Construction method and application of CAG promoter specific driving LSL-RCAN1-P2A-EGFP-Flag tag expression animal model

Abstract

The invention provides a construction method and application of an animal model for specifically driving LSL-RCAN1-P2A-EGFP-Flag tag to express by using a CAG (chorionic gonadotropin) promoter. The method is realized by inserting a CAG promoter sequence, an LSL sequence, an RCAN1 gene coding sequence, an EGFP sequence, a Flag tag sequence and a PolyA sequence into a Rosa26 site of a mouse genome. When the RCAN1-2A-EGFP gene is hybridized with a mouse with tissue or cell specific expression CRE enzyme, a Stop sequence between loxP sites can be cut off, so that overexpression of the RCAN1-2A-EGFP protein driven by a tissue or cell specific CAG promoter is realized, the translated protein can be separated into two independent proteins for performing functions, and an animal model is provided for researching the function of the RCAN1 in specific tissue or cell.

Description

Technical Field

[0001] This invention belongs to the field of medical biotechnology and relates to the construction of animal models, specifically to a method for constructing an animal model expressing LSL-RCAN1-P2A-EGFP-Flag tag specifically driven by the CAG promoter and its related applications. Background Technology

[0002] The CAG promoter is an artificially constructed, strongly combined promoter composed of an early enhancer element from cytomegalovirus (CMV) and a chicken beta-actin promoter, exhibiting highly efficient transcriptional activity. The CAG promoter retains the CMV enhancer, thus its transcriptional capacity is comparable to that of the CMV promoter, while the chicken beta-actin promoter provides it with a broader expression profile. The CAG promoter is widely used to drive high-level and sustained gene expression in mammalian vectors, serving as a highly efficient gene expression regulation tool.

[0003] RCAN1 is an endogenous regulator of calcineurin 1, belonging to the RCAN family, and is an evolutionarily conserved protein. RCAN1 plays a crucial role in the regulation of calcium signaling pathways, influencing the activity of multiple downstream signaling pathways by regulating the balance of intracellular calcium ion concentration, thereby participating in the regulation of biological processes such as cell proliferation, apoptosis, and neural development. There are four isoforms of RCAN1, with RCAN1.1 and RCAN1.4 being the most important members. RCAN1 was initially named based on its function of directly binding to the catalytic subunit of calcineurin. Its main function is to inhibit the calcineurin / NFAT signaling pathway, preventing the latter from catalyzing NFAT dephosphorylation and inhibiting the function of downstream target genes. Existing research has extensively investigated the function of RCAN1: Ryeom et al. found that RCAN1 deficiency leads to reduced IFN-γ production in mouse T lymphocytes, decreased cell proliferation, and increased expression of the apoptosis-related protein FasL. Wu et al.'s research showed that RCAN1 in mast cells can negatively regulate NFAT signaling activation induced by stem cell growth factors, and also inhibit the activity of downstream NF-κB. Studies by Kim et al. found that transfection of RCAN1 into human malignant glioma cells U87MG stabilized IκBα protein activity and inhibited the NF-κB signaling pathway. Zhang et al. found that RCAN1.4 exerted a renal protective effect in a mouse model of chronic allogeneic kidney transplantation-induced interstitial fibrosis by regulating oxidative stress. Li et al.'s research showed that RCAN1 expression was inhibited in podocyte injury due to HIV or diabetic nephropathy, leading to dysregulation of the calcineurin / NFAT pathway and thus promoting podocyte injury. Overexpression of RCAN1 inhibited NFAT transcriptional activity induced by high glucose or HIV infection and also stabilized the podocyte actin cytoskeleton structure. Conversely, inhibition of RCAN1 expression led to activation of the calcineurin / NFAT pathway and exacerbated cytoskeleton disorder induced by high glucose or HIV infection. These studies indicate that RCAN1 is widely involved in the regulation of immunity, tumors, and kidney diseases through the calcineurin / NFAT pathway. Summary of the Invention

[0004] Based on the aforementioned research, this invention addresses the current lack of animal models for RCAN1 in existing technologies by providing a method for constructing and applying an animal model specifically driven by the CAG promoter to express the LSL-RCAN1-P2A-EGFP-Flag tag. This invention constructs a mouse model of LSL-RCAN1-P2A-EGFP-Flag tag expression driven by the CAG promoter using a CRISPR-Cas9 system. When this model is hybridized with a mouse model specifically expressing CRE enzymes in tissues or cells, tissue- or cell-specific overexpression of RCAN1 can be achieved, providing an animal model for studying the function of RCAN1 in specific tissues or cells.

