Application of thymine or probiotics over-expressing pyrimidine nucleoside phosphorylase derived from clostridium papyrosolvens to preparation of medicine for regulating and controlling diseases related to glucose and lipid metabolism disorder

By using probiotics that express thymine or overexpress pyrimidine nucleoside phosphorylase from Clostridium perfringens, the problem of regulating disorders of glucose and lipid metabolism has been solved, significantly inhibiting weight gain and improving diabetes symptoms, and has broad application prospects.

CN121550263APending Publication Date: 2026-02-24INST OF ZOOLOGY CHINESE ACAD OF SCI
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202610094521.0
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-10-28
Publication Date
2026-02-24

AI Technical Summary

Technical Problem

Current technologies have failed to effectively regulate disorders of glucose and lipid metabolism, especially obesity and type 2 diabetes, and lack rapid and effective prevention and treatment methods.

Method used

Probiotics that utilize thymine or overexpress pyrimidine nucleoside phosphorylase from Clostridium perfringens can be used to prepare drugs or health products to improve glucose and lipid metabolism disorders by regulating glucose and lipid metabolism. This includes using recombinant vectors and probiotic strains that overexpress pyrimidine nucleoside phosphorylase, such as Lactococcus lactis, to promote the production of thymine in the gut.

Benefits of technology

It significantly inhibits weight gain induced by a high-fat diet, improves glucose and insulin tolerance, increases GLP-1 levels, and regulates glucose and lipid metabolism disorders, showing broad application prospects.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure FT_1
    Figure FT_1
  • Figure FT_2
    Figure FT_2
  • Figure FT_3
    Figure FT_3
Patent Text Reader

Abstract

The invention provides application of thymine or probiotics over-expressing pyrimidine nucleoside phosphorylase from clostridium papyrosolvens to preparation of drugs for regulating and controlling diseases related to glucose and lipid metabolism disorder, and belongs to the technical field of biological drugs. The invention discloses application of probiotics of pyrimidine nucleoside phosphorylase derived from thymine or over-expression clostridium papyrosolvens in preparation of drugs for regulating and controlling diseases related to glucose and lipid metabolism disorder. Glycolipid metabolism disorder caused by high-fat diet induction can be remarkably improved through thymine treatment. The thymine provided by the invention can be used for preparing food or medicines for preventing or treating metabolic diseases, and has a very wide application prospect.
Need to check novelty before this filing date? Find Prior Art

Description

[0001] This application is a divisional application of Chinese Patent Application No. 202511543534.3, filed on October 28, 2025, entitled "Application of probiotics expressing Clostridium lysinate, thymine, or pyrimidine nucleoside phosphorylase derived from Clostridium lysinate in the preparation of drugs for regulating disorders of glucose and lipid metabolism", the entire contents of which are incorporated herein by reference. Technical Field

[0002] This invention belongs to the field of biopharmaceutical technology, specifically relating to the application of probiotics that express thymine or overexpress pyrimidine nucleoside phosphorylase from Clostridium perfringens in the preparation of drugs that regulate disorders of glucose and lipid metabolism. Background Technology

[0003] High-sugar, high-fat diets and declining physical activity levels have led to a gradual increase in the incidence of metabolic diseases related to glucose and lipid metabolism disorders, such as obesity, type 2 diabetes, and metabolic syndrome. Therefore, developing rapid and effective prevention and treatment methods is of great significance.

