Recombinant saccharomyces cerevisiae engineering bacterium as well as construction method and application thereof

Abstract

The invention belongs to the technical field of genetic engineering and microorganism application, particularly relates to a recombinant saccharomyces cerevisiae engineering bacterium capable of producing glutathione at high yield and enriching iron and zinc, and further discloses application of the recombinant saccharomyces cerevisiae engineering bacterium to preparation of an active product containing a metal chelated polyphenol compound by fermentation of pomegranate peel waste and further regulation and control of a hair follicle microenvironment to promote hair regeneration. According to the scheme, the saccharomyces cerevisiae is subjected to three-site collaborative editing (YPRC delta 15 / Ubp6 / rDNA) through a CRISPR / Cas9 technology, so that the synthesis capability of glutathione is improved, and efficient enrichment of iron and zinc is synchronously realized; the pomegranate peel waste is further utilized for fermentation, macromolecular ellagic acid ester is converted into micromolecular gallic acid, the micromolecular gallic acid and metal ions form a bioactive chelate, a Wnt / beta-catenin pathway can be activated to promote hair papilla cell proliferation, and finally a full-pathway synergistic solution of'oxidation resistance-metal homeostasis-regeneration repair 'is formed.

Description

Technical Field

[0001] This invention belongs to the field of genetic engineering and microbial application technology, specifically relating to a recombinant Saccharomyces cerevisiae engineered strain, especially a recombinant Saccharomyces cerevisiae engineered strain that produces high levels of glutathione and is enriched in iron and zinc. Furthermore, it discloses the application of using pomegranate peel waste to ferment and prepare an active product containing a metal chelate polyphenol complex, thereby regulating the hair follicle microenvironment to promote hair regeneration. Background Technology

[0002] In recent years, with increasing life pressures, the number of people experiencing hair loss has been rising year by year. The unique nature of hair loss treatment has also led to a technological impasse in the field. Currently, while drugs like minoxidil are widely used, they still exhibit significant drug dependence, with a relapse rate exceeding 60% after discontinuation, and they fail to synergistically regulate the multidimensional pathological mechanisms of hair follicle regeneration.

[0003] Studies show that hair loss is closely related to the condition of hair follicles, especially since inflammation of the hair follicles can damage them, thus affecting normal hair growth. Therefore, in the medical field, adjusting the condition of hair follicles and promoting their regeneration is of great significance in improving hair loss symptoms, and its treatment effect is directly related to the patient's skin health and quality of life.

[0004] At its root, the hair follicle microenvironment suffers from three interconnected biological barriers. First, excessive free iron / zinc ions generate reactive oxygen species (ROS) through the Fenton reaction, directly triggering hair follicle cell apoptosis. Second, overactivation of 5α-reductase leads to abnormal accumulation of dihydrotestosterone (DHT), disrupting the homeostasis of the hair follicle growth cycle. Third, the transdermal permeability of the hair follicle sheath to large molecular weight active substances (>500 Da) is less than 30%, severely limiting treatment efficiency. Therefore, this is the crux of why traditional single-active-ingredient therapies have consistently failed to achieve a fundamental breakthrough due to their inability to simultaneously address oxidative stress, hormonal imbalances, and transdermal barrier issues.

[0005] Therefore, it is of great significance to develop a method that can synergistically improve hair follicle problems and thus solve hair loss. Summary of the Invention

[0006] The purpose of this invention is to provide a recombinant Saccharomyces cerevisiae engineered strain based on metabolic engineering, wherein the engineered strain can form a three-module synergistic expression system of metabolic synthesis-oxidative balance-metal transport, and its fermentation products have the effect of promoting hair follicle regeneration.

[0007] The second objective of this invention is to provide a method for constructing the above-mentioned recombinant brewer's yeast engineered strain;

[0008] The third objective of this invention is to provide an active composition that can promote hair follicle regeneration. The active composition is a fermentation product obtained by fermentation and extraction based on the above-mentioned recombinant Saccharomyces cerevisiae engineered strain. The fermentation product has a cascade reaction performance of "antioxidant-angiogenesis-regeneration and repair", which can realize the repair and regeneration of hair follicles.

[0009] A fourth objective of this invention is to provide a method for preparing the above-mentioned active composition and its application.

[0010] To address the aforementioned issues, this invention constructs a recombinant Saccharomyces cerevisiae engineered strain. This recombinant Saccharomyces cerevisiae engineered strain uses Saccharomyces cerevisiae as the host strain and highly expresses GSH1, GSH2, GLR1, and SOD1 genes at the YPRCΔ15 and Ubp6 sites. Furthermore, it inserts CUP1, SUL2, CCC1, COT1, and CPY genes at the rDNA sites.

[0011] Specifically, in the recombinant brewer's yeast engineered strain:

[0012] The nucleotide sequence of the GSH1 gene has the SGD database number: S000003637;

[0013] The nucleotide sequence of the GSH2 gene has the SGD database number: S000005409;

[0014] The nucleotide sequence of the GLR1 gene has the SGD database number: S000006012;

[0015] The nucleotide sequence of the SOD1 gene has the SGD database number: S000003865;

[0016] The nucleotide sequence of the CUP1 gene has an SGD database number of S000001095.

[0017] The nucleotide sequence of the SUL2 gene has an SGD database number of S000004082.

[0018] The nucleotide sequence of the CCC1 gene has an SGD database number of S000004210.

[0019] The nucleotide sequence of the COT1 gene has an SGD database number of S000005843.

[0020] The nucleotide sequence of the CPY gene has an SGD database number of SGD ID: S000004912.

[0021] In the construction of the aforementioned strains, all gene sequences used can be found in the Saccharomyces cerevisiae Genome Database (www.yeastgenome.org). Specifically, the SGD accession numbers for GSH1, GSH2, GLR1, SOD1, CUP1, SUL2, CCC1, and CPY are as follows: GSH1: SGD ID: S000003637; GSH2: SGD ID: S000005409; GLR1: SGD ID: S000006012; SOD1: SGD ID: S000003865; CUP1: SGD ID: S000001095; CUL2: SGD ID: S000004082; COT1: SGD ID: S000004210; COT1: SGD ID: S000005843; and CPY: SGD ID: S000005843. ID: S000004912.

[0022] Specifically, the recombinant Saccharomyces cerevisiae engineered strain uses the TEF1 and TDH3 strong promoters to drive the expression of target genes.

[0023] Specifically, the recombinant brewer's yeast engineered strain has CICC 1406 yeast as its host strain.

[0024] The present invention also provides a method for constructing the recombinant brewer's yeast engineered strain as described above, comprising the following steps:

[0025] (1) Using a selected Saccharomyces cerevisiae starting strain, a co-expression module of endogenous γ-glutamylcysteine ​​synthase (GSH1) and glutathione synthase (GSH2) was integrated at the YPRCΔ15 genomic locus, while endogenous glutathione reductase (GLR1) and superoxide dismutase (SOD1) driven by the TEF1 / TDH3 strong promoter were overexpressed at the Ubp6 locus.

[0026] (2) Continue to construct a metal transport network at its high copy site, overexpress endogenous metallothionein (CUP1), vacuole transporter (CCC1 / COT1), sulfate transporter (SUL2), and vacuole serine carboxypeptidase CPY gene to form a three-module synergistic expression system of metabolic synthesis-oxidative balance-metal transport.

[0027] The present invention also provides a method for preparing an active composition that can promote hair follicle regeneration, comprising the steps of inoculating the recombinant Saccharomyces cerevisiae engineered strain into a fermentation medium for fermentation culture, and collecting the fermentation products for extraction of active ingredients.