[0005] To achieve the above objectives, the technical solution of the present invention is as follows:

[0006] In a first aspect, the present invention provides a method for constructing an animal model of LSL-RCAN1-P2A-EGFP-Flag tag expression specifically driven by the CAG promoter, which is summarized as follows: the model is constructed by inserting the CAG promoter sequence, LSL sequence, RCAN1 gene coding sequence, EGFP sequence, Flag tag sequence and PolyA sequence into the Rosa26 site of the mouse genome.

[0007] Preferably, the specific construction steps are as follows:

[0008] (1) Construction of donor plasmid: The CAG promoter sequence, LSL sequence (loxP-Stop-loxP), RCAN1 gene coding sequence, EGFP sequence, Flag tag sequence and PolyA sequence were sequentially recombined into the plasmid to construct the recombinant expression plasmid;

[0009] (2) The Rosa26 site of the mouse genome was cut using gene editing technology; preferably, the CRISPR / Cas9 system was used to edit the Rosa26 site, and the nucleic acid sequence of the gRNA is shown below: ttcccatggcttaaatggca (SEQ ID NO.1);

[0010] (3) The CAG promoter sequence, LSL sequence, RCAN1 gene coding sequence, EGFP sequence, Flag tag sequence and PolyA sequence in the plasmid constructed in step (1) were inserted into the Rosa26 site of the mouse genome by homologous recombination;

[0011] (4) The fertilized eggs that survived the injection were transplanted into the bodies of pseudopregnant female mice. After they became pregnant and gave birth, the F0 generation mice were identified. The sexually mature positive F0 generation mice were mated with wild-type mice of the same background. The genotypes of the F1 generation mice were identified and homozygous mice were selected.

[0012] The preferred PCR primer sequences for mouse genotype identification are shown below:

[0013] Primer pair 1 (5' arm):

[0014] F:TTTCCAGGTGGATGTCTCCTCC (SEQ ID NO.2),

[0015] R: TGGCGTTACTATGGGAACATACGTC (SEQ ID NO.3), Product size: 1558bp;

[0016] Primer pair 2 (3' arm):

[0017] F: ATCAGCCTCGACTGTGCCTTCTA (SEQ ID NO.4),

[0018] R: GCCACTCAATGCTCACTAACAGTG (SEQ ID NO.5), Product size: 1698bp;

[0019] Primer pair 3 (WT):

[0020] F: AAATGTAGGGCCAGAGTTTAGCCA (SEQ ID NO.6),

[0021] R: TGGAAATCAGGCTGCAAATCTC (SEQ ID NO.7), product size: 438bp.

[0022] The following methods were used for identification:

[0023] Wild-type mice: PCR reactions with primer pairs 1 and 2 showed no bands, while PCR reactions with primer pair 3 yielded a single WT band.

[0024] Heterozygous mice: PCR reactions using primer pairs 1 and 2 yielded bands of corresponding sizes, while PCR reactions using primer pair 3 yielded a single WT band.

[0025] Homozygous mice: PCR reactions using primer pairs 1 and 2 yielded bands of the corresponding sizes, while PCR reactions using primer pair 3 showed no WT band.

[0026] In a second aspect, this invention provides an animal model for LSL-RCAN1-P2A-EGFP-Flag tag expression specifically driven by the CAG promoter, which is prepared using the method described above. When hybridized with a mouse model specifically expressing CRE enzymes in tissues or cells, tissue- or cell-specific overexpression of RCAN1 can be achieved, providing an animal model for studying the function of RCAN1 in specific tissues or cells.

