Kit, composition and analyzer for rapidly detecting helicobacter pylori and virulence genotyping

By optimizing the fluorescent PCR detection system and primer/probe design, rapid and accurate identification and virulence genotyping of Helicobacter pylori were achieved, solving the problems of long detection time and low accuracy in existing technologies. This method is applicable to complex samples and interfering substances, improving detection efficiency and reliability.

CN121472440APending Publication Date: 2026-02-06YOULIAN RUIKANG (SHANGHAI) GENE TECH CO LTD
View PDF 4 Cites 0 Cited by

Patent Information

Application Number
CN202610007183.2
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2026-01-06
Publication Date
2026-02-06

AI Technical Summary

Technical Problem

Existing fluorescent PCR detection methods suffer from problems such as insufficient detection, low throughput, and excessively long detection time in the identification and virulence genotyping of Helicobacter pylori, making it difficult to meet the demand for rapid and accurate detection.

Method used

The fluorescence PCR detection system was optimized, a highly specific primer-probe combination was designed, a two-step rapid amplification procedure was adopted, and the urease A gene was introduced as an endogenous quality control system to achieve simultaneous identification and virulence genotyping of Helicobacter pylori in a single tube. Hot-start rapid DNA polymerase was combined to shorten the detection time.

Benefits of technology

The system enables the identification and virulence genotyping of Helicobacter pylori within 30 minutes, improving the sensitivity and accuracy of detection, reducing false positive and false negative reports, adapting to the influence of complex sample components and interfering substances, and enhancing detection efficiency and reliability.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121472440A_ABST
    Figure CN121472440A_ABST
Patent Text Reader

Abstract

The invention relates to a kit, a composition and an analyzer for rapidly detecting helicobacter pylori and virulence genotyping. The invention specifically provides a kit for rapidly detecting helicobacter pylori and virulence genotypes. The kit comprises primers F1, F2, F3, F4, R1, R2, R3 and R4 and probes P1, P2, P3 and P4. The kit provided by the invention can greatly shorten the time of identification and virulence genotyping of helicobacter pylori without sacrificing the sensitivity and accuracy of detection, and the clinical coincidence rate of the kit is equivalent to that of an existing detection method.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of in vitro diagnostics, and more specifically to a kit, composition, and analyzer for rapid detection of Helicobacter pylori and virulence genotyping. Background Technology

[0002] Helicobacter pylori ( Helicobacter pylori, H. pylori Helicobacter pylori infection is an infectious disease. It can lead to digestive tract diseases such as chronic gastritis, gastric ulcers, gastric cancer, and gastric MALT lymphoma. Furthermore, Helicobacter pylori infection can be transmitted from person to person; therefore, eradication is crucial regardless of the presence of symptoms or complications. H. pylori It is absolutely necessary.

[0003] Infect H. pylori The occurrence of post-clinical symptoms is related not only to the host's genetic susceptibility and living environment, but also to... H. pylori The differences in physiological function among different strains due to virulence gene polymorphisms are of great importance. Cytotoxin-associated gene A (cagA) and vacuolating eytotoxin-associated gene A (vacA) are... H. pylori Key virulence genes, virulence factors, and the host's genetic background can influence the outcome of diseases affecting individuals, particularly the risk of developing gastric cancer.

[0004] Based on cagA and vacA, and whether or not cagA and vacA proteins are expressed, H. pylori The strains were classified into two types: Type I, which are highly pathogenic toxin-producing strains containing the cagA gene and expressing either CagA or VacA proteins; and Type II, which are less virulent, non-toxin-producing strains containing the cagA gene but not expressing either CagA or VacA proteins. Patients infected with Type I strains have a 7 times higher risk of developing gastric cancer than those infected with Type II strains, fully demonstrating the necessity of virulence genotyping.

[0005] Currently, methods for identifying Helicobacter pylori and typing its virulence genes include isolation and culture, histopathological staining, urea breath test, immunological examination, and fecal antigen detection, but all of these have limitations. For example, isolation and culture refers to identifying Helicobacter pylori after it has been cultured into colonies through biochemical reactions. However, Helicobacter pylori culture requires microaerophilic conditions and has stringent nutritional requirements, resulting in an extremely low detection rate. It is not easily promoted as a routine diagnostic method, and the 5-7 day culture time is not conducive to rapid diagnosis. Histopathological staining involves staining biopsy tissue sections from patients undergoing gastroscopy to observe the presence of Helicobacter pylori. This method is significantly affected by the Helicobacter pylori load and is cumbersome and time-consuming, making it unsuitable for high-throughput sample testing. The urea breath test is widely used clinically, but it is expensive and easily affected by antibacterial and acid-suppressing drugs. Immunological tests typically detect antibodies (IgG) in serum, saliva, or urine, but these cannot reflect current infection. Fecal antigen testing directly detects Helicobacter pylori somatic antigens or virulence factors in feces, using non-invasive sampling, but this method has low acceptance among the population and is unsuitable for rapid outpatient diagnosis.

