Construction of GFP-labeled transposon mutant library of M. morganii The recombinant plasmid GFP-pSAM-Spc-Amp-RpsL pro obtained in step 1 was transformed into E. coli S17-1 λpir by electroporation. E. coli S17-1 λpir as the donor bacteria and M. morganii FL160902 as the recipient bacteria, and the conjugation was performed. The specific operation was as follows: (2.1) The donor bacteria and the recipient bacteria were cultured to the logarithmic phase overnight; (2.2) The donor bacteria and the recipient bacteria were mixed at a volume ratio of 2:1: 1 mL of the donor bacteria and 0.5 mL of the recipient bacteria were taken in a 2 mL sterile centrifuge tube, centrifuged at 5000 r / min for 5 min, the supernatant was discarded, 100 μL of BHI liquid medium was added to resuspend the bacterial cells, and the mixed bacterial solution was dropped on a BHI plate coated with a nitrocellulose membrane, which was cultured at 37°C for 24 h; (2.3) The bacterial lawn on the membrane was washed with BHI liquid medium, and was coated on a BHI plate containing 100 μg / mL spectinomycin and 50 μg / mL meropenem to screen positive conjugants; (2.4) 85 transposon insertion mutant strains were randomly picked for bacterial liquid PCR verification, and primers Pro- gfp -F / R were used for verification, and double primers ureG -F / R and PNGase F -F / R were used for M. morganii strain identification. As shown in Figure 2 , the promoter- gfp fusion fragment of each mutant strain could be amplified, and PCR identification showed that it was M. morganii.

[0036] 3. Fluorescent signal detection and screening of GFP-labeled mutant strains of M. morganii (3.1) The above GFP-labeled mutant strains were cultured at 37°C and 200 r / min overnight to the logarithmic growth phase; (3.2) Each GFP-labeled mutant strain was washed with sterile PBS buffer for 3 times, and was inoculated into PBS buffer at a ratio of 1:100, and the bacterial suspension was vortexed to mix, which was the sample for fluorescence intensity detection; (3.3) 200 μL of the bacterial suspension was added to a sterile 96-well plate, and the fluorescence intensity of each mutant strain suspension was detected using an enzyme-labeled instrument. The excitation wavelength was set to 488 nm, the emission wavelength was set to 532 nm, PBS buffer was used as the negative control, each sample was repeated in triplicate, and the test was repeated for 3 times; (3.4) As shown in Figure 3 , the relative fluorescence values of 85 mutant strains were analyzed, the lowest value was 1.10×10 3 , the highest value was 6.31×10 3 , and the average value was 2.17×103 The mutant strain with the highest relative fluorescence value is selected as the GFP-labeled Mycoplasma gallisepticum.

[0037] (3.5) As shown in Figure 4 , the GFP-labeled Mycoplasma gallisepticum is observed. The GFP-labeled strain is inoculated on a BHI plate, and the wild strain is used as a negative control. The colony fluorescence signal of the BHI plate is observed using a fluorescence flashlight, as shown in Figure 4 B, the GFP-labeled strain presents a bright green fluorescent colony, Figure 4 A is the wild strain. The GFP-labeled strain is cultured at 37°C and 200 r / min overnight to the logarithmic growth phase, washed with PBS buffer for 3 times, and the bacterial fluorescence signal is observed using a fluorescence microscope (Nikon DM2500, maximum magnification 400x). The excitation filter used for the fluorescence microscope is 480 nm, and the blocking filter is LP530 nm, as shown in Figure 4 D, bright green fluorescent bacteria can be observed.

[0038] Example 2: The present embodiment provides an application of a GFP-labeled Mycoplasma gallisepticum, specifically including an application in a macrophage infection model: (1) The GFP-labeled strain is cultured to the logarithmic growth phase, washed with PBS buffer for 3 times, and a bacterial suspension is prepared; (2) The GFP-labeled strain is used to infect macrophage RAW264.7 at a multiplicity of infection of 20:1. After 2h of infection, the cells are washed with PBS for 3 times, and DMEM medium containing 10% FBS and 500 μg / mL gentamicin is added for 1h to remove extracellular non-internalized bacteria. At this time, it is defined as 0 hour after infection (0hpi). Thereafter, the infected cells are continuously cultured in medium containing 50 μg / mL gentamicin; (3) The spatiotemporal distribution and proliferation of bacteria in macrophages within 24 hours after infection are monitored and recorded using a live cell time-lapse microscopy system, as shown in Figure 5 With the extension of intracellular survival time, the fluorescence signal of Mycoplasma gallisepticum gradually increases, and bacterial clusters are formed at 24h, indicating that Mycoplasma gallisepticum can resist the killing of macrophages, survive in macrophages, and proliferate.

[0039] Comparative Example 1: The effect of selecting different plasmids in the construction of the recombinant plasmid of step 1 in Example 1 is different: The Escherichia coli expression vectors pET-30a, pET-32a, pGEX-4t-1, pGEX-5X-1, the Escherichia coli cloning vector pACYC184, and the duck Mycoplasma gallisepticum shuttle expression vector pLMF03 are used to construct recombinant plasmids, and the constructed recombinant plasmids cannot be transformed into Mycoplasma gallisepticum.