[0004] Clostridium perfringens ( Clostridium papyrosolvens It is a Gram-positive, anaerobic bacterium belonging to the genus Clostridium ( ). Clostridium *Clostridium papyriferum* holds significant value in the field of industrial microbiology. It can produce chemicals such as acetone, ethanol, and n-butanol, as well as biofuels, during fermentation, thus being considered an important industrial microorganism. Furthermore, *Clostridium papyriferum* has shown potential in degrading lignocellulose. Its secretomics analysis revealed the enzymatic basis of its lignocellulose degradation, indicating that the bacterium can produce various carbohydrate-active enzymes (CAZymes), including extracellular multi-enzyme complexes, to enhance the degradation of cellulose biomass. However, there are currently no reports on *Clostridium papyriferum*'s role in regulating glucose and lipid metabolism disorders. Summary of the Invention

[0005] In view of this, the purpose of this invention is to provide the application of probiotics that express thymine or overexpress pyrimidine nucleoside phosphorylase derived from Clostridium perfringens in the preparation of drugs that regulate disorders of glucose and lipid metabolism.

[0006] This invention provides the application of probiotics that express thymine or overexpress pyrimidine nucleoside phosphorylase from Clostridium perfringens in the preparation of drugs that regulate disorders of glucose and lipid metabolism.

[0007] Preferably, the probiotics overexpressing pyrimidine nucleoside phosphorylase from Clostridium lysate include probiotic strains with a gene sequence encoding pyrimidine nucleoside phosphorylase inserted into their genome and / or probiotic strains containing a recombinant vector expressing pyrimidine nucleoside phosphorylase.

[0008] Preferably, the disorders related to glucose and lipid metabolism include at least one of the following: obesity, type 2 diabetes, metabolic syndrome, insulin deficiency, diabetes, hypertension due to insulin resistance, and cardiovascular disease.

[0009] Preferably, the disorders related to glucose and lipid metabolism include those induced by a high-fat diet.

[0010] Preferably, the drug comprises at least one of the following dosage forms: tablets, capsules, liquid preparations, granules, powders, pills, and powders.

[0011] This invention provides a drug for regulating disorders of glucose and lipid metabolism, the active ingredients of which include thymine and probiotics that overexpress pyrimidine nucleoside phosphorylase derived from Clostridium perfringens.

[0012] This invention provides the application of probiotics expressing thymine or overexpressing pyrimidine nucleoside phosphorylase from *Clostridium lysinensis* in the preparation of drugs regulating disorders of glucose and lipid metabolism. Experiments of this invention demonstrate that *Clostridium lysinensis* can effectively inhibit weight gain induced by a high-fat diet in mice and induce metabolic remodeling; treatment with the *Clostridium lysinensis* metabolite thymine can effectively improve glucose and lipid metabolism disorders induced by a high-fat diet; furthermore, gavage administration of *Lactococcus lactis* overexpressing pyrimidine nucleoside phosphorylase to mice can promote the production of thymine in the intestine and exert an anti-obesity effect. The *Clostridium lysinensis*, the *Clostridium lysinensis* metabolite thymine, or the probiotics overexpressing pyrimidine nucleoside phosphorylase from *Clostridium lysinensis* provided by this invention can all be used to prepare health products or drugs for the prevention or treatment of metabolic diseases, and have very broad application prospects. Attached Figure Description