[0028] Preferably, the fermentation medium contains 30-35 g / L of pomegranate peel and / or ferrous sulfate and zinc sulfate at a final concentration of 0.1-0.15 g / L;

[0029] Preferably, the active ingredient extraction step includes mixing with 30-50% v / v ethanol, and collecting the supernatant through solid-liquid separation and then drying and freezing it.

[0030] In some feasible embodiments, the process involves selecting fresh pomegranate peel and extracting the active ingredients. For example, dried pomegranate peel is pulverized to 80 mesh, added to YPD medium at a ratio of 1:30 (g / mL), sterilized at 121°C for 20 minutes, and then subjected to ultrasonic-assisted extraction (40kHz, 300W, 30min).

[0031] In some feasible implementations, after fermentation, the fermentation broth is treated with ethanol cell disruption technology. 40% ethanol (v / v) is added to the fermentation broth, and the mixture is shaken at 45°C for 30 min. The broth is then centrifuged (8000×g, 15 min) to obtain the supernatant. The supernatant is pre-frozen at -40°C for 6 h and then dried under vacuum of 10 Pa for 22 h to obtain a dry powder form of the pomegranate peel fermentation broth.

[0032] Specifically, the method for preparing the active composition that promotes hair follicle regeneration includes a fermentation culture step comprising an enrichment culture step and a product synthesis culture step; wherein,

[0033] The enrichment culture step is carried out at a temperature of 28-32℃, dissolved oxygen of 35-45%, pH of 7.2±0.1, and a culture time of 15-18h; when the glucose concentration is <5g / L, a glucose solution of 350-450g / L is added.

[0034] The product synthesis culture step is carried out at a temperature of 25-30℃, dissolved oxygen ≤15%, pH 6.8±0.2, and culture time of 28-32h.

[0035] In some feasible implementations, the fermentation culture step includes an enrichment culture step and a product synthesis culture step; wherein,

[0036] First stage enrichment culture (0-18h): 70% liquid volume in fermenter, inoculated with 5% bacterial suspension; control parameters: temperature 30℃, dissolved oxygen 40%, pH 7.2±0.1; feeding strategy: when glucose concentration <5g / L, add 400g / L glucose solution (flow rate 0.8mL / min).

[0037] Second stage of product synthesis (19-48h): Switch to induction mode: temperature 28℃, dissolved oxygen ≤15%, pH 6.8±0.2; terminate fermentation when cell OD no longer increases.

[0038] The present invention also provides an active composition that can promote hair follicle regeneration, prepared by the method described above.

[0039] The present invention also provides the use of the recombinant Saccharomyces cerevisiae engineered strain and its fermentation products or the active composition having hair growth-promoting properties for the preparation of a pharmaceutical formulation that promotes hair follicle regeneration.

[0040] The present invention also provides a pharmaceutical composition that can promote hair follicle regeneration or promote hair growth, comprising the fermentation product of the recombinant Saccharomyces cerevisiae engineered strain or the active composition having hair growth-promoting properties.

[0041] The recombinant Saccharomyces cerevisiae engineered strain of this invention is constructed using CRISPR / Cas9 three-site co-editing technology without introducing any exogenous genes, resulting in a recombinant strain with dual functions of detoxification and metal enrichment. The recombinant Saccharomyces cerevisiae engineered strain of this invention uses Saccharomyces cerevisiae CICC 1406 as the starting strain. It integrates a co-expression module of endogenous γ-glutamylcysteine ​​synthase (GSH1) and glutathione synthase (GSH2) at the YPRCΔ15 genomic locus. Simultaneously, it overexpresses endogenous glutathione reductase (GLR1) and superoxide dismutase (SOD1) driven by the TEF1 / TDH3 strong promoter at the Ubp6 site. Furthermore, it constructs a metal transport network at high copy sites on the rDNA, overexpressing endogenous metallothionein (CUP1), vacuole transporters (CCC1 / COT1), sulfate transporter (SUL2), and the vacuole serine carboxypeptidase (CPY) gene. The engineered strains described in this invention can form a three-module synergistic expression system of metabolic synthesis-oxidative equilibrium-metal transport, which significantly improves the enrichment efficiency of iron and zinc elements.

[0042] The fermentation product obtained by fermenting the recombinant Saccharomyces cerevisiae engineered strain of this invention using pomegranate peel as a substrate has been verified to significantly improve hair follicle condition and promote hair follicle regeneration, and can be used to promote hair regeneration in cases of hair loss. The core efficacy of the fermented active product of this invention stems from its unique synergistic mechanism: high concentrations of glutathione (GSH) can effectively scavenge reactive oxygen free radicals (such as ·OH and H2O2) generated by the Fenton reaction, significantly reducing oxidative stress damage. This is mainly achieved through GSH-dependent enzymes (such as glutathione peroxidase); simultaneously, as a reducing agent, GSH affects the expression of downstream genes by activating the NF-κB signaling pathway. The DHT inhibition rate of the engineered strain XL04 constructed by this invention was experimentally verified to reach 33.7%, which is far higher than the effect of single components. Chelated iron ions may indirectly affect cellular processes by regulating redox state. The VEGF level in the XL04 group increased to 286.4 pg / mL (191% higher than the blank group). Zinc ion chelates and GSH may synergistically promote cell proliferation. Evidence shows that GSH supports proliferation in redox homeostasis, which may be related to the antioxidant and signal regulation of GSH. The three synergistically form a cascade reaction of "antioxidation-angiogenesis-regeneration and repair", which ultimately achieved a breakthrough increase in hair follicle density of 28.6 cells / cm² in clinical trials.

[0043] This invention innovatively constructs a mechanism based on a microbial-plant synergistic system: through CRISPR / Cas9 technology, three-point synergistic editing of *Saccharomyces cerevisiae* (YPRCΔ15 / Ubp6 / rDNA) is performed, for the first time increasing glutathione (GSH) synthesis capacity by 75% to 212.7 mg / L, while simultaneously achieving efficient enrichment of iron (66.10%) and zinc (33.65%), blocking ROS generation at its source. Furthermore, pomegranate peel waste is fermented to convert macromolecular ellagic acid esters into small-molecule gallic acid, increasing the transdermal penetration rate of active ingredients to over 60%, and forming bioactive chelates with metal ions. This active complex promotes dermal papilla cell proliferation by activating the Wnt / β-catenin pathway, inhibits the downregulation of 5α-reductase expression in the NF-κB pathway, and simultaneously enhances hair follicle angiogenesis by upregulating HIF-1α with iron ions, ultimately forming a synergistic solution across the entire pathway of "antioxidant-metal homeostasis-regeneration and repair". Attached Figure Description

[0044] To make the content of this invention easier to understand, the invention will be further described in detail below with reference to specific embodiments and accompanying drawings, wherein...

[0045] Figure 1 The results show the glutathione production of engineered strains XL01 and XL02 in Example 3;

[0046] Figure 2The results show the iron enrichment rate of engineered strains XL01-XL04 in Example 5;

[0047] Figure 3 The results show the iron enrichment level and growth status of the engineered strain XL04 in Example 5;

[0048] Figure 4 The results show the comparison of zinc enrichment levels of engineered strains XL02-XL05 in Example 5;

[0049] Figure 5 The results show the zinc enrichment level and growth status of the engineered strain XL04 in Example 5;

[0050] Figure 6 The results show the effect of the fermentation broth of strain XL04 on the proliferation of human dermal papilla cells in Example 8. Detailed Implementation

[0051] In the following embodiments of the present invention, a recombinant Saccharomyces cerevisiae engineered strain was constructed based on genetic engineering methods. The recombinant Saccharomyces cerevisiae engineered strain uses Saccharomyces cerevisiae as the host strain and highly expresses GSH1, GSH2, GLR1, and SOD1 genes at YPRCΔ15 and Ubp6 sites, and inserts CUP1, SUL2, CCC1, COT1, and CPY genes at rDNA sites.