[0040] Example 2: Effect of different ways of introducing recombinant plasmid into M. elysae The recombinant plasmid GFP-pSAM-Spc-Amp-RpsL pro was introduced into M. elysae by conventional electroporation, but the transformation was not successful.

[0041] Example 3: Change of conjugation conditions (other settings are the same as in Example 1) 1. Ratio of donor bacteria to recipient bacteria The donor bacteria and the recipient bacteria were cultured in BHI liquid medium to the logarithmic growth phase (OD 600 ≈1.0), and mixed at a volume ratio of 1:1, 2:1, 3:1, and 4:1. The mixed bacterial solution was centrifuged at 5,000 x g for 5 min, and resuspended in 100 μL of BHI after the supernatant was discarded. The suspension was uniformly coated on BHI plates covered with nitrocellulose membranes, and incubated at 37°C for 24 h. The bacterial lawn was scraped and washed with BHI, and then coated on BHI plates containing 100 μg / mL spectinomycin and 50 μg / mL meropenem to screen for conjugants. Conjugants were obtained in all ratios, and the conjugation efficiency was highest when the ratio of donor bacteria to recipient bacteria was 2:1.

[0042] 2. Conjugation time The mixed bacterial solution was coated on the coated BHI plates, and the conjugants were screened after incubation at 37°C for 4 h, 12 h, and 24 h, respectively. The conjugation efficiency of the 24 h incubation group was significantly higher than that of the other groups.

[0043] Based on the above results, the present application establishes a method for labeling M. elysae with GFP. The obtained engineered strain presents stable and bright green fluorescent signals under a fluorescence detection device, and has high genetic stability. The GFP-labeled strain is successfully applied to a macrophage RAW264.7 infection model, supporting real-time visualization tracking of the intracellular distribution and proliferation dynamics of bacteria. The present application provides a key technical means for in-depth analysis of the interaction mechanism between M. elysae and host cells.

[0044] It should be noted that the above examples do not limit the present application in any form, and any technical solution obtained by equivalent substitution or equivalent transformation falls within the scope of protection of the present application.

[0045] SEQ ID NO: 1 promoter sequence, 114 bases TTGCCACATTTGGTGTTTTTTTGTAGGTTTTTTTTAACATTTGATTTTGTATTTAAAAAATTTGGTGTTACTTTTGCTTGTAATTAACTAAATTGTAATTAAAAAAATTAAGTA SEQ ID NO: 2 gfp Sequence, 717 bases ATGAGCAAAGGCGAAGAACTGTTTACCGGTGTTGTTCCGATTCTGGTTGAACTGGATGGTGATGTTAATGGCCACAAATTTTCAGTTAGCGGTGAAGGCGAAGGTGATGCAACCTATGGTAAACTGACCCTGAAATTTATCTGTACCACCGGCAAACTGCCGGTTCCGTGGCCGACACTGGTTACCACCTTTGGTTATGGTGTTCAGTGTTTTGCACGTTATCCGGATCATATGAAACAGCACGATTTTTTCAAAAGCGCAATGCCGGAAGGTTATGTTCAAGAACGTACCATCTTCTTCAAAGATGACGGCAACTATAAAACCCGTGCCGAAGTTAAATTTGAAGGTGATACCCTGGTGAATCGCATTGAACTGAAAGGCATCGATTTTAAAGAGGATGGTAATATCCTGGGCCACAAACTGGAATATAATTATAATAGCCACAACGTGTACATCATGGCCGACAAACAGAAAAATGGCATCAAAGTGAACTTCAAGATCCGCCATAATATTGAAGATGGTTCAGTTCAGCTGGCCGATCATTATCAGCAGAATACCCCGATTGGTGATGGTCCGGTTCTGCTGCCGGATAATCATTATCTGAGCACCCAGAGCGCACTGAGCAAAGATCCGAATGAAAAACGTGATCACATGGTGCTGCTGGAATTTGTTACCGCAGCAGGTATTACCCATGGTATGGATGAACTGTACAAATAA SEQ ID NO: 3 pSAM-Spc-Amp-RpsL pro plasmid sequence, 4391 bases

Claims

1. A method for constructing GFP-labeled Elizabethan bacillus mirabilis, characterized in that, Includes the following steps:

1. Construct the recombinant plasmid GFP-pSAM-Spc-Amp-RpsLpro containing transposition function; 2. The recombinant plasmid GFP-pSAM-Spc-Amp-RpsLpro obtained in step 1 was introduced into Elizabethan mil strain via conjugation transfer to obtain a library of GFP-labeled transposon mutants.

3. Detect the relative fluorescence value of Elizabethan miernea mutant strains in the GFP-labeled transposon mutant library constructed in step 2, and select the mutant strain with the highest relative fluorescence value to obtain the GFP-labeled Elizabethan miernea.

2. The construction method according to claim 1, characterized in that, Step 1 of the method includes: 1.1 Using plasmid GFP-PUC-SP as a template, primer Pro- gfp -F / R, amplification yields the promoter- gfp Fragment fusion; 1.

