Composite microbial agent capable of efficiently degrading benzene and catechol and application of composite microbial agent

Abstract

The invention provides a compound microbial agent capable of efficiently degrading benzene and catechol and application of the compound microbial agent, and belongs to the technical field of environmental restoration. The compound microbial agent disclosed by the invention is prepared from an engineering strain B-tou and Klebsiella sp. LBTRJ-2BN. The engineering strain B-tou in the compound microbial agent disclosed by the invention can be used for completely degrading benzene, and meanwhile, the degradation capability of Klebsiella on catechol is not influenced. The combination of the two strains finds that the combination can completely degrade benzene and catechol within 24 hours, and the strain combination can greatly reduce the application cost and simplify the operation procedure, and has application potential in the fields of waste liquid treatment, environmental restoration and the like.

Description

Technical Field

[0001] This invention belongs to the field of environmental remediation technology, and in particular relates to a composite microbial agent capable of efficiently degrading benzene and catechol and its application. Background Technology

[0002] Benzene, a typical monocyclic aromatic hydrocarbon, is one of the most basic structural units and raw materials in the petrochemical industry, widely used in the production of numerous chemical products such as plastics, rubber, fibers, dyes, pesticides, and pharmaceuticals. However, benzene is also a recognized highly toxic substance with high volatility, capable of entering the environment through various pathways including industrial waste gas, wastewater, and soil seepage. Compared to substituted aromatic hydrocarbons (such as toluene), benzene has a more stable chemical structure, is less prone to oxidative degradation, and exhibits strong migration within the environment. The International Agency for Research on Cancer (IARC) classifies benzene as a Group 1 carcinogen, as it has a severe damaging effect on the human hematopoietic system, potentially causing aplastic anemia and even leukemia. Therefore, countries worldwide impose strict limits on the concentration of benzene in the environment. For example, my country's "Groundwater Quality Standard" (GB / T 14848-2017) stipulates a benzene limit of ≤0.5 μg / L for Class I water. During the microbial degradation of benzene, its key intermediate metabolite—catechol—also exhibits significant toxicity and environmental persistence. Therefore, it is crucial to develop technologies that can simultaneously and efficiently remove benzene and its toxic intermediates.

[0003] Among existing benzene pollution remediation technologies, bioremediation is considered an environmentally friendly and sustainable solution due to its advantages such as high cost-effectiveness, low risk of secondary pollution, and on-site implementation. Benzene-degrading microorganisms in nature, such as certain Pseudomonas and Rhodococcus bacteria, primarily initiate degradation through key enzyme systems such as benzene dioxygenase, converting benzene into intermediates such as cis-hydroquinone, which ultimately enters the catechol pathway for ring-opening cleavage. However, directly applying these Klebsiella strains faces several challenges: their tolerance to high concentrations of benzene is limited, and their degradation efficiency is significantly affected by fluctuations in environmental factors (such as oxygen, nutrients, and pH), making their effectiveness unstable in practical engineering applications.

[0004] Synthetic biology offers new insights into overcoming the limitations of Klebsiella pneumoniae strains. Compared to traditional genetic engineering methods that introduce complex entire degradation pathways into a single strain, rationally designed artificial microbial assemblages (or synthetic microbial communities) show greater potential advantages: Enhancing system robustness: Modularizing benzene degradation pathways (e.g., from benzene to catechol, and then to ring-opening cleavage) and assigning them to different strains for execution. This division of labor strategy makes the microbial community more adaptable to external environmental stresses (such as toxic shocks and nutrient competition), and the degradation function of the entire system can still be maintained even if the activity of some strains is affected.

[0005] Optimize metabolic flux and efficiency: By dividing labor among bacteria, metabolic congestion caused by resource competition and intermediate product accumulation in a single bacterial cell can be avoided, thereby improving the overall conversion rate from benzene to the final product and achieving higher degradation efficiency.

[0006] Reducing the metabolic burden on single bacteria: The complete degradation pathway of benzene involves multiple enzymatic steps, especially the benzene dioxygenase required for the initial step, which is usually a multi-subunit complex, making efficient expression in a single host extremely challenging. Distributing this process among different strains can significantly reduce the metabolic load on each strain, promoting stable coexistence and functional durability of the bacterial community.