[0027] In a third aspect, the present invention provides applications of the animal model specifically driven by the CAG promoter to express the LSL-RCAN1-P2A-EGFP-Flag tag, such as in screening or developing drugs with RCAN1 as a therapeutic target, or in constructing a research platform for the RCAN1 mechanism, to find new methods and more effective therapeutic drugs for preventing and alleviating the occurrence and development of diseases and for understanding the damage mechanisms of diseases.

[0028] Compared with the prior art, the present invention has the following significant advantages:

[0029] (1) The method for constructing an animal model specifically driven by the CAG promoter to express LSL-RCAN1-P2A-EGFP-Flag tag provided by the present invention can stably pass on mouse models constructed by this method, providing a convenient, reliable and economical means for studying RCAN1 gene mutations and their pathogenic mechanisms.

[0030] (2) Given the difficulty in obtaining human patient research materials and the constraints imposed by medical ethics, the mouse model provided by this invention will become an important tool in the study of RCAN1 mutation-related diseases. This will not only help researchers to deeply analyze the biological function of the RCAN1 gene, but also provide an effective research approach and method for exploring the intrinsic link between RCAN1 gene function and disease pathogenesis, and lay the foundation for related applications. Attached Figure Description

[0031] Figure 1 The procedure for constructing a mouse model in which the CAG promoter specifically drives the expression of the LSL-RCAN1-P2A-EGFP-Flag tag is shown;

[0032] Figure 2 The results of PCR identification of positive F0 generation mice are shown (1, 2, 6-8, 10, and 11 are heterozygous, and the rest are WT).

[0033] Figure 3 The sequencing and alignment results of the PCR products from positive F0 generation mice are shown (the CAG promoter-LSL-RCAN1-P2A-EGFP-Flag tag sequence was inserted into the Rosa26 site). Detailed Implementation

[0034] The following embodiments and experimental examples further illustrate the present invention and should not be construed as limiting the invention. The embodiments do not include a detailed description of conventional methods, which are well known to those skilled in the art and described in numerous publications.

[0035] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as are familiar to those skilled in the art. Furthermore, any methods and materials similar to or equivalent to those described herein may be applied to this invention, and the preferred embodiments and materials described in the specific implementation are for illustrative purposes only.

[0036] Animal model construction methods such as Figure 1 As shown, the specific steps are as follows:

[0037] 1. Construct donor plasmids. The CAG promoter sequence, LSL sequence, RCAN1 gene coding sequence, EGFP sequence, Flag tag sequence, and PolyA sequence were synthesized using chemical synthesis methods. The correctness of the sequences was confirmed by Sanger sequencing.

[0038] 2. Design a gRNA targeting the Rosa26 site in the mouse genome (sequence: ttcccatggcttaaatggca), and co-inject the CRISPR-Cas9 system and donor plasmid together into mouse zygotes with a wild-type C57BL / 6NGpt background.

[0039] 3. The fertilized eggs that survive the injection are transferred into a pseudopregnant female mouse, and she is allowed to become pregnant and give birth.

[0040] 4. Identification of F0 generation mice: F0 generation pups born to recipient mice were numbered by cropping their tails and toes on days 5-7, and genomic DNA was extracted for PCR amplification and sequencing identification. Figure 2 , Figure 3 ), confirming the genotype.

[0041] 5. Breeding of positive F0 generation mice: After the positive F0 generation mice reach sexual maturity, they are mated with wild-type mice of the same background. The F1 generation pups are numbered by cropping their tails and toes on days 5-7. Genomic DNA is extracted for PCR amplification and sequencing to identify the genotype.