[0006] Currently, real-time quantitative PCR (qPCR) technology has been reported for detecting Helicobacter pylori. This method avoids complex procedures such as bacterial culture, but its detection process still has many shortcomings. For example, CN116103417A and CN116904629A disclose a method for typing Helicobacter pylori virulence genes, but lack an endogenous quality control system for identifying Helicobacter pylori itself. This "typing only, not identification" approach cannot confirm the presence of Helicobacter pylori genomic DNA in the sample, posing clinical risks. In fact, the introduction of an endogenous quality control system may introduce uncertainties into the qPCR reaction; for example, primers from the endogenous quality control system may form dimers with virulence gene primers or undergo non-specific annealing.

[0007] On the other hand, although some studies have attempted to simultaneously identify Helicobacter pylori and virulence gene typing in real-time PCR, the design of primers is much more difficult because it requires ensuring that the annealing temperatures of different primers are the same and that there is no interference. At the same time, it is also necessary to ensure that the amplification efficiencies of different detection channels are similar. This makes it even more difficult to optimize the reaction process, such as the duration, as the entire detection process often takes 80 to 120 minutes.

[0008] Excessive testing time has several negative impacts in clinical practice: First, it limits clinical throughput, failing to meet the demand for immediate testing of large numbers of samples. Second, it delays treatment decisions, slows the development of individualized treatment plans, and affects patient experience and diagnostic efficiency. Third, it fails to fully realize the potential of rapid molecular diagnostics.

[0009] In summary, current fluorescent PCR detection methods still have drawbacks such as insufficient detection coverage, low throughput, and excessively long detection time.

[0010] Therefore, there is an urgent need to further improve the existing fluorescent PCR detection methods to achieve rapid, accurate and comprehensive identification and virulence genotyping of Helicobacter pylori. Summary of the Invention

[0011] In view of this, the main objective of this invention is to further improve the fluorescent PCR detection technology to rapidly and accurately identify Helicobacter pylori and perform virulence genotyping.

[0012] As mentioned earlier, while some studies have reported the ability to simultaneously identify and genotype Helicobacter pylori, they all have certain limitations. For example, CN104846097A achieves both detection effects, but its total PCR reaction time reaches 85 minutes, making rapid detection difficult. JP09065899A can achieve highly sensitive detection of Helicobacter pylori, but its primer combination is not suitable for rapid detection systems, still facing the risk of excessively long detection times.

[0013] Based on the above research, the inventors optimized the existing fluorescent PCR detection system and reaction process through a series of studies. The optimized detection system can simultaneously identify Helicobacter pylori and perform virulence gene typing. It can also perform rapid detection of Helicobacter pylori and virulence gene typing in one reaction tube within 30 minutes, thus completing this invention.

[0014] The specific technical solution of the present invention is as follows.

[0015] The first aspect of the present invention provides a kit for rapid detection of Helicobacter pylori and virulence gene typing, comprising: upstream primer 1 (F1), upstream primer 2 (F2), upstream primer 3 (F3), upstream primer 4 (F4), downstream primer 1 (R1), downstream primer 2 (R2), downstream primer 3 (R3), downstream primer 4 (R4), Taqman probe 1 (P1), Taqman probe 2 (P2), Taqman probe 3 (P3), and Taqman probe 4 (P4);

[0016] The sequence of F1 is shown in SEQ ID NO. 1;

[0017] The sequence of R1 is shown in SEQ ID NO. 2;

[0018] The sequence of P1 is shown in SEQ ID NO. 3;

[0019] The sequence of F2 is shown in SEQ ID NO. 4;

[0020] The sequence of R2 is shown in SEQ ID NO. 5;

[0021] The sequence of P2 is shown in SEQ ID NO. 6;

[0022] The sequence of F3 is shown in SEQ ID NO. 7;

[0023] The sequence of R3 is shown in SEQ ID NO. 8;

[0024] The sequence of P3 is shown in SEQ ID NO. 9;

[0025] The sequence of F4 is shown in SEQ ID NO. 10;

[0026] The sequence of R4 is shown in SEQ ID NO. 11;

[0027] The sequence of P4 is shown in SEQ ID NO. 12.

[0028] In some implementations, a fluorescent reporter group is attached to the 5' end of the probe, and there is no overlap in the emission spectra of the fluorescent reporter groups attached to different probes.

[0029] In some implementations, the kit further includes PCR amplification reaction solution, DNA polymerase, and water, wherein the DNA polymerase is a hot-start rapid DNA polymerase.

[0030] A second aspect of the present invention provides a composition for rapid detection of Helicobacter pylori and virulence gene typing, comprising primers F1, F2, F3, F4, R1, R2, R3 and R4 of the present invention and probes P1, P2, P3 and P4.

[0031] A third aspect of the present invention provides an analyzer for rapid detection of Helicobacter pylori and virulence genotyping, comprising:

[0032] The reaction module includes a reagent supply section and a mixing chamber. The reagent supply section is provided with a placement position for placing reagent containers. The placement position holds the primers F1, F2, F3, F4, R1, R2, R3 and R4 and probes P1, P2, P3 and P4 of the present invention. The mixing chamber is used to mix the sample with the reagents.

[0033] Temperature control device for heating and cooling the reaction module; and

[0034] The controller is configured to control the temperature control device to perform the following procedure:

[0035] 1) Pre-denaturation: 95℃, 30 to 60 seconds;

[0036] 2) Denaturation: 95℃, 2 to 5 seconds;

[0037] 3) Annealing, extension, and fluorescence signal acquisition: 8 to 15 seconds.