[0013] Figure 1 The graph shows the effects of *Clostridium perfringens* on body weight, blood glucose, and GLP-1 levels in mice induced by a high-fat diet. A represents the effect of *Clostridium perfringens* on body weight in mice induced by a high-fat diet; B represents the effect of *Clostridium perfringens* on blood glucose levels at the GTT (glucose tolerance test) in mice induced by a high-fat diet; C represents the effect of *Clostridium perfringens* on blood glucose levels at the ITT (intracytoplasmic weight test) in mice induced by a high-fat diet; and D represents the effect of *Clostridium perfringens* on serum GLP-1 levels in mice induced by a high-fat diet under fasting conditions. express P <0.05; express P <0.01; express P <0.001; Figure 2 The image shows the metabolomics results of Clostridium difficile; where A represents the fecal metabolomics results of mice after gavage treatment with Clostridium difficile; B represents the metabolomics results of the culture medium of Clostridium difficile; and C represents a comparison between the fecal metabolomics results and the culture medium metabolomics results. Figure 3 Figure 1 shows the effects of thymine on body weight, blood glucose, and histological characteristics in mice induced by a high-fat diet. Specifically, A represents the effect of thymine on body weight in mice induced by a high-fat diet; B represents the effect of thymine on glucose tolerance in mice induced by a high-fat diet; C represents the effect of thymine on insulin tolerance in mice induced by a high-fat diet; and D represents the H&E staining results of thymine on different mouse tissues. express P <0.05; express P <0.01; express P <0.0001; Figure 4 The levels of GLP-1 in mice and STC-1 cells induced by a high-fat diet and thymine were measured. gcg The diagram illustrates the effects of thymine on serum GLP-1 levels in mice induced by a high-fat diet; Figure A shows the effect of thymine on GLP-1 levels in mouse colon. gcg Effects of thymine on gene expression levels; C represents the effect of thymine on GLP-1 levels in the small intestinal epithelial endocrine cell line STC-1; D represents the effect of thymine on STC-1 cells. gcg The influence of gene expression levels; among which express P <0.05; express P <0.01; Figure 5 A graph showing the thymine content in a reaction system with added MBP-pdp; Figure 6 For reorganization L. lactis Results of thymine assay in the intestinal contents of ::pdp group mice; among which express P <0.05; Figure 7 For reorganization L. lactis Results of the effect of pdp on body weight in mice on a high-fat diet; among which express P <0.05; express P <0.0001. Detailed Implementation

[0014] This invention provides the application of Clostridium difficile, thymine, or probiotics overexpressing pyrimidine nucleoside phosphorylase from Clostridium difficile in the preparation of drugs that regulate disorders of glucose and lipid metabolism.

[0015] The present invention also provides the application of probiotics containing Clostridium lysate, thymine, or overexpressing pyrimidine nucleoside phosphorylase derived from Clostridium lysate in the preparation of health products that improve the following metabolic-related symptoms: overweight, dyslipidemia, and glucose intolerance.

[0016] In this invention, the *Clostridium lycolyticum* preferably includes wild-type *Clostridium lycolyticum* or genetically modified *Clostridium lycolyticum*. The genetically modified *Clostridium lycolyticum* preferably includes recombinant *Clostridium lycolyticum* overexpressing pyrimidine nucleoside phosphorylase. Experiments of this invention demonstrate that the overexpression of pyrimidine nucleoside phosphorylase can effectively promote the secretion of thymine, a secondary metabolite of *Clostridium lycolyticum*. Experiments have shown that thymine is the only *Clostridium lycolyticum* metabolite whose metabolism is upregulated both in vivo and in vitro in vitro. Furthermore, treatment of high-fat diet-induced model mice with thymine alone not only achieves the same effect as *Clostridium lycolyticum* in regulating glucose and lipid metabolism disorders (inhibiting weight gain, regulating glucose tolerance and insulin tolerance in mice), but also increases GLP-1 levels.

[0017] In this invention, the probiotics overexpressing pyrimidine nucleoside phosphorylase from *Clostridium lysate* preferably include probiotic strains with a sequence encoding pyrimidine nucleoside phosphorylase inserted into their genome and / or probiotic strains containing a recombinant vector expressing pyrimidine nucleoside phosphorylase. This invention does not impose any special limitations on the type of probiotics used; any probiotics well-known in the art, such as lactic acid bacteria, can be used. In a specific embodiment of this invention, *Lactococcus lactis* (… L.lactis (Example:) This section illustrates the application characteristics of probiotics that overexpress pyrimidine nucleoside phosphorylase derived from Clostridium perfringens. 。 The method for constructing probiotics overexpressing pyrimidine nucleoside phosphorylase preferably involves cloning the sequence encoding pyrimidine nucleoside phosphorylase into an expression vector, transferring the resulting recombinant vector into competent host cells, and collecting the bacterial cells after screening and induction culture. The overexpressed pyrimidine nucleoside phosphorylase in the bacterial cells enhances the synthesis of thymine from thymine nucleosides, increasing the synthesis of the secondary metabolite thymine, thereby regulating glucose and lipid metabolism disorders (inhibiting weight gain in mice and regulating glucose tolerance and insulin tolerance).