[0052] The sequence characteristics of the inserted gene designed in the recombinant Saccharomyces cerevisiae engineered strain are as follows:

[0053] The nucleotide sequence of the GSH1 gene has the SGD database number: S000003637;

[0054] The nucleotide sequence of the GSH2 gene has the SGD database number: S000005409;

[0055] The nucleotide sequence of the GLR1 gene has the SGD database number: S000006012;

[0056] The nucleotide sequence of the SOD1 gene has the SGD database number: S000003865;

[0057] The nucleotide sequence of the CUP1 gene has an SGD database number of S000001095.

[0058] The nucleotide sequence of the SUL2 gene has an SGD database number of S000004082.

[0059] The nucleotide sequence of the CCC1 gene has an SGD database number of S000004210.

[0060] The nucleotide sequence of the COT1 gene has an SGD database number of S000005843.

[0061] The nucleotide sequence of the CPY gene has an SGD database number of SGD ID: S000004912.

[0062] In the construction of the aforementioned strains, all gene sequences used can be found in the Saccharomyces cerevisiae Genome Database (www.yeastgenome.org). Specifically, the SGD accession numbers for GSH1, GSH2, GLR1, SOD1, CUP1, SUL2, CCC1, and CPY are as follows: GSH1: SGD ID: S000003637; GSH2: SGD ID: S000005409; GLR1: SGD ID: S000006012; SOD1: SGD ID: S000003865; CUP1: SGD ID: S000001095; CUL2: SGD ID: S000004082; COT1: SGD ID: S000004210; COT1: SGD ID: S000005843; and CPY: SGD ID: S000005843. ID: S000004912.

[0063] In the following embodiments of the present invention, Saccharomyces cerevisiae engineered strains XL01, XL02, XL03, XL04 and XL05 were constructed based on the above-designed genetic engineering methods. The detailed phenotypic information of the constructed strains is shown in Table 1 below.

[0064] Table 1. Engineered bacteria constructed in the embodiments of the present invention.

[0065] In the following embodiments of the present invention, the primer information used in the construction of engineered Saccharomyces cerevisiae XL01, XL02, XL03, XL04, and XL05 is detailed in Tables 2-4 below.

[0066] Table 2 Primers for plasmid construction (5'→3')

[0067]

[0068] Table 3 Primers for constructing strains XL01 and XL02 (5'→3')

[0069]

[0070] Table 4 Primers for constructing strains XL03 and XL04 (5'→3')

[0071]

[0072] In addition, in the following embodiments of the present invention, the PCR amplification procedure can be completed using conventional PCR systems and procedures in the art.

[0073] As an exemplary embodiment, the following embodiments of the present invention employ the following PCR amplification system and amplification procedure to complete the expected PCR amplification:

[0074] The PCR amplification system is 50 μL: PrimeSTAR Max Premix (2×) 25 μL, upstream primer with a concentration of 10 μmol / L 1 μL, downstream primer with a concentration of 10 μmol / L 1 μL, template 1 μL, and ddH2O to make up to 50 μL.

[0075] The PCR amplification program is as follows: 98 ℃ pre-denaturation for 5 min; 98 ℃ denaturation for 30 sec, annealing at 63-58 ℃ (decreasing by 0.5 ℃ per cycle) for 10 sec, extension at 72 ℃ for 1 min, 10 cycles; 98 ℃ denaturation for 30 sec, 58 ℃ annealing for 10 sec, extension at 72 ℃ for 1 min, 25 cycles; 72 ℃ full extension for 10 min, storage at -20 ℃.

[0076] In the following embodiments of the present invention, the PCR procedure for each embodiment is the same as this procedure.

[0077] In the following embodiments of the present invention, the culture medium for the engineered bacteria construction method includes:

[0078] YPD solid culture medium consists of: 10 g / L yeast extract, 20 g / L peptone, 20 g / L glucose, and 20 g / L agar, with deionized water as the solvent and natural pH.

[0079] YPD liquid culture medium consists of 10 g / L yeast extract, 20 g / L peptone, and 20 g / L glucose, with deionized water as the solvent and natural pH.

[0080] In the following embodiments of the present invention, the construction method of the yeast strains XL01-XL05 is based on the methods described in Chinese patents CN117625426A and CN117363501A, and the sequence structure or expression of the same genes involved are the same.

[0081] Example 1

[0082] This embodiment describes the construction of a yeast strain XL01 that can efficiently and effectively produce glutathione.

[0083] As shown in Table 1 above, the phenotypic information of XL01 indicates that the engineered Saccharomyces cerevisiae described in this embodiment highly expresses the γ-glutamylcysteine ​​synthase encoding gene GSH1 and the glutathione synthase encoding gene GSH2 in the glutathione synthesis pathway at the YPRCΔ15 site, and at the same time highly expresses the glutathione reductase encoding gene GLR1 and the superoxide dismutase encoding gene SOD1 at the Ubp6 site.

[0084] (1) Primer and promoter design

[0085] The PCR primer sequences and templates used in constructing the engineered strain XL01 in this embodiment are shown in Table 2 above. The endogenous promoter fragments, endogenous enzyme encoding genes, their terminator fragments, and homologous arm fragments used were all amplified from the genomic DNA of yeast CEN.PK2-1D (EUROSCARF, Germany). Furthermore, all endogenous promoter and gene sequences used in the strain construction process could be obtained from the Saccharomyces cerevisiae genome database (www.yeastgenome.org). Specifically, the TDH3 promoter sequence used is 698 bp upstream of the TDH3 gene (SEQ ID NO.1), and the TEF1 promoter sequence is 579 bp upstream of the TEF1 gene (SEQ ID NO.2).

[0086] SEQ ID NO: 1 (TDH3 promoter nucleotide sequence):

[0087] ATAAAAAACACGCTTTTTCAGTTCGAGTTTATCATTATCAATACTGCCATTTCAAAGAATACGTAAATAATTAATAGTAGTGATTTTCCTAACTTTATTTAGTCAAAAAATTAGCCTTTTAATTCTGCTGTAACCCGTACATGCCCAAAATAGGGGGCGGGTTACACAGAATATATAACATCGTAGGTGTCTGGGTGAACAGTTTATTCCTGGCATCCACTAAATATAATGGAGCCCGCTTTTTAAGCTGGCATCCAGAAAAAAAAAGAATCCCAGCACCAAAATATTGTTTTCTTCACCAACCATCAGTTCATAGGTCCATTCTCTTAGCGCAACTACAGAGAACAGGGGCACAAACAGGCAAAAAACGGGCACAACCTCAATGGAGTGATGCAACCTGCCTGGAGTAAATGATGACACAAGGCAATTGACCCACGCATGTATCTATCTCATTTTCTTACACCTTCTATTACCTTCTGCTCTCTCTGATTTGGAAAAAGCTGAAAAAAAAGGTTGAAACCAGTTCCCTGAAATTATTCCCCTACTTGACTAATAAGTATATAAAGACGGTAGGTATTGATTGTAATTCTGTAAATCTATTTCTTAAACTTCTTAAATTCTACTTTTATAGTTAGTCTTTTTTTTAGTTTTAAAACACCAAGAACTTAGTTTCGAATAAACACACATAAACAAACAAA。

[0088] SEQ ID NO: 2 (TEF1 promoter nucleotide sequence):

[0089] .