[0007] Ensuring application safety and compliance: Selecting safe host strains that have undergone thorough genetic characterization and long-term laboratory use. These strains are typically auxotrophic or have introduced biocontrol mechanisms, are environmentally harmless and pose extremely low ecological risks, comply with biosafety regulations, and are conducive to future evaluation and promotion in real-world environments.

[0008] In summary, constructing a microbial ensemble specifically for the efficient and simultaneous degradation of benzene and catechol can not only effectively address the current severe problem of benzene pollution, but also provide an innovative technical solution for developing next-generation high-performance bioremediation agents by leveraging the comprehensive advantages of synthetic microbial communities in terms of stability, efficiency, and safety. Summary of the Invention

[0009] In view of this, the purpose of this invention is to provide a composite microbial agent capable of efficiently degrading benzene and catechol, and its application. This invention uses an artificially modified *Escherichia coli* B- tou When combined with Klebsiella pneumoniae LBTRJ-2BN isolated from polluted environments, it significantly reduces application costs and simplifies operating procedures, showing potential applications in wastewater treatment and environmental remediation.

[0010] To achieve the above-mentioned objectives, the present invention provides the following technical solution: This invention provides a composite microbial agent capable of efficiently degrading benzene and catechol, wherein the composite microbial agent is derived from engineered strain B- tou Composed of Klebsiella pneumoniae LBTRJ-2BN; among which the engineered strain B- tou OD 600 The OD of Klebsiella pneumoniae LBTRJ-2BN ranged from 0.1 to 4. 600 It is 0.5~4; The engineered bacteria B- tou Obtained by transfection of Escherichia coli BL21 with a recombinant vector; The recombinant vector contains an artificial sequence encoding toluene monooxygenase and the pET-28a vector; The artificial sequence encoding toluene monooxygenase contains subunits as shown in SEQ ID NO.1. touA The sequence, such as the subunit shown in SEQ ID NO.2 touB The sequence, such as the subunit shown in SEQ ID NO.3 touC The sequence, such as the subunit shown in SEQ ID NO.4 touD The sequence, such as the subunit shown in SEQ ID NO.5 touE The sequence, such as the subunit shown in SEQ ID NO.6 touF sequence.

[0011] Preferably, each subunit is connected to the T7 promoter and terminator at both ends of its sequence to form an expression unit.

[0012] Preferably, the recombinant vector is constructed by tandemly connecting the expression units of the six subunits and inserting them into the pET-28a vector to obtain the recombinant vector.

[0013] Preferably, the Klebsiella pneumoniae LBTRJ-2BN has the accession number GDMCC No: 65677.

[0014] The present invention also provides the application of the aforementioned composite microbial agent in wastewater treatment, wherein the wastewater is contaminated with benzene compounds.

[0015] The present invention also provides the application of the aforementioned composite microbial agent in environmental remediation, wherein the environment is an environment contaminated by benzene compounds.

[0016] Compared with existing technologies, the present invention has the following beneficial effects: The present invention utilizes genetic engineering technology to express the gene of six subunits of toluene monooxygenase, which can convert benzene into catechol, in Escherichia coli. Verification has shown that the engineered bacterium B- tou The expression of exogenous genes can function without the theoretically required inducers. Engineered bacteria B- tou Combining the bacteria with Klebsiella pneumoniae LBTRJ-2BN, which is capable of degrading catechol, allows for the complete degradation of benzene without affecting Klebsiella pneumoniae's ability to degrade catechol. The ratio of the two strains was optimized, and the resulting strain combination can completely degrade both benzene and catechol within 24 hours. This combination significantly reduces application costs and simplifies operating procedures, demonstrating potential applications in wastewater treatment and environmental remediation. Attached Figure Description

[0017] Figure 1 This describes the metabolic pathway for the microbial degradation of benzene and catechol in this invention. Figure 2A schematic diagram of a vector used to express six genes related to benzene degradation in Escherichia coli; Figure 3 For different bacterial counts B- tou Degradation effect on 1mM benzene; Figure 4 For OD 600 =0.5 and B- tou The amount of catechol produced when 1 mM benzene is degraded; Figure 5 The degradation effect of LBTRJ-2BN with different bacterial counts on 1mM catechol was investigated. Figure 6 For different bacterial counts B- tou With LBTRJ-2BN (OD 600 =2) The degradation effect of each bacterial strain combination on 1mM phenol after combination; Figure 7 The optimized bacterial strain combination was used to assess its degradation effect on 1mM benzene or catechol.