2. Based on the multiple cloning restriction site of pSAM-Spc-Amp-RpsLpro, the plasmid pSAM-Spc-Amp-RpsLpro was digested with the restriction endonuclease XbaI to obtain the linearized vector. 1.

3. Combine the linearized vector obtained in step 1.2 with the promoter obtained in step 1.

1. gfp The fusion fragment was ligated with homologous recombinase and transformed into competent cells. E. coli The S17-1λpir strain was used to obtain a strain carrying the recombinant plasmid GFP-pSAM-Spc-Amp-RpsLpro. E. coli The recombinant plasmid GFP-pSAM-Spc-Amp-RpsLpro was extracted from strain S17-1λpir.

3. The construction method according to claim 2, characterized in that, The PCR amplification conditions in step 1.1 are as follows: 94℃ pre-denaturation for 5 min; 94℃ denaturation for 30 s, 55℃ annealing for 40 s, 72℃ extension for 60 s, 30 cycles; final extension at 72℃ for 10 min; and incubation at 16℃.

4. The construction method according to claim 2, characterized in that, The enzyme digestion system in step 1.2 is as follows: Enzyme digestion system volume 10×Quick Cut buffer 3 μL pSAM-Spc-Amp-RpsLpro 1 μg Quick Cut XbaI 1 μL ddH2O to 30 μL Enzyme digestion reaction conditions: 37℃ for 30 min.

5. The construction method according to claim 2, characterized in that, The connection system in step 1.3 is as follows: Connecting system volume 2×MultiF Seamless Assembly Mix 10μL Linearization of pSAM-Spc-Amp-RpsLpro 150 ng Pro-gfp 50 ng ddH2O to 20 μL Recombination reaction conditions: Recombination at 50℃ for 30 min.

6. The construction method according to claim 5, characterized in that, Step 2 of the method includes: 2.

1. Using the recombinant plasmid GFP-pSAM-Spc-Amp-RpsLpro E. coli S17-1 λpir is used as the donor bacterium, and Elizabethan mil is used as the recipient bacterium. The donor and recipient bacteria are cultured overnight to the logarithmic phase. Preferably, the Elizabethan mil strain is Elizabethan mil strain FL160902. 2.2 Mix the donor bacteria and recipient bacteria at a volume ratio of 1:1 to 4:1: Take the donor bacteria and recipient bacteria into a sterile centrifuge tube, centrifuge at 5000 r / min for 5 min, discard the supernatant, add 100 μL BHI to resuspend the bacterial cells, drop the well mixed bacterial solution onto a BHI plate covered with a nitrocellulose membrane, and incubate at 37℃ for 24 h. 2.3 Wash the bacterial growth off the membrane with BHI liquid medium and spread it on a BHI plate containing 100 μg / mL spectinomycin and 50 μg / mL meropenem to screen for positive conjugates, which are GFP-labeled transposon insertion mutants; 2.

4. Select the GFP marker transposon insertion mutant strain described in step 2.3 for colony PCR verification. Primer Pro- gfp -F / R is used for verification, using double primers. ureG -F / R and PNGase F -F / R Elizabethan mil strain identification. Each GFP-labeled mutant strain was quantitatively screened using a fluorescent microplate reader to obtain a GFP-high expression mutant strain, which is the GFP-labeled Elizabethan mil strain described above.

7. The construction method according to claim 6, characterized in that, The volume ratio of donor bacteria to recipient bacteria in step 2.2 is 2:

1.

8. The construction method according to claim 6, characterized in that, The primers used in the method are as follows: Primer sequence 5'-3' Pro-gfp-F CTTTTAAAACTACTGTCTAGACGGGTCCCTTGCCACA Pro-gfp-R TCCCTACTCTCGCATTCTAGACTCGTCGTGCCCTCTA ureG-F TCTGGAAAACGTGCTGCTAA ureG-R TGTGGGTTCTGGTAAAACTGC PNGase FF GACAGGATCTGGGTCTGGTA PNGase FR CTTTGGCTGCTTCCTTCC.

9. Application of a GFP-labeled Elizabethan mil in a macrophage infection model.

10. The application according to claim 9, characterized in that, Includes the following steps: (1) The GFP-labeled Elizabethan mil was cultured to the logarithmic growth phase, washed three times with PBS buffer, and a bacterial suspension was prepared. (2) RAW264.7 macrophages were infected with the bacterial suspension obtained in step (1) at a multiplicity of infection ratio of 20:

1. After 2 hours of infection, the cells were washed three times with PBS and treated with DMEM medium containing 10% FBS and 500 μg / mL gentamicin for 1 hour to remove extracellular bacteria that had not been internalized. This time was defined as 0 hours post-infection. After that, the infected cells were cultured in medium containing 50 μg / mL gentamicin. (3) Using a live cell time-lapse microscopy system, the spatiotemporal distribution and proliferation of bacteria in macrophages within 24 hours after infection were monitored and recorded. As the intracellular survival time increased, the fluorescence signal of Elizabethan mil gradually increased and formed bacterial clusters at 24 hours.