[0090] (2) Construction of p436-Cas9-gRNA-Hyg plasmid

[0091] To perform genome editing on the non-auxotrophic strain CICC 1406, the hygromycin resistance gene expression cassette was amplified from plasmid pRS41H using the primers shown in Table 2 above. This amplified cassette replaced the HIS3 expression cassette in plasmid p436-Cas9-gRNA-HIS3b (Addgene), creating a new Cas9-gRNA plasmid containing the hygromycin resistance gene expression cassette, denoted as p436-Cas9-gRNA-Hyg. Using the LiAc / SS DNA / PEG method (Gietz & Schiestl, 2007), the yeast strain was transformed with a donor DNA fragment containing approximately 50 bp homologous arms and the p436-Cas9-gRNA-Hyg plasmid containing the target gRNA sequence. Unless otherwise specified, 500 ng of the Cas9-gRNA plasmid and 1 μg of each donor DNA fragment were used for co-transformation.

[0092] (3) Construction of strain XL01

[0093] Using the Chopchop website, based on the YPRCΔ15 target sequence from the Saccharomyces Genome Database, the target sequence was designed as follows: AAGTAACTCTACTCCGCCTG. Using the constructed plasmid p436-Cas9-gRNA-Hyg as a template, PCR amplification was performed using the corresponding primers in Table 2. The primers contained a 20bp target sequence at the YPRCΔ15 site. The plasmid was then transformed into *E. coli* DH5α competent cells. Positive transformants were screened, and the obtained plasmid was designated p436-Cas9-gRNA-Hyg-YPRCΔ15.

[0094] The PCR amplification system is 50 μL: PrimeSTAR Max Premix (2×) 25 μL, upstream primer with a concentration of 10 μmol / L 1 μL, downstream primer with a concentration of 10 μmol / L 1 μL, template 1 μL, and ddH2O to make up to 50 μL.

[0095] The PCR amplification program is as follows: 98 ℃ pre-denaturation for 5 min; 98 ℃ denaturation for 30 sec, annealing at 63-58 ℃ (decreasing by 0.5 ℃ per cycle) for 10 sec, extension at 72 ℃ for 1 min, 10 cycles; 98 ℃ denaturation for 30 sec, 58 ℃ annealing for 10 sec, extension at 72 ℃ for 1 min, 25 cycles; 72 ℃ full extension for 10 min, storage at -20 ℃.

[0096] Furthermore, using the primers and templates listed in Table 3, PCR amplification was performed on the upstream homologous arm (SEQ ID NO. 3) of the integration site YPRCΔ15 according to the aforementioned PCR system and amplification procedure to obtain fragment 1; fragment 2 was obtained by amplification of the TEF1 promoter; fragment 3 was obtained by amplification of the glutamylcysteine ​​synthase gene GSH1 (SGD ID: S000003637) and its 591 bp terminator; fragment 4 was obtained by amplification of the TDH3 promoter; fragment 5 was obtained by amplification of the glutathione synthase gene GSH2 (SGD ID: S000005409) and its 402 bp terminator; and fragment 6 was obtained by amplification of the downstream homologous arm (SEQ ID NO. 4) of the integration site YPRCΔ15. Following the method described in the literature (Modular pathway engineering of diterpenoid synthases and themevalonic acid pathway for miltiradiene production, J. Am. Chem. Soc. (2012)134:3234-3241), overlap extension PCR was used to splice these DNA fragments into long fragments with overlapping regions. For example, to integrate the above six fragments into the genome, overlap extension PCR can be used to splice fragments 1, 2, and 3 into the first large fragment. Fragments 3, 4, 5, and 6 are then spliced ​​into the second large fragment. Fragments 1 and 6 are genomic homologous arms, and fragment 3 is the overlapping region.

[0097] SEQ ID NO: 3 (nucleotide sequence of upstream homologous arm of YPRCΔ15);

[0098] AAAGGAGGTGCACGCATTATGGAGACCACTACGATACGATAGCTGCGTTGTTGTTGAAGGGGTTTCTTAAGGTTGTTTTCGTTGAAGGTAAATATTGGTCGTTTTTGTGCAGCATATTGTCCTCTAGATGCAAACTCTGCAGGTCCATTTGCAGTAAAGTGAGTTGCCTCTCGAAGAATCATTAATTTCGTATAACCGTCACTATTAAAGTCAGAAAATAAATTCTGTCGTAGACAATGTTACCATAATGTTCTTGTCCATTTTGCATACACTTTAAATATTCATTTGATTTCTCAGGGTTCATGATCATAATAAATTGCGCATTCGCAAGGCGGTAGTATTATAATGGGGTCCATCATTCTGTAGCAAGAAGTTACAGTACGCTGTTCAAGCGTTAAACAAGATAAGTAATCTCGAATGAAACATTCATATTTCGCATGAGCCAACATACAGTTGCTGAGTAATCTTCATTGCGCTTATTTATCGGCATTGAGATTGTAAAGGAAGTAAAACGCATTTTTGCAGATCTGTTCTCTTATGTATTTTTAATCGTCCTTGTATGGAAGTATCAAAGGGGACGTTCTTCACCTCCTTGGAA. SEQ ID NO: 4 (

[0099] Nucleotide sequence of the downstream homologous arm of YPRCΔ15):

[0100] .

[0101] Following the DNA assembly method described in the literature (DNA assembler, an in vivo genetic method for rapid construction of biochemical pathways, Nucleic. Acid.s Res. (2009) 37 : 16), the aforementioned long DNA fragment with homologous arms and overlapping regions was transformed into yeast CICC 1406 via lithium acetate chemical transformation. The transformed fragments were then plated on YPD agar plates containing 1 mg / mL hygromycin to screen for positive transformants. Positive transformants were cultured in YPD agar at 30°C for 1-2 days. After centrifugation, 100 μL of the culture was washed with sterile water and plated on YPD agar plates. Colonies that could not grow on plates containing hygromycin were identified as strain XL01, free of hygromycin resistance selection markers.

[0102] Example 2

[0103] This embodiment describes the construction of a yeast strain XL02 that can efficiently and effectively produce glutathione.

[0104] Using the chopchop website, based on the Ubp6 target site sequence from the Saccharomyces Genome Database, the target sequence was designed as follows: CTATAAACAGCAAGACGCTG. Using the corresponding primers in Table 2, the plasmid for gRNA was constructed as described above, and the resulting plasmid was designated p436-Cas9-gRNA-Hyg-Ubp6.

[0105] Using the primers and templates listed in Table 3, PCR amplification was performed according to the PCR system and amplification procedure described in Example 1 above to obtain the following fragments: upstream homologous arm of the integration site Ubp6 (SEQ ID NO. 5, fragment 1); fragment 2 obtained by amplifying the TEF1 promoter; fragment 3 obtained by amplifying the superoxide dismutase gene SOD1 (SGD ID: S000003865) and its terminator; fragment 4 obtained by amplifying the TDH3 promoter; fragment 5 obtained by amplifying the glutathione oxidoreductase gene GLR1 (SGD ID: S000006012) and its terminator; and downstream homologous arm of the integration site Ubp6 (SEQ ID NO. 6, fragment 6). Using XL01 as the host bacterium, the DNA splicing method, transformation method, and removal of selection markers were performed as described above to obtain strain XL02.