[0038] Among them, steps 2) and 3) are repeated 35 to 45 times; and

[0039] The detection module includes a detection area and at least one optical detector.

[0040] In some implementations, step 1) takes 40 to 60 seconds.

[0041] In some implementations, step 2) takes 3 to 4 seconds.

[0042] In some implementations, step 3) takes 9 to 11 seconds.

[0043] The beneficial effect of this invention is that, through the technical improvement of primer and probe design, this invention significantly shortens the time for the combined detection of Helicobacter pylori identification and virulence gene typing while ensuring high sensitivity and high accuracy.

[0044] On the one hand, through the design of primers and probes, the kit can perform a rapid amplification procedure in an extremely compressed "two-step method". The pre-denaturation time is greatly shortened to only 30 to 60 seconds. Each cycle contains only two steps: 2 to 5 seconds of ultra-short denaturation and 8 to 15 seconds of annealing and extension, which can complete the amplification procedure in a short time.

[0045] On the other hand, the primer and probe system of the present invention places the primer and probe for identifying Helicobacter pylori ureA and the genotyping primers and probes for virulence genes such as cagA and vacA in the same multiplex fluorescent PCR reaction system, so as to realize the detection in a single tube and a single reaction, which significantly improves the convenience and efficiency of detection, and the detection effect can meet the clinical testing needs.

[0046] On the other hand, this invention features a comprehensive quality control system. In the ultra-rapid process, the ureA system for identifying Helicobacter pylori is used as an endogenous quality control system, achieving "full visualization" and "quality controllability" throughout the detection process. This significantly improves the reliability and confidence of test results, reduces the risk of erroneous reports due to human error, enhances the uniformity of laboratory quality, and is more conducive to standardization and industrialization.

[0047] Furthermore, the detection system of this invention can effectively avoid the influence of cross-reactive pathogenic microorganisms such as Escherichia coli, Staphylococcus aureus, Enterobacter cloacae, Bacillus cereus, Campylobacter jejuni, Campylobacter coli, Enterococcus faecalis, Candida albicans, Salmonella enterica, Shigella flexneri, Klebsiella pneumoniae, Streptococcus pneumoniae, Pseudomonas aeruginosa, Bacillus subtilis, Proteus vulgaris, and Bacteroides fragilis.

[0048] Furthermore, the detection system of the present invention can also maintain no significant change in the amplification curve of the sample when interfering substances such as blood, white blood cells, gastric juice, hemoglobin, omeprazole, lansoprazole, rabeprazole, levofloxacin, clarithromycin, and ibuprofen are added for detection.

[0049] On another note, the present invention has an integrated reagent kit structure for rapid detection. The kit contains multiple independent reaction tubes, and the primers, probes, rapid premixed solution and other necessary components in each reaction tube can be pre-amplified in a liquid refrigerated state, minimizing the operation preparation time.

[0050] In summary, this invention significantly shortens the detection time without sacrificing the sensitivity and accuracy of the detection. The lowest detection limit reaches 500 copies / mL, and the clinical concordance rate is comparable to that of existing detection methods that take 80 to 120 minutes, as compared with the gene sequencing results of 130 clinical samples. Attached Figure Description

[0051] Figure 1 The graph shows the results of the ultrafast loop program in the experimental group of Example 1.

[0052] Figure 2 The graph shows the results of the ultrafast loop program in the control group of Example 1.

[0053] Figure 3 This is a graph showing the results of the normal loop program in the comparison group of Example 2.

[0054] Figure 4 The figure shows the experimental results of cross-reactivity of the kit of the present invention.

[0055] Figure 5 The figure shows the experimental results of the interference test of the kit of the present invention.

[0056] Figure 6 The PCR amplification curve for identifying ureA in Helicobacter pylori in the limit of detection assay is shown.

[0057] Figure 7 This is a PCR amplification curve of vacA in the limit of detection assay.

[0058] Figure 8This is a PCR amplification curve of cagA in the limit of detection assay. Detailed Implementation

[0059] The technical solution of the present invention will be clearly and completely described below with reference to specific embodiments. Obviously, the described embodiments are only a part of the embodiments of the present invention, and not all of them. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention.

[0060] Unless otherwise stated, all technical and scientific terms used herein have the same meaning as commonly understood in the art to which this invention pertains. The following definitions supplement those in the art and relate to this application, but are not extrapolated to any relevant or unrelated circumstances, such as any conventionally used patent or application. While any methods and materials similar to or equivalent to those described herein may be used in practical testing, the materials and methods described herein are preferred. Therefore, the terminology used herein is intended to describe specific embodiments only and is not intended to limit the invention.

[0061] In this invention, the terms "comprising," "including," and "having" are open-ended descriptions that include the specified steps described, as well as other steps that do not substantially affect them, and are optional and not excluded.

[0062] As explained above, the current method of "typing only, not identification" carries clinical risks. Specifically, it may result in "false negatives" due to the failure of all target virulence genes to be successfully amplified, thus missing actual infections and delaying patient treatment; conversely, it may result in "false positives" due to the successful amplification of all target virulence genes, leading to unnecessary or incorrect treatment for patients. Therefore, developing a detection system that can simultaneously complete Helicobacter pylori identification and virulence gene typing in a single reaction is urgently needed and of great significance for improving detection accuracy, reliability, and clinical guidance value.