[0042] The PCR primer sequences (5'-3') for mouse genotyping are shown below:

[0043] Primer pair 1 (5' arm):

[0044] F:TTTCCAGGTGGATGTCTCCTCC (SEQ ID NO.2),

[0045] R: TGGCGTTACTATGGGAACATACGTC (SEQ ID NO.3), Product size: 1558bp;

[0046] Primer pair 2 (3' arm):

[0047] F: ATCAGCCTCGACTGTGCCTTCTA (SEQ ID NO.4),

[0048] R: GCCACTCAATGCTCACTAACAGTG (SEQ ID NO.5), Product size: 1698bp;

[0049] Primer pair 3 (WT):

[0050] F: AAATGTAGGGCCAGAGTTTAGCCA (SEQ ID NO.6),

[0051] R: TGGAAATCAGGCTGCAAATCTC (SEQ ID NO.7), product size: 438bp.

[0052] The following methods were used for identification:

[0053] Wild-type mice: PCR reactions with primer pairs 1 and 2 showed no bands, while PCR reactions with primer pair 3 yielded a single WT band.

[0054] Heterozygous mice: PCR reactions using primer pairs 1 and 2 yielded bands of corresponding sizes, while PCR reactions using primer pair 3 yielded a single WT band.

[0055] Homozygous mice: PCR reactions using primer pairs 1 and 2 yielded bands of the corresponding sizes, while PCR reactions using primer pair 3 showed no WT band.

[0056] The sequence of the inserted fragment in the plasmid is shown below (SEQ ID NO.8):

[0057]

[0058] The undescribed parts of this invention are the same as or implemented using existing technology. The applicant declares that this invention is illustrated through the above embodiments, but the invention is not limited to the above detailed methods, i.e., it does not mean that the invention must rely on the above detailed methods to be implemented. Those skilled in the art should understand that any improvements to this invention, equivalent substitutions of raw materials for the product of this invention, additions of auxiliary components, and selection of specific methods all fall within the protection and disclosure scope of this invention.

Claims

1. A method for constructing an animal model specifically driven by the CAG promoter to express the LSL-RCAN1-P2A-EGFP-Flag tag, characterized in that, It was constructed by inserting the CAG promoter sequence, LSL sequence, RCAN1 gene coding sequence, EGFP sequence, Flag tag sequence and PolyA sequence into the Rosa26 site of the mouse genome.

2. The construction method according to claim 1, characterized in that, Includes the following steps: (1) Construction of donor plasmid: The CAG promoter sequence, LSL sequence, RCAN1 gene coding sequence, EGFP sequence, Flagtag sequence and PolyA sequence were sequentially recombined into the plasmid to construct the recombinant expression plasmid; (2) The Rosa26 site in the mouse genome was cut using gene editing technology; (3) The CAG promoter sequence, LSL sequence, RCAN1 gene coding sequence, EGFP sequence, Flag tag sequence and PolyA sequence in the plasmid constructed in step (1) were inserted into the Rosa26 site of the mouse genome by homologous recombination.

3. The construction method according to claim 2, characterized in that, In step (1), the LSL sequence is the loxP-Stop-loxP site.

4. The construction method according to claim 2, characterized in that, In step (2), the Rosa26 site was edited using the CRISPR / Cas9 system, and the nucleic acid sequence of the gRNA is shown in SEQ ID NO.

1.

5. The construction method according to claim 2, characterized in that, The procedure also includes the following steps: fertilized eggs that survive the injection are transplanted into pseudopregnant female mice, and after the mice become pregnant and give birth, the F0 generation mice are identified. Sexually mature positive F0 generation mice are mated with wild-type mice of the same background, and the genotypes of the F1 generation offspring are identified to screen for homozygous mice.

6. The construction method according to claim 5, characterized in that, The PCR primer sequences for mouse genotyping are shown in SEQ ID NO.2~7.

7. An animal model specifically driven by the CAG promoter to express the LSL-RCAN1-P2A-EGFP-Flag tag, characterized in that, It is prepared by the method described in any one of claims 1 to 6.

8. The application of the animal model specifically driven by the CAG promoter of claim 7 to express LSL-RCAN1-P2A-EGFP-Flag tag in screening or developing drugs targeting RCAN1.

9. The application of the animal model specifically driven by the CAG promoter to express the LSL-RCAN1-P2A-EGFP-Flag tag as described in claim 7 in constructing a research platform for the RCAN1 mechanism.

Images