[0018] In this invention, the *Clostridium thuringiensis* preferably comprises *Clostridium thuringiensis* cells and / or a culture of *Clostridium thuringiensis*. The *Clostridium thuringiensis* culture preferably comprises *Clostridium thuringiensis* fermentation broth or *Clostridium thuringiensis* fermentation supernatant. The *Clostridium thuringiensis* fermentation broth is preferably obtained by culturing wild-type *Clostridium thuringiensis* or genetically modified *Clostridium thuringiensis* in GS-2 medium, and contains cells and metabolites. The *Clostridium thuringiensis* fermentation supernatant is preferably obtained by solid-liquid separation of the *Clostridium thuringiensis* fermentation broth and collection of the liquid phase, and contains metabolites.

[0019] In this invention, the probiotics overexpressing pyrimidine nucleoside phosphorylase from *Clostridium lysozyme* preferably include *Lactococcus lactis* overexpressing pyrimidine nucleoside phosphorylase from *Clostridium lysozyme*. This invention does not impose any particular limitation on the construction method of the probiotics overexpressing pyrimidine nucleoside phosphorylase from *Clostridium lysozyme*; any recombinant strain construction method well-known in the art can be used. For example, a recombinant vector expressing pyrimidine nucleoside phosphorylase from *Clostridium lysozyme* can be cloned into a probiotic strain, and the positive transformants obtained through verification and screening are probiotics overexpressing pyrimidine nucleoside phosphorylase from *Clostridium lysozyme*.

[0020] In this invention, the glucose and lipid metabolism disorder-related diseases preferably include at least one of the following: obesity, type 2 diabetes, metabolic syndrome, insulin deficiency, diabetes, hypertension caused by insulin resistance, and cardiovascular disease. The glucose and lipid metabolism disorder-related diseases preferably include those induced by a high-fat diet.

[0021] In this invention, the drug preferably comprises at least one of the following dosage forms: tablets, capsules, liquid formulations, granules, powders, pills, and powders. The drug also includes medically acceptable excipients. The selection of excipients is conventional, depending on the specific dosage form of the drug. This invention does not impose any special limitations on the preparation method of the drug; any drug preparation method well-known in the art can be used. The preferred concentration of Clostridium perfringens in the drug is 5 × 10⁻⁶. 10 CFU / ml or 5×10 10 CFU / g or higher, preferably 5×10⁻⁶ 11 CFU / ml or 5×10 11 CFU / g.

[0022] This invention provides a drug for regulating disorders of glucose and lipid metabolism, wherein the active ingredients include at least two of Clostridium perfringens, thymine, and probiotics that overexpress pyrimidine nucleoside phosphorylase derived from Clostridium perfringens.

[0023] In this invention, the active ingredients preferably include a combination of *Clostridium lysole* and thymine, a combination of *Clostridium lysole* and probiotics overexpressing pyrimidine nucleoside phosphorylase from *Clostridium lysole*, a combination of thymine and probiotics overexpressing pyrimidine nucleoside phosphorylase from *Clostridium lysole*, or a combination of *Clostridium lysole*, thymine, and probiotics overexpressing pyrimidine nucleoside phosphorylase from *Clostridium lysole*. The preferred ratio of *Clostridium lysole* to thymine is 1~10:1~10, but can be 2~7:2~7, 3~5:3~5, or 1:1. Similarly, the preferred ratio of *Clostridium lysole* to probiotics overexpressing pyrimidine nucleoside phosphorylase from *Clostridium lysole* is 1~10:1~10, but can be 2~7:2~7, 3~5:3~5, or 1:1. The preferred ratio of thymine to probiotics overexpressing pyrimidine nucleoside phosphorylase from *Clostridium lysinus* is 1~10:1~10, but can be 2~7:2~7, 3~5:3~5, or 1:1. The preferred ratio of the probiotics containing *Clostridium lysinus*, thymine, and pyrimidine nucleoside phosphorylase from *Clostridium lysinus* is 1~10:1~10:1~10, but can be 2~7:2~7:2~7, 3~5:3~5:3~5, or 1:1:1.