[0063] While balancing Helicobacter pylori identification and virulence genotyping, detection methods still have significant room for improvement in terms of speed. Many current methods employ lengthy cyclical procedures and conservative reaction settings, essentially trading time for reliability without deeply optimizing the reaction system for maximum speed. Therefore, there is an urgent need in this field for a rapid detection solution that can simultaneously confirm the presence of Helicobacter pylori and perform accurate virulence typing.

[0064] Furthermore, numerous challenges remain in the testing process. For example, clinical samples (such as gastric mucosa and feces) have complex compositions and often contain PCR inhibitors such as hemoglobin, bile salts, and polysaccharides. If nucleic acid extraction is incomplete, these inhibitors will be eluted along with DNA, non-competitively inhibiting Taq enzyme activity and easily leading to false negatives. Another example is the presence of bacteria and other interfering substances in the sample. These interfering substances can still be amplified by PCR, easily causing false positive signals and misleading clinicians into believing that Helicobacter pylori infection is present. Yet another example is that the pathogen load in the sample may be very low, or the sampling may be inadequate, resulting in insufficient bacterial counts. Consequently, inefficient nucleic acid extraction methods may fail to capture sufficient template DNA, making it impossible to distinguish between true negatives and false negatives. Therefore, further optimization of the testing system is still needed to effectively address these challenges.

[0065] In order to simultaneously identify Helicobacter pylori and characterize its virulence genes, shorten the detection time, and ensure the sensitivity and accuracy of the detection, the inventors completed this invention after a series of studies.

[0066] The first aspect of the present invention provides a kit for rapid detection of Helicobacter pylori and virulence gene typing, comprising: upstream primer 1 (F1), upstream primer 2 (F2), upstream primer 3 (F3), upstream primer 4 (F4), downstream primer 1 (R1), downstream primer 2 (R2), downstream primer 3 (R3), downstream primer 4 (R4), Taqman probe 1 (P1), Taqman probe 2 (P2), Taqman probe 3 (P3), and Taqman probe 4 (P4);

[0067] The nucleotide sequences of the upstream primer 1 (F1) are shown in SEQ ID NO. 1; the downstream primer 1 (R1) is shown in SEQ ID NO. 2; the Taqman probe 1 (P1) is shown in SEQ ID NO. 3; the upstream primer 2 (F2) is shown in SEQ ID NO. 4; the downstream primer 2 (R2) is shown in SEQ ID NO. 5; the Taqman probe 2 (P2) is shown in SEQ ID NO. 6; the upstream primer 3 (F3) is shown in SEQ ID NO. 7; the downstream primer 3 (R3) is shown in SEQ ID NO. 8; the Taqman probe 3 (P3) is shown in SEQ ID NO. 9; the upstream primer 4 (F4) is shown in SEQ ID NO. 10; and the downstream primer 4 (R4) is shown in SEQ ID NO. 10. As shown in SEQ ID NO. 11; the nucleotide sequence of Taqman probe 4 (P4) is shown in SEQ ID NO. 12.

[0068] In some implementations, the molar ratio of upstream primer 1 (F1), upstream primer 2 (F2), upstream primer 3 (F3), upstream primer 4 (F4), downstream primer 1 (R1), downstream primer 2 (R2), downstream primer 3 (R3), downstream primer 4 (R4), Taqman probe 1 (P1), Taqman probe 2 (P2), Taqman probe 3 (P3), and Taqman probe 4 (P4) is 3:3:1:1:3:3:1:1:2:2:1:1.

[0069] In this invention, upstream primer 1 (F1), downstream primer 1 (R1), and Taqman probe 1 (P1) are used for the identification of Helicobacter pylori, targeting the highly conserved and specific urease A (ureA) gene. The ureA gene is a key functional gene for the survival and colonization of Helicobacter pylori, and its presence is a strong indicator of active infection. The ureA gene detection system is used for endogenous quality control, for monitoring sample quality and the detection process, verifying the quality of nucleic acid extraction and the normality of the PCR process; and for confirming Helicobacter pylori infection, clearly distinguishing the presence of Helicobacter pylori genomic DNA in the sample.

[0070] Using the ureA gene detection system as an endogenous quality control allows operators to directly verify the effectiveness of the entire experimental process, from nucleic acid extraction to PCR amplification, transforming molecular diagnostics from a "black box" operation into a transparent, traceable, and quality-controlled process. Furthermore, by introducing internal controls, a dual verification mechanism is provided for both "negative" and "positive" results. ureA- / virulence gene- indicates a true negative, ureA+ / virulence gene- indicates a true negative, ureA+ / virulence gene+ indicates a true positive, and ureA- / virulence gene+ indicates an invalid result requiring retesting, thus avoiding false positive reports. Moreover, the addition of endogenous quality control enables the automatic identification of failed experiments due to sample quality or operational errors, reducing the risk of erroneous reports caused by human misjudgment, improving experimental uniformity, and facilitating standardization and industrialization.

[0071] In this invention, the upstream primer 2 (F2), the downstream primer 2 (R2), and the Taqman probe 2 (P2) target the vacA gene; the upstream primer 3 (F3), the downstream primer 3 (R3), and the Taqman probe 3 (P3) target the cagA gene; both are used together for virulence gene typing.