[0106] SEQ ID NO: 5 (nucleotide sequence of the upstream homologous arm of Ubp6):

[0107] GTTTACCCAATAACACTTTCCACTGATGCTACTTCAGCAGATTTGAAAAGCAAAGCAGAGGAATTGACCCAAGTCCCAAGTGCCCGCCAAAAATACATGGTTAAAGGTGGCTTGTCTGGCGAAGAGTCCATTAAAATATATCCCTTAATCAAGCCAGGATCGACAGTAATGCTATTGGGGACTCCAGATGCTAACCTGATTTCTAAACCAGCCAAAAAGAATAATTTCATTGAAGACCTTGCGCCTGAGCAACAAGTCCAACAATTTGCTCAATTGCCTGTTGGTTTCAAGAATATGGGCAACACCTGTTATCTGAATGCTACCCTACAGGCTTTATACAGAGTGAACGATTTAAGGGATATGATTCTTAATTATAACCCTTCTCAAGGTGTGTCTAACAGTGGTGCACAAGATGAAGAGATTCACAAACAAATCGTTATTGAAATGAAGCGTTG。

[0108] SEQ ID NO: 6 (Nucleotide sequence of the homologous arm downstream of Ubp6):

[0109] .

[0110] Example 3

[0111] In this embodiment, the glutathione production of the yeast strains XL01 and XL02, which are capable of producing high-efficiency glutathione, was determined.

[0112] Take 9 mL of yeast fermentation broth from YPD medium cultured with XL01 and XL02 for 48 h, centrifuge at 4000 rpm for 5 min, discard the supernatant and collect the cells, add 3 mL of deionized water and pipette to mix evenly, freeze at -20℃ overnight, then treat with boiling water bath for 5 min, centrifuge at 6000 rpm for 10 min, and collect the supernatant for testing.

[0113] Add 3 mL of 0.25 mol / L pH 8.0 Tris-HCl buffer to the sample, pipette to mix thoroughly, then add 1 mL of 3% methanol, pipette to mix thoroughly, and let stand at room temperature for 2 min. Immediately take 1 mL of the solution and add it to 5 mL of 5,5'-dithiobis-2-nitrobenzoic acid (DTNB) analytical solution preheated to 25℃, shake well, let stand for 5 min, and immediately measure the absorbance at 412 nm. The GSH content results are attached. Figure 1 As shown.

[0114] like Figure 1 The results showed that the GSH production of strain XL01 reached 164.7 mg / L, which was 75% higher than the 41.2 mg / L of the original strain.

[0115] The present invention further highly expresses the glutathione reductase encoding gene GLR1 and the superoxide dismutase encoding gene SOD1, thereby constructing strain XL02, which has a glutathione content of 212.0 mg / L. High concentration of GSH not only directly scavenge ROS free radicals (·OH, H2O2) generated by the Fenton reaction (Free Radical Biology and Medicine 2017, 113:45-58), but also reduces the production of dihydrotestosterone (DHT) by inhibiting the NF-κB signaling pathway and downregulating the expression of 5α-reductase (Journal of Biological Chemistry 2005, 280(12):11234-11241).

[0116] Example 4

[0117] This embodiment describes the construction of engineered strains XL03 and XL04, which are enriched in iron and zinc.

[0118] (1) Construction of CRISPR-CAS9 plasmid

[0119] Using rDNA as the target site and the laboratory-existing plasmid p436-Cas9-gRNA-hyg-YPRC15 as a template, the PCR system and amplification procedure described in Example 1 above were followed, with the primers 2k-grna-F and 2k-grna-R as shown in Table 2 as the amplification site. The 20 bp bases at the gRNA position were replaced with TGTTCCAAGGAACATAGACA. The plasmid template was digested with DpnI, and the PCR product was purified and transformed into competent E. coli DH5α cells. Five single colonies were picked and cultured, and sequencing was performed to verify whether they were positive transformants. Positive transformants were then preserved and plasmids were extracted.

[0120] (2) Constructing engineered brewer's yeast strains that efficiently enrich trace metal elements

[0121] Using XL02 as the host bacterium, and following the methods described in Examples 1-2, the metallothionein gene CUP1 (SGD ID: S000001095), sulfate protein gene SUL2 (SGD ID: S000004082), upstream and downstream fragments of the rDNA multicopy site, and the promoter TDH3 fragment, all derived from *Saccharomyces cerevisiae*, were cloned using the corresponding primers in Table 3. Through overlap extension PCR, the fragments were spliced ​​into rDNA-TDH3-CUP1-rDNA and rDNA-TDH3-SUL2-rDNA, and the fragments were integrated into the rDNA multicopy site. The transformed culture medium was plated onto plates containing 5‰ hygromycin resistance to obtain strain XL03. The upstream homologous arm nucleotide sequence of the rDNA is shown in SEQ ID NO: 7, and the downstream homologous arm nucleotide sequence is shown in SEQ ID NO: 8.

[0122] SEQ ID NO: 7 (nucleotide sequence of upstream homologous arm of rDNA):

[0123] ACCTCTAATCATTCGCTTTACCTCATAAAACTGATACGAGCTTCTGCTATCCTGAGGGAAACTTCGGCAGGAACCAGCTACTAGATGGTTCGATTAGTCTTTCGCCCCTATACCCAAATTCGACGATCGATTTGCACGTCAGAACCGCTACGAGCCTCCACCAGAGTTTCCTCTGGCTTCACCCTATTCAGGCATAGTTCACCATCTTTCGGGTCCCAACAGCTATGCTCTTACTCAAATCCATCCGAAGACATCAGGATCGGTCGATTGTGCACCTCTTGCGAGGCCCCAACCTACGTTCACTTTCATTACGCGTATGGGTTTTACACCCAAACACTCGCATAGACGTTAGACTCCTTGGTCCGTGTTTCAAGACGGGCGGCATATAACCATTATGCCAGCATCCTTGACTTACGTCGCAGTCCTCAGTCCCAGCTGGCAGTATTCCCACAGGCTATAATACTTACCGAGGCAAGCTACATTCCTATGGATTTATCCTGCCACCAAAACTGATGCTGGCCCAGTGAAATGCGAGATTCCCCTACCCACAAGGAGCAGAGGGCACAAAACACCATGTCTGATCAAATGCCCTTCCCTTTCAACAATTTCACGTACTTTTTCACTCTCTTTTCAAAGTTCTTTTCATCTTTCCATCACTGTACTTGTTCGCTATCGGTCTCTCGCCAATATTTAGCTTTAGATGGAATTTACCACCCACTTAGAGCTGCATTCCCAAACAACTCGACTCTTCGAAGGCACTTTACAAAGAACCGCACTCCT。

[0124] SEQ ID NO: 8 (Nucleotide sequence of the downstream homologous arm of rDNA):

[0125] .

[0126] Following the method described in Example 1, and using the corresponding primers in Table 4, the vacuolar serine vacuolar carboxypeptidase gene CPY (SGD ID: S000004912), vacuolar metal transporter genes CCC1 (SGD ID: S000004210) and COT1 (SGD ID: S000005843), upstream and downstream fragments of the rDNA multicopy site, and the promoter TDH3 fragment of Saccharomyces cerevisiae were cloned. The fragments were then spliced ​​by overlap extension PCR in the order of upstream rDNA fragment, promoter, target gene fragment, and downstream rDNA fragment to integrate the fragments into the multicopy site, thus obtaining strain XL04.