[0018] Biological Preservation Instructions

[0019] Klebsiella pneumoniae LBTRJ-2BN, Latin name Klebsiella sp. The strain is deposited at the Guangdong Provincial Center for Microbial Culture Collection, located at 5th Floor, Building 59, No. 100 Xianlie Middle Road, Guangzhou, on December 25, 2024, with accession number GDMCC No: 65677. Detailed Implementation

[0020] This invention provides a composite microbial agent capable of efficiently degrading benzene and catechol, wherein the composite microbial agent is derived from engineered strain B- tou Composed of Klebsiella pneumoniae LBTRJ-2BN; among which the engineered strain B- tou OD 600 The OD value is 0.1~4, preferably 0.3~2, and more preferably 0.5; OD value of Klebsiella pneumoniae LBTRJ-2BN 600 The concentration is 0.5~4, preferably 1~3, and more preferably 2; the engineered bacteria B- tou Obtained by transfection of *Escherichia coli* BL21 with a recombinant vector; the recombinant vector contains an artificial sequence encoding toluene monooxygenase and a pET-28a vector; the artificial sequence encoding toluene monooxygenase contains subunits as shown in SEQ ID NO. 1. touA The sequence, such as the subunit shown in SEQ ID NO.2 touB The sequence, such as the subunit shown in SEQ ID NO.3 touC The sequence, such as the subunit shown in SEQ ID NO.4 touDThe sequence, such as the subunit shown in SEQ ID NO.5 touE The sequence, such as the subunit shown in SEQ ID NO.6 touF The sequence is as follows: touA (SEQ ID NO.1): touB (SEQ ID NO.2): ggatccatggcaacctttccaatcatgtccaactttgagcgtgactttgtcatccagctggttcctgttgacactgaggatactatggatcaggttgcagagaagtgtgcctaccactccatcaaccgtcgtgttcatccacaacctgagaagatcctgcgtgttcgtcgtcacgaagatggcaccctgttccctagaggcatgatcgtctctgatgctggcctgagacctaccgagactctggacatcatcttcatggacaactaagagctc; touC (SEQ ID NO.3): ggatccatggcattcgagaaaatctgcaccttggatgatgtctgggaatgtgagatggaaaccttcactacctccactggtgttgacatcctgcttgttggtgttgaaggtggtgacatgaaggctttccaggctatgtgtccacatcaggagatcgagctggttgaaggtgagttcgatggcaaggtcctgacctgcaaggcacacctctggcagttcgattgccacaatggtgaaggcatcaacccatctgactgtagaatcgctgagtatcctgtcaagatcgaaggtgaagacgtcttcgtcgatgttgaaggtgtcgagccattcaagtctcactcctaagagctc; touD (SEQ ID NO.4): ggatccatgaccaccaacactgttcagaccttgtctgcatctgacaacgcactcaacaacaacatggttggaccagtcctcagagctggtgatgttgccattgctgttggtgaagccgcagagatcgacaatcctggcaaagagatcaaggttgacgacaaacttgcctatgtcagaatcggtgctgaagatgagctgattctccgtaaggagaccatcgaggaatgccttggcagaccattccgtatgcaggagttggagatcaacctgtcttccttcgctggcatcatcgacatggacttcgatcgtgttcgtttctacttcaacaagcacctgtaagagctc; touE (SEQ ID NO.5): touF (SEQ ID NO.6):

[0021] In this invention, each subunit's sequence is connected to the T7 promoter and terminator at both ends to form an expression unit.

[0022] In this invention, the recombinant vector is constructed by tandemly connecting the expression units of the six subunits to form a complete sequence, and connecting EcoRI and HindIII restriction sites at both ends of the complete sequence to obtain a gene fragment. The gene fragment is then digested with EcoRI and HindIII and ligated into the vector pET-28a, which is digested with the same restriction enzymes, to obtain the recombinant vector (recombinant plasmid pET-tou).

[0023] In this invention, the Klebsiella pneumoniae LBTRJ-2BN has the accession number: GDMCC No: 65677.

[0024] The present invention also provides the application of the aforementioned composite microbial agent in wastewater treatment, wherein the wastewater is contaminated with benzene compounds.

[0025] The present invention also provides the application of the aforementioned composite microbial agent in environmental remediation, wherein the environment is an environment contaminated by benzene compounds.

[0026] The technical solutions provided by the present invention will be described in detail below with reference to the embodiments, but they should not be construed as limiting the scope of protection of the present invention.