[0072] In this invention, the primers and probes are designed with suitable melting temperatures and sequence specificity, making them suitable for the "two-step" rapid amplification procedure and ensuring efficient and specific nucleic acid amplification even in a very short time. Furthermore, the primers in this invention do not form dimers or undergo non-specific annealing, thus avoiding competitive consumption of dNTPs, enzymes, and primers, which could lead to decreased sensitivity of the primary detection target or even amplification failure.

[0073] In some embodiments, the 5' end of the probe is attached to a fluorescent reporter group, which is selected from any one of FAM, ROX, VIC / HEX, CY5, CY3, Texas Red, and Alexa Fluor 488 fluorescent dyes.

[0074] In some specific implementations, the fluorescent reporter group is selected from any one of FAM, ROX, VIC / HEX, and CY5.

[0075] In some implementations, there is no overlap in the emission spectra of the fluorescent reporter groups attached to different probes. In some specific implementations, the fluorescent reporter groups at the 5' ends of Taqman probe 1 (P1), Taqman probe 2 (P2), Taqman probe 3 (P3), and Taqman probe 4 (P4) are FAM, ROX, CY5, and HEX, respectively.

[0076] The emission spectra of the fluorescent reporter groups of each probe do not overlap, which avoids "fluorescence crosstalk" caused by spectral overlap, thus not affecting the accuracy of signal-to-noise ratio and Ct value interpretation, and further ensuring the accuracy of detection.

[0077] In some implementations, a fluorescence quenching group is attached to the 3' end of the probe.

[0078] In some specific implementations, the fluorescence quenching group is selected from either BHQ1 or BHQ2.

[0079] In some implementations, the kit also includes PCR amplification reaction solution.

[0080] In some implementations, the PCR amplification reaction solution includes a starting reagent, which may include one or more of MgCl2, Tris, and glycerol.

[0081] In some implementations, the PCR amplification reaction solution also includes dNTPs and buffer.

[0082] In some implementations, the kit also includes enzymes, including DNA polymerase and UNG enzyme.

[0083] In some implementations, the DNA polymerase is a hot-start rapid DNA polymerase. In some specific implementations, the DNA polymerase is Taq QS II.

[0084] In this invention, a hot-start rapid DNA polymerase is used, which is usually genetically engineered to have extremely high elongation rate and thermal stability, effectively improving the speed and efficiency of amplification.

[0085] In some implementations, the kit also includes a negative control and / or a positive control.

[0086] In some implementations, the positive control is a mixed plasmid DNA containing all targets.

[0087] In some implementation schemes, the target gene channels of the positive control all exhibit S-shaped amplification curves, and the Ct value is <32.

[0088] In some implementations, the negative control is purified water.

[0089] In some implementations, the negative control showed no amplification curves or no obvious S-shaped curves in any of its channels.

[0090] In some implementations, the kit includes multiple independent reaction tubes, with the primers, probes, and other necessary components of this invention pre-alication into each tube. Users only need to add the template nucleic acid for immediate detection, minimizing setup time.

[0091] A second aspect of the present invention provides a composition for rapid detection of Helicobacter pylori and virulence gene typing, comprising primers F1, F2, F3, F4, R1, R2, R3, R4 and probes P1, P2, P3 and P4 of the present invention.

[0092] The above-described technical solutions in the kit of the present invention are also applicable to the compositions of the present invention.

[0093] Based on a general inventive concept, since the composition of the present invention adopts some or all of the technical solutions of the above embodiments, it has at least all the beneficial effects brought about by the technical solutions of the above embodiments, which will not be repeated here.

[0094] A third aspect of the present invention provides an analyzer for rapid detection of Helicobacter pylori and virulence genotyping, comprising:

[0095] The reaction module includes a reagent supply section and a mixing chamber. The reagent supply section is provided with a placement position for placing reagent containers. The placement position holds the primers F1, F2, F3, F4, R1, R2, R3 and R4 and probes P1, P2, P3 and P4 of the present invention. The mixing chamber is used to mix the sample with the reagents.

[0096] Temperature control device for heating and cooling the reaction module; and

[0097] The controller is configured to control the temperature control device to perform the following procedure:

[0098] 1) Pre-denaturation: 95℃, 30 to 60 seconds;

[0099] 2) Denaturation: 95℃, 2 to 5 seconds;

[0100] 3) Annealing, extension, and fluorescence signal acquisition: 8 to 15 seconds.

[0101] Among them, steps 2) and 3) are repeated 35 to 45 times; and

[0102] The detection module includes a detection area and at least one optical detector.

[0103] This invention optimizes the cyclic procedure and combines it with the previously used reaction system to ensure efficient and specific nucleic acid amplification in an extremely short time. This reduces the detection time from 80 to 120 minutes required by traditional methods to approximately 30 minutes, increasing efficiency by 3 to 4 times and achieving an order-of-magnitude improvement in detection speed. Shortening the detection time minimizes in vitro manipulation time, maintains the integrity of the nucleic acid, and ensures the accuracy and reliability of the test results. Furthermore, it allows for the rapid provision of pathogen or drug resistance information in the early stages of hospitalization, guiding immediate medication and significantly optimizing the clinical diagnosis and treatment process.