[0024] The following examples illustrate the application of probiotics containing thymine or overexpressing pyrimidine nucleoside phosphorylase from Clostridium perfringens in the preparation of drugs for regulating disorders of glucose and lipid metabolism. However, these examples should not be construed as limiting the scope of protection of this invention.

[0025] Example 1 Application of Clostridium difficile and its metabolites in metabolic regulation 1. Materials and Methods 1.1 Experimental Materials The experimental bacteria used was Clostridium difficile DSM 2782, purchased from the Biogas Research Institute of the Ministry of Agriculture and Rural Affairs.

[0026] Mice: C57BL / 6 mice, purchased from Vital River.

[0027] Experimental reagents and materials: DMEM high-glucose medium, phosphate-buffered saline (PBS), fetal bovine serum (FBS): Gibco; dimethyl sulfoxide (DMSO), trypsin, thymine, thymidine, glucose: Sigma; 60% fat high-fat diet: Research Diets; insulin: Humalog; IDPP4: Millipore; GLP-1 ELISA kit, insulin ELISA kit: Shanghai Enzyme-Linked Biotechnology Co., Ltd.; blood glucose test strips: Roche; reverse transcription kit, Q-PCR enzyme: Nanjing Novizan Biotechnology Co., Ltd.; Trizol, FastDigest BamH1, FastDigest Ecor1 restriction endonuclease, T4 DNA ligase: Thermo Fisher Scientific; Ensure Plus: Abbott Laboratories; ampicillin, NaOH, competent cells: TransGold.

[0028] 1.2 Experimental Methods and Results 1.2.1 Clostridium perfringens ( Clostridium papyrosolvens Feeding significantly inhibited the increase in body weight induced by a high-fat diet in mice and induced metabolic remodeling in them. A glucose and lipid disorder model was induced in C57BL / 6 mice by feeding them a high-fat diet containing 60% fat. Successful induction was indicated by a body weight greater than 35g after eight weeks of feeding, resulting in obese mice. 1×10 10 Obese mice were administered CFU / mouse / day or an equal volume of sterile water by gavage. Glucose tolerance in mice was assessed by oral glucose tolerance test (OGTT) or intraperitoneal glucose tolerance test (IPGTT), and insulin resistance was assessed by insulin resistance test (ITT).

[0029] result The results are as follows Figure 1 As shown in Figure A, treatment with Clostridium difficile significantly inhibited the increase in body weight in the model mice. Figure 1 As shown in Figure B, treatment with Clostridium difficile resulted in better glucose tolerance in the model mice compared to the control group; Figure 1 As shown in Figure C, Clostridium difficile treatment resulted in better insulin tolerance in the model mice compared to the control group. In summary, compared to the high-fat diet control group, Clostridium difficile significantly improved glucose metabolism disorders induced by a high-fat diet.

[0030] After fasting for 16 hours, 50 μl of blood was collected from the tail vein of obese or normal mice (IDPP4 was added to the centrifuge tube beforehand to prevent GLP-1 degradation). Serum was collected after centrifugation at 4000 rpm and 4℃ for 20 min. The GLP-1 content in mouse serum was detected using a GLP-1 ELISA kit (purchased from Shanghai Enzyme-Link Biotechnology Co., Ltd.).

[0031] The results are as follows Figure 1 As shown in Figure D, the serum GLP-1 content in mice treated with Clostridium difficile was significantly higher than that in the control group.

[0032] In summary, Clostridium difficile can effectively inhibit the increase in body weight and induce metabolic remodeling in obese mice induced by a high-fat diet, as well as increase the level of GLP-1 in serum.