[0127] In addition, as a control strain, this embodiment used the same method, directly using Saccharomyces cerevisiae CICC 1406 as the starting strain, and adopted the construction methods of XL03 and XL04 described above to construct a metal transport network at the high copy site of rDNA. The strain XL05, which can chelate metal ions, was constructed as a control strain by overexpressing endogenous metallothionein (CUP1), vacuolar transporter (CCC1 / COT1), sulfate transporter (SUL2), and vacuolar serine carboxypeptidase CPY gene.

[0128] Example 5

[0129] In this embodiment, the enrichment rates of iron and zinc by the engineered strains XL03 and XL04, which are capable of enriching iron and zinc, were determined. Iron and zinc were enriched by shake-flask fermentation, and the enrichment rates of iron and zinc were also determined.

[0130] Transfer the seed culture at 10% to 50 mL of YPD liquid medium, add sterile ferrous sulfate or zinc sulfate solution until the final concentration of iron or zinc ions in the medium is 0.12 g / L, shake and incubate, take samples every 12-20 h, centrifuge the final fermentation broth and collect the supernatant to determine the amount of substrate consumed.

[0131] The methods for determining the enrichment rates of iron and zinc are as follows.

[0132] Ferrous sulfate substrate solution: Weigh 2.71 g of ferrous sulfate solid using an analytical balance, dissolve it in approximately 50 mL of ddH2O, and bring the volume to 100 mL. Sterilize in an autoclave at 121 °C for 30 min and store for later use.

[0133] Zinc sulfate substrate solution: Weigh 2.48 g of ferrous sulfate solid using an analytical balance, dissolve it in approximately 50 mL of ddH2O, and bring the volume to 100 mL. Sterilize in an autoclave at 121 °C for 30 min and store for later use.

[0134] Acetic acid solution: Measure 16 mL of glacial acetic acid using a graduated cylinder and dilute to 500 mL with ddH2O.

[0135] Sodium acetate solution: Weigh 8.2 g of sodium acetate solid using an analytical balance, dissolve it in approximately 100 mL of ddH2O, transfer the solution to a 500 mL volumetric flask, and dilute to 500 mL with ddH2O. Sodium acetate was purchased from Hangzhou Jigong Biotechnology Co., Ltd.

[0136] Acetic acid-sodium acetate buffer solution: Mix 49 mL of acetic acid solution with 51 mL of sodium acetate, and use immediately after preparation.

[0137] Ferrous standard solution: Weigh 0.027 g of ferrous sulfate solid, dissolve it in a small amount of ddH2O, transfer it to a 100 mL volumetric flask, and dilute to 100 mL. The concentration of ferrous ions is 0.1 g / L.

[0138] Phenyrolidine colorimetric solution: Weigh 0.1 g of phenyrolidine solid and 2.5 g of ascorbic acid using an analytical balance, dissolve in acetate-sodium acetate buffer, and bring the volume to 100 mL. Phenyrolidine was purchased from Sinopharm Chemical Reagent Co., Ltd.

[0139] Zinc standard solution: Weigh 0.025 g of zinc sulfate solid using an analytical balance, dissolve it in a small amount of ddH2O, transfer the solution to a 100 mL volumetric flask, and dilute to 100 mL. The zinc ion concentration is 0.1 g / L.

[0140] Borate buffer: Weigh 18.9 g potassium chloride solid, 15.5 g boric acid solid and 4.17 g sodium hydroxide solid using an analytical balance, dissolve in water, cool and bring to a final volume of 500 mL.

[0141] Zinc reagent colorimetric solution: Weigh 0.1 g of zinc reagent powder using an analytical balance, dissolve in 250 mL of ethanol, and store protected from light. Zinc reagent was purchased from Shanghai Aladdin Biochemical Technology Co., Ltd.

[0142] Take 1 mL of iron standard solution and dilute to 100 mL with ddH2O to obtain the working solution of iron standard solution. Add the colorimetric system according to Table 5 below, mix well for 3 min, and then measure its absorbance at a wavelength of 560 nm. Take the supernatant of fermentation broth, dilute it to the range of the standard curve measurement, take 1 mL, add 0.2 mL of phenanthroline colorimetric solution, add water to 5 mL, mix well, let stand for 3 min, and then measure its absorbance at a wavelength of 560 nm.

[0143] Table 5 Colorimetric Reaction System of Iron Element

[0144] Take 5 mL of zinc standard solution and dilute to 100 mL with ddH2O to prepare a 5 mg / L zinc standard solution. Add the colorimetric system according to Table 6 below, mix well, let stand for 10 min, and then measure the absorbance at 620 nm. Take the supernatant of the fermentation broth, dilute it to the standard curve measurement range, take 1 mL, add 3 mL of ddH2O, 3 mL of borate buffer and 3 mL of zinc reagent colorimetric solution, mix well, let stand for 10 min, and then measure the absorbance at 620 nm.

[0145] Table 6 Zinc Element Colorimetric Reaction System

[0146] Using ferrous sulfate as a substrate, strains XL02, XL03, XL04, and XL05 were fermented to enrich iron. The iron enrichment rates of the three strains were compared, and the results are as follows: Figure 2 As shown.

[0147] It is evident that the iron enrichment rate of XL03 was slightly increased compared to XL02, but the difference was not statistically significant. This indicates that the high expression of metallothioneins CUP1 and SUL2 has a certain but limited effect on increasing iron enrichment in Saccharomyces cerevisiae. This may be because iron differs from trivalent chromium; trivalent chromium enters yeast cells via diffusion, while ferrous ions need to enter yeast cells via transport proteins. When iron is sufficient within yeast cells, the low-affinity transport system is activated, reducing the binding of membrane transport proteins to iron and thus reducing iron transport. Therefore, the iron enrichment rate of XL03 did not increase significantly. The iron enrichment rate of XL04 was 66.10%, an increase of 51.02% compared to XL02. This indicates that the high expression of CCC1, COT1, and CPY increased the iron enrichment effect of Saccharomyces cerevisiae. However, when the expression of metal ion chelation-related genes was directly enhanced using the starting strain CICC 1406 without enhancing the expression of GSH, the iron ion chelation efficiency of the constructed XL05 strain was only 32.98%.

[0148] In this embodiment, XL04 is further used as an example to test its iron enrichment rate change curve and growth curve during the fermentation process. The results are shown in the attached figure. Figure 3 As shown. By Figure 3 The results show that XL04's OD 600 The value remained essentially unchanged after 48 hours, but the iron enrichment rate reached its maximum at 60 hours of fermentation, after which the iron enrichment rate decreased, at which point the OD value... 600 The value also decreased, possibly due to the release of iron back into the culture medium caused by the death of Saccharomyces cerevisiae cells.

[0149] In this embodiment, zinc sulfate was used as a substrate to ferment XL02, XL03, XL04, and XL05 strains for zinc enrichment, and the zinc enrichment rates of the three strains were compared. The results are as follows: Figure 4 As shown.

[0150] As can be seen, there was a slight improvement compared to XL02 and XL03, but no significant difference was obtained. This may be because Saccharomyces cerevisiae itself possesses the metallothionein Crs5p, which can be induced to be expressed by zinc ions.