[0104] In some implementations, the reagent supply unit is configured to provide primers, probes, and other necessary components to the mixing chamber.

[0105] In some embodiments, the mixing chamber is configured to mix the sample to be tested with a corresponding reaction solution. In some specific embodiments, the reaction solution may be the primers, probes, and other necessary components of the present invention.

[0106] In some implementations, the analyzer also includes a non-transitory computer-readable storage medium programmed with computer applications.

[0107] In some implementations, the controller executes a computer application stored on a non-transitory computer-readable storage medium, performing the aforementioned program.

[0108] In some implementations, the duration of step 1) can be 30 seconds, 40 seconds, 50 seconds, or 60 seconds. In some specific implementations, the duration of step 1) is 40 to 60 seconds.

[0109] In some implementations, step 2) can be 2 seconds, 3 seconds, 4 seconds, or 5 seconds. In some specific implementations, the duration of step 2) is 3 to 4 seconds.

[0110] In some implementations, the duration of step 3) can be 8 seconds, 9 seconds, 10 seconds, 11 seconds, 12 seconds, 13 seconds, 14 seconds, or 15 seconds. In some specific implementations, the duration of step 3) is 9 to 11 seconds.

[0111] The following describes preferred embodiments of the present invention, but the scope of protection of the present invention is not limited to these preferred embodiments. It should be noted that any modifications and improvements made by those skilled in the art based on this inventive concept are within the scope of protection of the present invention. All reagents used, unless otherwise specified, are commercially available conventional products.

[0112] The specific sequences used in the embodiments of the present invention are shown in Table 1.

[0113] Table 1

[0114]

[0115] Each Taqman probe has a fluorescent reporter group and a fluorescent quencher group attached to its 5' and 3' ends, respectively. Specifically, the fluorescent reporter groups at the 5' ends of Taqman probes 1 to 4 are FAM, ROX, CY5, and HEX, respectively; the fluorescent quencher group at the 3' ends of Taqman probes 1 and 4 is BHQ1, and the fluorescent quencher group at the 3' ends of Taqman probes 2 and 3 is BHQ2.

[0116] Example 1: Combined detection of Helicobacter pylori drug resistance and host metabolic typing

[0117] In this embodiment, the above primer-probe combinations were used for detection, and the primer pairs for the gene loci were replaced with other primers while keeping the probe sequences unchanged as a control group. The specific PCR systems prepared are shown in Table 2.

[0118] Robustart Taq QSⅡ was purchased from Zhuhai Baorui Biotechnology, catalog number E20, and was equipped with Taq Buffer, MgCl2 (25mM), and dNTPs (10mM).

[0119] Replace the sequence of downstream primer 1 with ATGGAAGTGTGAGCCGATTTG (SEQ ID NO.13);

[0120] Replace the sequence of upstream primer 2 with ATGGAACAAGCTTGAAGTGGATATG (SEQ ID NO.14);

[0121] Replace the sequence of downstream primer 3 with AAAAATATCCAGCCAATCCCC (SEQ ID NO.15);

[0122] Table 2

[0123]

[0124] The final concentrations of upstream primer 1, upstream primer 2, downstream primer 1, downstream primer 2, replacement downstream primer 1, and replacement upstream primer 2 were 0.3 μM; the final concentrations of Taqman probe 1 and Taqman probe 2 were 0.2 μM; and the final concentrations of upstream primer 3, upstream primer 4, downstream primer 3, downstream primer 4, replacement downstream primer 3, Taqman probe 3, and Taqman probe 4 were 0.1 μM.

[0125] In the reaction system of this invention, upstream primer 1 (F1), downstream primer 1 (R1), and Taqman probe 1 (P1) are used for the identification of Helicobacter pylori, targeting the highly conserved and specific urease A (ureA) gene of Helicobacter pylori; upstream primer 2 (F2), downstream primer 2 (R2), and Taqman probe 2 (P2) target the vacA gene; upstream primer 3 (F3), downstream primer 3 (R3), and Taqman probe 3 (P3) target the cagA gene, and both are used for virulence genotyping.

[0126] When a sample contains Helicobacter pylori, the P1 channel for identifying Helicobacter pylori will show an S-shaped amplification curve; when vacA and / or cagA are present in the sample, the P2 and / or P3 channels will each show an S-shaped amplification curve; as long as the nucleic acid extraction of the sample is successful, the P4 quality control channel will show an S-shaped amplification curve.

[0127] Gastric mucosal tissue samples (confirmed to contain Helicobacter pylori and exhibiting vacA and cagA) were extracted using a commercially available nucleic acid extraction kit. The obtained nucleic acid was used as the sample nucleic acid for subsequent applications. 2.5 μL of the sample nucleic acid was added directly to a reaction tube containing PCR reaction solution AF, the tube was capped, centrifuged, and then analyzed.

[0128] The PCR reaction tubes were placed in a fluorescence PCR instrument (SLAN-96H fully automated medical PCR analysis system) for amplification and detection. The amplification parameters were set as shown in Table 3 below.

[0129] Table 3

[0130]

[0131] After amplification, the test results for each sample were obtained by analysis using the instrument software. The results for the experimental group are as follows: Figure 1 As shown, the experimental results of the control group are as follows: Figure 2 As shown.