[0027] Experimental methods not specified in this invention, such as ligation, transformation, and preparation of relevant culture media, were performed in accordance with the methods in Molecular Cloning: A Laboratory Manual, 3rd Edition (translated by Huang Peitang et al., Science Press, China, 2002). The *Escherichia coli* used was preserved by the Plant Genetic Engineering Laboratory of the Institute of Biotechnology, Shanghai Academy of Agricultural Sciences. Various restriction endonucleases and ligases were purchased from Shanghai Haojia Company. Unspecified chemicals were of analytical grade and purchased from Sangon Biotech (Shanghai) Co., Ltd. or Shanghai Sinopharm Group Co., Ltd.

[0028] Example 1: Optimized design and synthesis of the six subunits of toluene monooxygenase

[0029] Based on wild type Pseudomonas stutzeri The coding sequences of the genes for the six subunits of bacterial toluene monooxygenase were optimized according to the following principles to obtain the nucleotide sequences of the six optimized genes as shown in SEQ ID NO.1, SEQ ID NO.2, SEQ ID NO.3, SEQ ID NO.4, SEQ ID NO.5 and SEQ ID NO.6. A T7 promoter and a terminator were attached to both ends of each gene, and they were tandemly linked to form a complete sequence. EcoRI and HindIII restriction sites were attached to both ends of the complete sequence. The full-length sequence was synthesized by Nanjing GenScript Biotech Co., Ltd.

[0030] The optimization principles are as follows: (i) Optimize gene codons, taking into account the codon preferences of both E. coli and plants, to improve gene translation efficiency. (ii) Eliminate recognition sites of commonly used restriction endonucleases within the gene to facilitate expression cassette construction. (iii) Eliminate inverted repeat sequences, stem-loop structures, and transcription termination signals to balance GC / AT within the gene and improve RNA stability. (iv) Ensure that the gene-encoded protein conforms to the N-terminal principle to improve the stability of the translated protein. (v) Optimize the mRNA secondary structure free energy to improve gene expression efficiency.

[0031] SEQ ID NO.2:ggatccatggcaacctttccaatcatgtccaactttgagcgtgactttgtcatccagctg gttcctgttgacactgaggatactatggatcaggttgcagagaagtgtgcctaccactccatcaaccgtcgtgttcatccacaacctgagaagatcctgcgtgttcgtcgtcacgaagatggcaccctgttccctagaggcatgatcgtctctgatgctggcctgagacctaccgagactctggacatcatcttcatggacaactaagagctc; SEQ ID NO.3:ggatccatggcattcgagaaaatctgcaccttggatgatgtctgggaatgtgagatgg aaaccttcactacctccactggtgttgacatcctgcttgttggtgttgaaggtggtgacatgaaggctttccaggctatgtgtccacatcaggagatcgagctggttgaaggtgagttcgatggcaaggtcctgacctgcaaggcacacctctggcagttcgattgccacaatggtgaaggcatcaacccatctgactgtagaatcgctgagtatcctgtcaagatcgaaggtgaagacgtcttcgtcgatgttgaaggtgtcgagccattcaagtctcactcctaagagctc; SEQ ID NO.4:ggatccatgaccaccaacactgttcagaccttgtctgcatctgacaacgcactcaaca acaacatggttggaccagtcctcagagctggtgatgttgccattgctgttggtgaagccgcagagatcgacaatcctggcaaagagatcaaggttgacgacaaacttgcctatgtcagaatcggtgctgaagatgagctgattctccgtaaggagaccatcgaggaatgccttggcagaccattccgtatgcaggagttggagatcaacctgtcttccttcgctggcatcatcgacatggacttcgatcgtgttcgtttctacttcaacaagcacctgtaagagctc; SEQ ID NO.6:ggatccatgagcaacaagatcaagattgctgacaccgatgtcgagttcaccatctctgatcgtgacaccattcttcgtgctgctcttcgtgatggcattccaatctcctatgagtgcaactctggtggatgtggctcctgcaagatcgacgttgtcgaaggacaggtcgagaccctctggggtgaagcacctggactgtctccacgtgacaagcgtaagtctcgtaaactggcatgtcagtgtcttgcctctggacctgtcaccatcaaggctcaactgaccgacaacaaactgcctgagattcgtccattccgtcgtcgtgttcgttacgttggacgtcgtgatctcacctctgacatggctgagttctccttccaggctgaagaaccagcactgtttcttcctggacagtatgccatgctgactgttcctggcatcgaaggagatcgtgcttactccatgtccaacgtctccaacgactctggacgttggcagttcatcatcaagcgtatgcctggaggcaaggcatccaactggctgttcgacgaactgaaacctggtggcatgatcgagatcgatggaccattcggtcttgcctaccttcatcctgagattcaacgtgatgtcgtctgcatcgctggtggctctggtctgtctcctgtcatgtccatcgttcgtgctatcactggtgatccacgtctgtccgaacgtaaggtccacctgttctatggtggacgtactccacaagacctgtgcacctctgaactgctgtctgagatcgaaccactgaacaccaaggcaaaggtcatctccaagactgctgtctctgatcatcagtctgccgagaaggagaactgggaaggaccatgttgctacatccatgaacttgctgaacagactcttggtgatcacatgatggagttcgagtactacttctgtggaccaccaccactgactgaagctgttcagcgtatgctgatgatcgaccacaaggttccattcgatcgtattcatttcgatcgtttcttctaagagctc。