[112] When *Saccharomyces cerevisiae* is induced by high concentrations of zinc ions, its expression is greatly activated and it binds to zinc ions, thus meeting the detoxification needs of *Saccharomyces cerevisiae* in high-zinc environments. The zinc enrichment rate of XL04 is 33.65%. However, when the expression of metal ion chelation-related genes is directly enhanced using the starting strain CICC 1406 without enhancing the expression of GSH, the zinc ion chelation efficiency of the constructed XL05 strain is only 15.58%.

[0151] In this embodiment, XL04 is further used as an example to test its iron enrichment rate change curve and growth curve during the fermentation process. The results are shown in the attached figure. Figure 5 As shown, similar to the enrichment of iron, the growth of XL04 was inhibited to some extent, with the maximum OD... 600 The value decreased by 11.76%. The zinc enrichment rate reached its maximum at 48 h and remained almost constant thereafter. The zinc enrichment rate of XL04 increased rapidly in the first 24 h. The likely reason is that the vacuolar metallotransfer proteins CCC1 and COT1 have a high affinity for zinc, causing zinc to be transported into the vacuoles. After the zinc concentration in the cytoplasm decreased, the zinc transport proteins on the cell membrane continued to transport zinc, leading to a rapid increase in zinc enrichment. However, after 24 h, once the zinc transport in the cytoplasm and vacuoles reached equilibrium, the low-affinity zinc transport system was activated, and the affinity of *Saccharomyces cerevisiae* for zinc decreased, thus the increase in zinc enrichment rate slowed down.

[0152] In addition, by appendix Figure 2-5 It is known that the control strain XL05, which can chelate metal ions, was constructed by directly using Saccharomyces cerevisiae CICC 1406 as the starting strain in this invention. Its enrichment efficiency for iron and zinc reached 30.31% and 16.32%, respectively.

[0153] Example 6

[0154] In this embodiment, pomegranate peel was selected as the substrate for preparing the fermentation broth.

[0155] First, fresh pomegranate peel was selected for extraction to obtain the active ingredients. Dried pomegranate peel was pulverized to 80 mesh and added to YPD medium at a ratio of 1:30 (g / mL). After sterilization at 121℃ for 20 minutes, ultrasonic extraction was performed (40kHz, 300W, 30min). The extract was then fermented using the engineered strain XL04.

[0156] First stage enrichment culture (0-18h): The fermenter was filled with 70% liquid and inoculated with 5% bacterial suspension. Control parameters: temperature 30℃, dissolved oxygen 40%, pH 7.2±0.1; feeding strategy: when the glucose concentration is <5g / L, add 400g / L glucose solution (flow rate 0.8mL / min).

[0157] Second stage of product synthesis (19-48h): Switch to induction mode: temperature 28℃, dissolved oxygen ≤15%, pH 6.8±0.2; terminate fermentation when cell OD no longer increases.

[0158] After fermentation, the fermentation broth was treated using ethanol cell disruption technology. 40% ethanol (v / v) was added to the fermentation broth, and the mixture was shaken at 45℃ for 60 min. The supernatant was obtained by centrifugation (8000×g, 15 min). The supernatant was pre-frozen at -40℃ for 6 h and then dried under vacuum of 10 Pa for 22 h to obtain a dry powder form of the pomegranate peel fermentation broth.

[0159] Example 7

[0160] In this embodiment, referring to existing literature reports, chelated zinc ions activate the Wnt / β-catenin pathway to promote the proliferation of dermal papilla cells (Developmental Cell 2019, 48(2):185-199), while iron ions enhance angiogenesis by upregulating HIF-1α (Nature Cell Biology 2017, 19(3):257-270), to verify the synergistic effect of GSH-metal chelation-pomegranate peel fermentation.

[0161] (1) Experimental materials

[0162] Cell model: Human dermal papilla cells (DPCs, Lonza, CC-2505) were cultured in high-glucose DMEM medium (HyClone) containing 10% FBS (Gibco) and 1% penicillin antibiotics.

[0163] Interventions include:

[0164] XL04 fermentation product: fermented pomegranate peel powder (GSH 212±8.3 mg / g, Fe²⁺ 0.12±0.01%, total polyphenols 6.65±0.23%).

[0165] Control group: minoxidil (5 μg / mL, Sigma), pure GSH (Sigma, purity ≥98%), Fe²⁺-gallic acid chelate.

[0166] Key reagents include:

[0167] DCFH-DA ROS Detection Kit (Beyotime, S0033S);

[0168] 5α-Reductase Activity Assay Kit (Cloud-Clone, CEA905Ge);

[0169] VEGF ELISA kit (R&D Systems, DY293B).

[0170] (2) Experimental group design

[0171] In this embodiment, the grouping design elements for each group are shown in Table 7 below.

[0172] Table 7 Experimental Group Design

[0173] (3) Experimental procedure and analysis method

[0174] Cell processing and synchronization: After passage to the 3rd generation, DPCs were seeded at 5×10³ cells / well in 96-well plates and cultured at 37°C and 5% CO2 until 70% confluence.

[0175] Synchronization treatment: Replace with serum-free culture medium 24 hours later to eliminate cell cycle heterogeneity.

[0176] Key testing indicators and procedures:

[0177] (a) ROS removal rate detection

[0178] Remove the culture medium, add 10 μM DCFH-DA (diluted with PBS), and incubate at 37°C in the dark for 30 minutes.

[0179] Quantitative fluorescence analysis: Wash three times with PBS and detect fluorescence intensity using an ELISA reader (Ex / Em=488 / 525 nm).

[0180] The calculation formula is as follows:

[0181] .

[0182] (b) 5α-Reductase Activity Detection

[0183] Cell lysis: DPCs were lysed with RIPA buffer, and protein concentration was determined by BCA method.

[0184] Reaction system: 50 μg protein + 100 μM testosterone substrate (37℃, 1 hour), ELISA to quantify DHT production.

[0185] (c) Cell proliferation (MTT assay)

[0186] Staining: Add 20 μL MTT (5 mg / mL) to each well and incubate at 37°C for 4 hours.

[0187] Dissolve: Discard the culture medium and add 150 μL of DMSO, then shake to dissolve and crystallize.

[0188] Detection: OD570nm was measured using an ELISA reader, and the proliferation rate was calculated as follows:

[0189] .

[0190] In this embodiment, the experiment used GraphPad Prism to analyze the data, and statistical differences were determined by t-test.

[0191] In this embodiment, the quantitative analysis results of the synergistic effect of each experimental group are shown in Table 8 below.

[0192] Table 8. Quantitative Analysis Results of Synergistic Effect

[0193] In addition, the VEGF secretion levels detected by ELISA were as follows: XL04 group 286.4±22.7 pg / mL, XL02 group 135.7±19.1 pg / mL, while the blank control group 98.3±11.5 pg / mL and XL05 control group 95±9.5 pg / mL, with no significant difference from the blank control group.

[0194] The experimental results above show that the XL04 whole fermentation broth is superior to the single components GSH and Fe²⁺-gallic acid, as well as the XL02 and XL05 fermentation groups in terms of ROS scavenging rate, DHT inhibition rate, and cell proliferation rate. Furthermore, treatment with the XL04 whole fermentation broth significantly increased VEGF secretion and improved hair follicle microcirculation.

[0195] Example 8

[0196] This embodiment tests the functional verification of scalp cells by fermentation broth of XL04 strain at different concentrations, that is, it measures the proliferative effect of XL04 strain fermentation broth on human dermal papilla cells.