[0132] from Figure 1 andFigure 2 As can be seen, all channels in the experimental group exhibited typical S-shaped curves with clear inflection points, while the channels in the control group with replaced sites showed no amplification curves or had delayed peaks. Furthermore, it can be observed that the Ct values ​​in the experimental group were earlier; the Ct values ​​in the control group with replaced sites were significantly delayed or failed to meet detection requirements. The fluorescence signal in the experimental group was strong with a clear plateau phase; the fluorescence signal in the control group was weak and failed to reach the interpretation threshold.

[0133] This demonstrates that the detection system of the present invention enables rapid detection compared to the replacement primers used in the control group.

[0134] Example 2: Investigation into the shortest amplification time

[0135] Keeping the PCR reaction systems of the experimental and control groups in Example 1 unchanged, the PCR program was adjusted as shown in Table 4 below.

[0136] Table 4

[0137]

[0138] After amplification, the instrument software analyzes the results of each sample to obtain the detection results. The results for an amplification time of 40 seconds are shown below. Figure 3 As shown.

[0139] from Figure 3 As can be seen, the minimum annealing extension time required for the control group to achieve amplification efficiency comparable to that of the experimental group is 40 seconds. In this case, the total detection time is 80 minutes (which also includes the necessary time for the instrument to heat up and down), which is significantly longer than the detection time of the present invention.

[0140] Example 3: Validation of reagent kit performance indicators

[0141] 1. Specificity assessment of the reagent kit

[0142] The analytical specificity of the kit is mainly tested from two aspects: cross-reactivity and interference assays.

[0143] Cross-reactivity mainly examines wild-type bacteria that may exhibit cross-reactivity and other mutated gene types that may cause cross-reactivity, as well as whether pathogens and closely related bacteria that cause similar symptoms to Helicobacter pylori produce false positive results, effectively reducing the probability of false positives in clinical testing.

[0144] To assess the impact of potential cross-reactivity in gastric mucosal samples on test results, this experiment investigated 16 cross-reactive pathogenic microorganisms, including Escherichia coli, Staphylococcus aureus, Enterobacter cloacae, Bacillus cereus, Campylobacter jejuni, Campylobacter coli, Enterococcus faecalis, Candida albicans, Salmonella enterica, Shigella flexneri, Klebsiella pneumoniae, Streptococcus pneumoniae, Pseudomonas aeruginosa, Bacillus subtilis, Proteus vulgaris, and Bacteroides fragilis.

[0145] After counting and inactivating the above-mentioned pathogens, the samples were diluted to the required concentration, and nucleic acid was extracted using a bacterial extraction reagent. 2 μL each of the sample to be tested, positive control, and negative control were added to the reagent reaction tubes of this invention, the tubes were capped, and centrifuged for 20 seconds. Then, the PCR parameters were set according to Example 1, and the experimental results were analyzed. The experimental results are as follows: Figure 4 As shown.

[0146] from Figure 4 As can be seen, no amplification curves were generated for any of the cross-reactive pathogens, which indicates that the detection combination of the present invention can effectively avoid the influence of cross-reactive pathogens.

[0147] Interference testing primarily examines endogenous and exogenous substances that may interfere with sample detection, leading to false negatives. By eliminating the influence of these substances on sample detection results, the accuracy of the kit can be improved.

[0148] To assess the impact of potential interfering substances in gastric mucosal samples on the detection results, 16 human gastric mucosal tissue samples were selected. Interfering substances included blood, leukocytes, gastric juice, hemoglobin, omeprazole, lansoprazole, rabeprazole, levofloxacin, clarithromycin, and ibuprofen. Each sample was homogenized and divided into three aliquots (without interfering substances) and three aliquots (with interfering substances added), and extracted using nucleic acid extraction reagents. 2 μL each of the sample to be tested, positive control, and negative control were added to the reagent reaction tubes of this invention, capped, and centrifuged for 20 seconds. Then, the PCR parameters were set according to Example 1, and the experimental results were analyzed. The results are as follows: Figure 5 As shown.

[0149] from Figure 5 As can be seen, after adding interfering substances for detection, the amplification curve of the sample did not change significantly, which indicates that the detection combination of the present invention can effectively avoid the influence of interfering substances.

[0150] 2. Evaluation of the reagent kit's limit of detection capability

[0151] The limit of detection capability of the kit was evaluated by detecting samples with different nucleic acid concentrations. This was achieved through repeated testing at 2 × 10⁻⁶. 5 copies / mL, 2×104 copies / mL, 1×10 3 copies / mL, 5×10 2 copies / mL, 5×10 1 Five different nucleic acid concentration levels were tested, with the results for a concentration of 500 copies / mL as shown below. Figures 6 to 8 As shown, the limit of detection for the kit is thus determined to be 500 copies / mL.

[0152] Example 4: Clinical application of the reagent kit

[0153] The clinical application of the kit was examined by comparing the test results from the kit with those from gene sequencing. The specific methods are as follows:

[0154] The reaction system was prepared according to Example 1.

[0155] Gastric mucosal tissues were collected from 130 patients who were Helicobacter pylori negative and positive, and nucleic acids were extracted from them. The nucleic acids were then tested according to the method of this invention. At the same time, the extracted nucleic acids were subjected to gene sequencing to verify the accuracy of the test kit.