[0033] Example 2 Screening of candidate secondary metabolites that mediate the beneficial effects of Clostridium difficile on metabolism To identify candidate secondary metabolites that play an important role in the regulation of glucose and lipid metabolism by Clostridium difficile, a high-fat diet-induced model was induced, and the bacteria were fed a diet containing 1×10⁻⁶ metabolites. 10 Mice were treated with *Clostridium thuringiensis* via gavage at a dose of CFU / mouse / day, with obese mice induced by gavage with an equal volume of sterile water and a high-fat diet serving as controls. After eight weeks of treatment, fecal samples were collected for fecal metabolomics analysis. To identify secondary metabolites of *Clostridium thuringiensis* that exert metabolic regulatory functions, *Clostridium thuringiensis* was cultured in GS-2 medium at 37°C for 24 hours in vitro. The culture supernatant was collected by centrifugation and subjected to metabolomics analysis, with GS-2 medium without *Clostridium thuringiensis* serving as a control.

[0034] The results are as follows Figure 2 As shown in Figure A, the content of various metabolites in mouse feces was significantly altered after treatment with Clostridium difficile.

[0035] like Figure 2 As shown in Figure B, metabolomics results revealed significant changes in the types and abundance of secondary metabolites in the culture medium after *Clostridium lysate* growth, compared to the control medium. A comparison of fecal metabolomics results and culture medium metabolomics results showed that, for example... Figure 2 As shown in C, thymine is the only metabolite in Clostridium difficile that is upregulated in both in vivo and in vitro culture in mice.

[0036] Example 3 Thymine treatment can significantly improve glucose and lipid metabolism disorders induced by a high-fat diet. Mice were treated with thymine at a dose of 5 mg / kg / day in a high-fat diet. Glucose tolerance was assessed by oral glucose tolerance test (OGTT) or intraperitoneal glucose tolerance test (IPGTT), and insulin resistance was assessed by insulin resistance test (ITT).

[0037] The results are as follows Figure 3 As shown in Figure A, treatment with the secondary metabolite thymine significantly inhibited the weight gain induced by a high-fat diet in mice; Figure 3 As shown in Figure B, compared to the control group mice on a high-fat diet only, mice treated with thymine and fed a high-fat diet exhibited better glucose tolerance in the high-fat diet-induced mice. Figure 3 As shown in Figure C, compared with the control group mice on a high-fat diet only, the insulin tolerance induced by the high-fat diet treated with thymine was significantly improved in the mice.

[0038] The morphological changes of liver and adipose tissue were observed by tissue sectioning and staining (H&E staining in this example).

[0039] The results are as follows Figure 3 As shown in Figure D, H&E staining results indicate that thymine can alleviate fatty liver levels induced by a high-fat diet and reduce the size of lipid droplets in inguinal white fat (subcutaneous fat), visceral fat (epididymal fat), and brown fat.

[0040] Example 4 Thymine increased GLP-1 levels and gcg Transcription level To investigate the effect of thymine on GLP-1 levels in mouse serum, 50 μl of blood was collected from the tail vein of thymine-treated and control mice after a 16-hour fast. Serum was collected after centrifugation at 4000 rpm and 4°C for 20 min. The GLP-1 level in mouse serum was detected using a GLP-1 ELISA kit (IDPP4 was added to the centrifuge tubes beforehand to prevent GLP-1 degradation).

[0041] The results are as follows Figure 4 As shown in Figure A, compared with the control group mice on a high-fat diet only, the serum GLP-1 content of mice in the thymine-treated group was significantly increased.

[0042] To identify the protein encoding GLP-1 in the mouse colon gcg To investigate gene level changes, colon tissue samples were collected from mice, and quantitative real-time polymerase chain reaction (qPCR) was used to quantitatively analyze the colon tissue. gcgGene expression levels. The primer sequences used for qPCR are as follows: F: AATCTTGCCACCAGGGACTT (SEQ ID NO:1), R: AGTGACTGGCACGAGATGTT (SEQ ID NO:2); RT-qPCR was performed using HiScript III 1st Strand cDNA Synthesis Kit (+gDNA wiper) (R312, Vazyme) reagents, and the reaction system and procedure were performed according to the reagent manufacturer's instructions.