[0197] In this embodiment, the MTT assay was used to evaluate the proliferative effect of KGF-2 on human dermal dermal papilla cells to verify its anti-hair loss efficacy. The samples were divided into a blank control group (BC), a positive control group (PC, minoxidil), and a fermentation broth sample group. OD values ​​were measured after 72 hours of culture. Results are shown in the appendix. Figure 6 As shown.

[0198] The results showed that 1 mg / ml of fermentation broth powder significantly increased cell proliferation rate by 13.5% (P<0.05), which was close to the effect of the PC group (15.1%), indicating that this concentration has the potential to prevent hair loss. Furthermore, 10 mg / ml of fermentation broth powder had a significantly better effect on the proliferation of hair papilla cells than minoxidil.

[0199] Example 9

[0200] This embodiment further tests the clinical evaluation of the hair care efficacy of the XL04 strain fermentation broth.

[0201] Subjects: 30 patients with androgenetic alopecia (22 males / 8 females, Norwood III-V grade) were randomly and double-blindly assigned to either the treatment group (hair growth cream containing 1 mg / mL XL04 fermented dry powder (base: Carbopol 940 / propylene glycol) or the placebo group (empty cream with the same base).

[0202] Apply to the affected area twice daily for 28 days, followed by a 4-week follow-up after discontinuation of the medication.

[0203] In this embodiment, the specific evaluation methods and standards are shown in Table 9 below, and the experimental results are shown in Table 10 below.

[0204] Table 9 Evaluation Methods

[0205]

[0206] Table 10 Experimental Results

[0207]

[0208] As can be seen from the data in the table above, blood flow velocity is significantly positively correlated with VEGF concentration (r=0.89, p<0.001), confirming the hypothesis that iron ions upregulate VEGF through HIF-1α. After 56 days of drug withdrawal, the hair follicle density retention rate was 89.2% (compared to only 42.7% in historical data for minoxidil), breaking through the bottleneck of drug dependence.

[0209] In summary, the engineered Saccharomyces cerevisiae strain described in this invention utilizes CRISPR / Cas9 technology to perform three-point synergistic editing (YPRCΔ15 / Ubp6 / rDNA) on Saccharomyces cerevisiae, achieving for the first time a 75% increase in glutathione (GSH) synthesis capacity to 212.7 mg / L, while simultaneously achieving highly efficient enrichment of iron (66.10%) and zinc (33.65%), blocking ROS generation at its source. Furthermore, by utilizing pomegranate peel waste for fermentation, the high-molecular-weight ellagic acid ester is converted into the low-molecular-weight gallic acid, increasing the transdermal penetration rate of the active ingredients to over 60%, and forming bioactive chelates with metal ions. This complex promotes dermal papilla cell proliferation by activating the Wnt / β-catenin pathway, inhibits the downregulation of 5α-reductase expression in the NF-κB pathway, and simultaneously enhances hair follicle angiogenesis by upregulating HIF-1α with iron ions, ultimately forming a synergistic solution across the entire pathway of "antioxidant-metal homeostasis-regeneration and repair".

[0210] The embodiments of the present invention have been described in detail above. Specific examples have been used to illustrate the principles and implementation methods of the present invention. The description of the above embodiments is only for the purpose of helping to understand the method and core ideas of the present invention. At the same time, for those skilled in the art, there will be changes in the specific implementation methods and application scope based on the ideas of the present invention. Therefore, the content of this specification should not be construed as a limitation of the present invention.

Claims

1. A recombinant brewer's yeast engineered strain, characterized in that, The recombinant Saccharomyces cerevisiae engineered strain uses Saccharomyces cerevisiae as the host strain, highly expresses GSH1, GSH2, GLR1, and SOD1 genes at YPRCΔ15 and Ubp6 sites, and inserts CUP1, SUL2, CCC1, COT1, and CPY genes at rDNA sites.

2. The recombinant brewer's yeast engineered strain according to claim 1, characterized in that: The nucleotide sequence of the GSH1 gene has the SGD database number: S000003637; The nucleotide sequence of the GSH2 gene has an SGD database number of S000005409. The nucleotide sequence of the GLR1 gene has the SGD database number: S000006012; The nucleotide sequence of the SOD1 gene has the SGD database number: S000003865; The nucleotide sequence of the CUP1 gene has the SGD database number: S000001095; The nucleotide sequence of the SUL2 gene has an SGD database number of S000004082. The nucleotide sequence of the CCC1 gene has an SGD database number of S000004210. The nucleotide sequence of the COT1 gene has an SGD database number of S000005843. The nucleotide sequence of the CPY gene is SGD database numbered as SGD ID: S000004912.

3. The recombinant brewer's yeast engineered strain according to claim 1 or 2, characterized in that, The recombinant Saccharomyces cerevisiae engineered strain uses the TEF1 and TDH3 strong promoters to drive the expression of target genes.

4. The recombinant brewer's yeast engineered strain according to claim 1 or 2, characterized in that, The host bacteria is CICC 1406 yeast.

5. A method for constructing a recombinant Saccharomyces cerevisiae engineered strain as described in any one of claims 1-4, characterized in that, Includes the following steps: (1) Using a selected Saccharomyces cerevisiae starting strain, a co-expression module of endogenous γ-glutamylcysteine ​​synthase (GSH1) and glutathione synthase (GSH2) was integrated at the YPRCΔ15 genomic locus, while endogenous glutathione reductase (GLR1) and superoxide dismutase (SOD1) driven by the TEF1 / TDH3 strong promoter were overexpressed at the Ubp6 locus. (2) Continue to construct a metal transport network at its high copy site, overexpress endogenous metallothionein (CUP1), vacuole transporter (CCC1 / COT1), sulfate transporter (SUL2), and vacuole serine carboxypeptidase CPY gene to form a three-module synergistic expression system of metabolic synthesis-oxidative balance-metal transport.

6. A method for preparing an active composition that can promote hair follicle regeneration, characterized in that, The method includes the steps of inoculating the recombinant Saccharomyces cerevisiae engineered strain according to any one of claims 1-4 into a fermentation medium for fermentation culture, and collecting the fermentation products for extraction of active ingredients. Preferably, the fermentation medium contains 30-35 g / L of pomegranate peel and / or ferrous sulfate and zinc sulfate at a final concentration of 0.1-0.15 g / L. Preferably, the active ingredient extraction step includes mixing with 30-50% v / v ethanol, and collecting the supernatant through solid-liquid separation and then drying and freezing it.

7. The method for preparing the active composition for promoting hair follicle regeneration according to claim 6, characterized in that, The fermentation culture step includes an enrichment culture step and a product synthesis culture step; wherein... The enrichment culture step is carried out at a temperature of 28-32℃, dissolved oxygen of 35-45%, pH of 7.2±0.1, and a culture time of 15-18h; when the glucose concentration is <5g / L, a glucose solution of 350-450g / L is added. The product synthesis culture step is carried out at a temperature of 25-30℃, dissolved oxygen ≤15%, pH 6.8±0.2, and culture time of 28-32h.

8. An active composition that promotes hair follicle regeneration, characterized in that, Prepared by the method described in claim 8 or 9.

9. Use of the recombinant Saccharomyces cerevisiae engineered strain according to any one of claims 1-4 and its fermentation products, or the hair growth-promoting active composition according to claim 8, for the preparation of a pharmaceutical preparation that promotes hair follicle regeneration.

10. A pharmaceutical composition that promotes hair follicle regeneration or hair growth, characterized in that, The fermentation product of the recombinant Saccharomyces cerevisiae engineered strain according to any one of claims 1-4 or the active composition with hair growth promotion according to claim 8.

Images