[0156] The test results of clinical samples were compared and analyzed according to the following result interpretation criteria. The statistical results are shown in Tables 5 to 7 below.

[0157] The criteria for judging the test results are as follows:

[0158] FAM channel: A sample showing an S-shaped amplification curve and a Ct value ≤ 36 indicates a positive result for Helicobacter pylori. A Ct value > 36 indicates a negative result for Helicobacter pylori.

[0159] ROX channel: A sample showing an S-shaped amplification curve and a Ct value ≤ 37 indicates that the vacA gene is positive in the sample. If the Ct value > 37, it indicates that Helicobacter pylori is negative in the sample.

[0160] CY5 channel: A sample showing an S-shaped amplification curve and a Ct value ≤ 36 indicates that the cagA gene is positive in the sample. If the Ct value > 36, it indicates that Helicobacter pylori is negative in the sample.

[0161] Table 5

[0162]

[0163] Table 6

[0164]

[0165] Table 7

[0166]

[0167] As can be seen from Table 5, the kit of the present invention has a positive concordance rate of 95.45% and a negative concordance rate of 95.24% for Helicobacter pylori ureA.

[0168] As can be seen from Table 6, the kit of the present invention has a positive concordance rate of 95.29% and a negative concordance rate of 100% for the virulence gene vacA.

[0169] As can be seen from Table 7, the kit of the present invention has a positive concordance rate of 96.00% and a negative concordance rate of 92.31% for the virulence gene cagA.

[0170] The above results confirm that the specific primer-probe combination and detection system provided by this invention can be effectively used for the accurate detection of clinical samples, solving the problems of long test cycles, cumbersome operation, and lack of endogenous quality control in existing technologies, and providing reliable and rapid technical support for clinical practice.

[0171] The above description is merely a preferred embodiment of the present invention and is not intended to limit the scope of protection of the present invention.

Claims

1. A kit for rapid detection and virulence genotyping of Helicobacter pylori, comprising: Primers F1, F2, F3, F4, R1, R2, R3, R4 and probes P1, P2, P3 and P4; in, The sequence of F1 is shown in SEQ ID NO. 1; The sequence of R1 is shown in SEQ ID NO. 2; The sequence of P1 is shown in SEQ ID NO. 3; The sequence of F2 is shown in SEQ ID NO. 4; The sequence of R2 is shown in SEQ ID NO. 5; The sequence of P2 is shown in SEQ ID NO. 6; The sequence of F3 is shown in SEQ ID NO. 7; The sequence of R3 is shown in SEQ ID NO. 8; The sequence of P3 is shown in SEQ ID NO. 9; The sequence of F4 is shown in SEQ ID NO. 10; The sequence of R4 is shown in SEQ ID NO. 11; The sequence of P4 is shown in SEQ ID NO.

12.

2. The reagent kit according to claim 1, characterized in that, The probe has a fluorescent reporter group attached to its 5' end, and the emission spectra of the fluorescent reporter groups attached to different probes do not overlap.

3. The reagent kit according to claim 1, characterized in that, The kit further includes a PCR amplification reaction solution, DNA polymerase, and water, wherein the DNA polymerase is a hot-start rapid DNA polymerase.

4. A composition for rapid detection and virulence genotyping of Helicobacter pylori, characterized in that, The composition includes primers F1, F2, F3, F4, R1, R2, R3 and R4 as defined in claim 1 and probes P1, P2, P3 and P4.

5. The composition according to claim 4, characterized in that, The probe has a fluorescent reporter group attached to its 5' end, and the emission spectra of the fluorescent reporter groups attached to different probes do not overlap.

6. An analyzer for rapid detection and virulence genotyping of Helicobacter pylori, characterized in that, The analyzer includes: The reaction module includes a reagent supply section and a mixing chamber. The reagent supply section is provided with a placement position for placing reagent containers. The placement position holds primers F1, F2, F3, F4, R1, R2, R3 and R4 and probes P1, P2, P3 and P4 as defined in claim 1. The mixing chamber is used to mix the sample with the reagents. A temperature control device, used for heating and cooling the reaction module; A controller, configured to control the temperature control device to execute the following program: 1) Pre-denaturation: 95℃, 30 to 60 seconds; 2) Denaturation: 95℃, 2 to 5 seconds; and 3) Annealing, extension, and fluorescence signal acquisition: 8 to 15 seconds. Among them, steps 2) and 3) are repeated 35 to 45 times; and The detection module includes a detection area and at least one optical detector.

7. The analyzer according to claim 6, characterized in that, The time for step 1) is 40 to 60 seconds.

8. The analyzer according to claim 6, characterized in that, The time for step 2) is 3 to 4 seconds.

9. The analyzer according to claim 6, characterized in that, The time for step 3) is 9 to 11 seconds.

Citation Information

Patent Citations

  • Helicobacter pylori (HP) type and drug-resistant mutation gene detection kit

    CN104846097A

  • Real-time fluorescent PCR (Polymerase Chain Reaction) specific primer and probe combination for helicobacter pylori vacA genotyping

    CN116103417A

  • Helicobacter pylori nucleic acid typing detection method, kit and application

    CN116904629A

  • Oligonucleotide, primer for detecting helicobacter pylori consisting thereof and detection of helicobacter pylori using the same

    JP1997065899A