[0032] Example 2: Construction and transformation of Escherichia coli expression vector

[0033] The gene fragment synthesized in Example 1 was digested with EcoRI and HindIII and then ligated into the vector pET-28a, which was also digested with the same enzymes, to obtain the recombinant plasmid pET-tou. This plasmid was then transformed into *E. coli* BL21(DE3) by heat shock. After being plated on kanamycin-resistant solid 2YT plates and incubated overnight at 37°C, positive clones (B-) were obtained. tou The integrity and correctness of the gene sequence were determined by enzyme digestion and DNA sequencing of plasmids in positive clones (see [link]). Figure 2 ).

[0034] Depend on Figure 2 It can be seen that the method of the present invention can successfully construct the recombinant plasmid pET- tou .

[0035] Example 3 Different concentrations of B- tou Degradation effect on 1mM benzene

[0036] The positive strain (B-) obtained in Example 2 tou 1 loop of bacteria was inoculated into 50 mL of LB liquid culture medium and incubated at 37°C for 24 hours (150 rpm). The supernatant was discarded by centrifugation, and the bacterial cells were washed once with sterile M9 medium. The cells were then resuspended in M9 liquid medium. The concentration of the resuspended cells was determined by OD0.05. 600 The concentrations were 0.1, 0.5, 1, 2, and 4 (containing 1% glycerol and 50 μg / mL kanamycin). 1 mM benzene was added to each concentration, and the mixture was shaken at 37°C. Bacterial cultures were collected at 1 h and 2 h to determine the residual benzene content. Figure 3 and Figure 4 ).

[0037] Benzene detection method: The bacterial culture was extracted with an equal volume of ethyl acetate (containing 0.5 mM n-hexadecane) for 1 hour. The upper organic phase was collected, and the residual benzene content was determined by gas chromatography. Gas chromatography conditions: Agilent 7890B gas chromatography system; column: Agilent HP-5 capillary column (30 m × 0.25 mm × 0.25 µm); FID detector; carrier gas He (99.999%), flow rate 1.0 mL / min; injection port temperature 250 °C, temperature program: hold at 50 °C for 6 minutes, then increase to 250 °C at 20 °C / min; injection volume 1.0 μL.

[0038] HPLC detection conditions for catechol: Agilent 1100 high performance liquid chromatography system; C18 column (120 Å, 4.6 × 150 mm, 5 μm); mobile phase: methanol:water = 30:70, flow rate: 1 mL / min; column temperature: 30 ℃; detection wavelength: 213 nm; injection volume: 20 μL.

[0039] Depend on Figure 3 It can be seen that when the bacterial concentration is OD 600 When the value is 1, it only takes 2 hours to completely degrade benzene.

[0040] Depend on Figure 4 It can be seen that benzene is engineered strain B- tou Conversion to catechol: As benzene degrades, the content of catechol increases.

[0041] Example 4: Degradation effect of different concentrations of LBTRJ-2BN on 1mM catechol

[0042] One loopful of Klebsiella pneumoniae LBTRJ-2BN (patent CN119799584A) was inoculated into 50 mL of LB liquid culture medium. The culture was incubated at 37°C for 24 hours (150 rpm), centrifuged to remove the supernatant, and the bacterial cells were washed once with sterile M9 medium. The cells were then resuspended in M9 liquid medium. The concentration of the resuspended cells was determined by OD0.05. 600 The concentrations were 0.5%, 1%, 2%, and 4% (containing 1% glycerol). 1 mM catechol was added to each concentration, and bacterial cultures were collected at 0, 1, 4, and 24 hours. The residual catechol content was determined by HPLC. Figure 5 The detection method is the same as in Example 3.

[0043] Depend on Figure 5 It can be seen that when the concentration (OD) of Klebsiella pneumoniae LBTRJ-2BN resuspended cells is... 600 When the concentration is above 2, catechol can be completely degraded within 24 hours.

[0044] Example 5: Degradation effect of bacterial strain combination on 1mM benzene and catechol

[0045] The positive strain (B-) obtained in Example 2 tou One loop of bacteria was cultured in 50 mL LB liquid medium at 37°C for 24 hours; after centrifugation, the bacteria were washed once with liquid M9 medium; then centrifuged again, and the bacterial cells were resuspended in M9 liquid medium (containing 1% glycerol and 50 μg / mL kanamycin) to obtain approximately OD0.05. 600 =8 of B- tou The suspension, without the addition of the carrier and the inducer required in the host instructions: arabinose and ITPG. Klebsiella LBTRJ-2BN was cultured in LB medium using the same method and then resuspended in M9 liquid medium to obtain approximately OD... 600=8 LBTRJ-2BN suspension. With OD 600 =2 LBTRJ-2BN combined with different concentrations of B- tou (OD 600 After combining different proportions of bacterial strains (e.g., 0.1, 0.5, 1, 2, 4), 1 mM benzene or catechol was added, and the mixture was shaken at 37°C for incubation (degradation pathway see...). Figure 1 Bacterial culture was collected at different times (0, 2, 6, 24 hours) and the content of benzene or catechol was detected. The detection method was the same as in Example 3. The degradation effect under different bacterial load conditions was compared. Figure 6 and Figure 7 .

[0046] Depend on Figure 6 It can be seen that B- tou The ratio of benzene to LBTRJ-2BN can directly affect the degradation rate of benzene.

[0047] Depend on Figure 7 It can be seen that when B- tou and LBTRJ-2BN respectively according to OD 600 When 0.5 and 2.0 are mixed together, both benzene (without catechol accumulation) and catechol are completely degraded after 24 hours.

[0048] The above description is only a preferred embodiment of the present invention. It should be noted that for those skilled in the art, several improvements and modifications can be made without departing from the principle of the present invention, and these improvements and modifications should also be considered within the scope of protection of the present invention.

Claims

1. A composite microbial agent capable of efficiently degrading benzene and catechol, characterized in that, The compound microbial agent is composed of engineered strain B- tou Composed of Klebsiella pneumoniae LBTRJ-2BN; among which the engineered strain B- tou OD 600 The OD of Klebsiella pneumoniae LBTRJ-2BN ranged from 0.1 to 4. 600 It is 0.5~4; The engineered bacteria B- tou Obtained by transfection of Escherichia coli BL21 with a recombinant vector; The recombinant vector contains an artificial sequence encoding toluene monooxygenase and the pET-28a vector; The artificial sequence encoding toluene monooxygenase contains subunits as shown in SEQ ID NO.

1. touA The sequence, such as the subunit shown in SEQ ID NO.2 touB The sequence, such as the subunit shown in SEQ ID NO.3 touC The sequence, such as the subunit shown in SEQ ID NO.4 touD The sequence, such as the subunit shown in SEQ ID NO.5 touE The sequence, such as the subunit shown in SEQ ID NO.6 touF sequence.

2. The compound microbial agent according to claim 1, characterized in that, Each subunit's sequence is connected to the T7 promoter and terminator at both ends, forming an expression unit.

3. The compound microbial agent according to claim 1, characterized in that, The recombinant vector is constructed by tandemly connecting the expression units of the six subunits and inserting them into the pET-28a vector to obtain the recombinant vector.

4. The compound microbial agent according to claim 1, characterized in that, The preservation number of the Klebsiella pneumoniae LBTRJ-2BN is: GDMCC No: 65677.

5. The application of the composite microbial agent according to any one of claims 1 to 4 in wastewater treatment, characterized in that, The waste liquid is contaminated with benzene compounds.

6. The application of the compound microbial agent according to any one of claims 1 to 4 in environmental remediation, characterized in that, The environment in question is one polluted by benzene compounds.

Images