[0043] The results are as follows Figure 4 As shown in Figure B, compared to the control group mice fed only a high-fat diet, the colon tissue of the thymine-treated group mice showed increased levels of... gcg Gene expression levels were significantly increased.

[0044] Meanwhile, in order to study the effect of thymine on GLP-1 levels and gcg To investigate the effect on gene expression, mouse small intestinal endocrine cells (STC-1), a cell model with high GLP-1 synthesis and secretion, were used. After treating STC-1 cells with 10 μM thymine for 24 hours, the level of GLP-1 in the culture supernatant was measured, and RNA was extracted from the cells for further analysis. gcg Gene expression.

[0045] The results are as follows Figure 4 As shown in C and D, the level of GLP-1 in the culture supernatant was significantly upregulated after 24 hours of treatment with thymine on STC-1 cells, and gcg The transcription level was also significantly increased.

[0046] In summary, thymine can increase GLP-1 levels and gcg Gene expression, a process that may be a pathway by which thymine regulates the body's glucose and lipid metabolism.

[0047] Example 5 Pyrimidine nucleoside phosphorylase (PDP) mediates the production of thymine, a secondary metabolite from Clostridium lysate. To investigate the specific metabolic pathways by which Clostridium thuringiensis produces the secondary metabolite thymine, a KEGG database search was conducted to identify the sources of thymine in organisms. The search revealed four main pathways for the sources of thymine in organisms. A search of the genes encoding the proteases of these four pathways in Clostridium thuringiensis revealed that only the gene encoding pyrimidine nucleoside phosphorylase (pdp) was found in the Clostridium thuringiensis genome.

[0048] BamH 1 and Ecor 1. The PCR product and pMAL-c5x vector were digested with enzymes at 37℃ for 3 hours, and the corresponding bands were recovered by agarose gel electrophoresis. The insert sequence and vector were ligated using T4 DNA ligase at a molar ratio of 1:1. The resulting recombinant plasmid pdp-pMAL-c5x and empty pMAL-c5x vector were transformed into *E. coli*. Transetta The competent cells were plated on LB agar plates containing ampicillin and cultured overnight. Six to eight clones were picked from each plate and inoculated into 3 ml of LB liquid medium. Once the OD value of the bacterial culture reached 0.4–0.6, 1 ml of the culture was incubated with 0.8 M IPTG at a 1:1000 ratio and induced at 28°C and 200 rpm in the dark. After collecting the bacterial sediment, loading buffer was added, and the culture was heated at 95°C for 10 minutes. The supernatant was then collected after centrifugation to detect the PDP protein expression level.

[0049] The pdp-pMAL-c5x vector contains an MBP sequence (maltose-binding protein, which enhances the solubility of the fusion protein), therefore, the complete structure of the expressed recombinant protein is MBP-pdp-his. If a specific band appears at the target position in the induced sample compared to before induction, expression is successful, and protein purification can begin. After overnight induction, the bacterial culture is centrifuged, the bacterial precipitate is collected, resuspended in PBS, and lysed using an ultrasonic homogenizer to release the recombinant protein into the solution. Once the bacterial culture becomes clear, lysis is stopped, and the supernatant is collected by centrifugation at 12000 rpm and 4°C for 20 min. The supernatant is then filtered through a 0.22 µm filter and used for further purification. Because the recombinant protein carries a His tag, purification is performed using a nickel column. 10 ml of packing material is added to a clean chromatography column, washed five times with 10 ml of PBS, and the lysed bacterial supernatant is added. The liquid is allowed to flow slowly through the packing material, and the eluent is collected in a clean centrifuge tube below. This process is repeated five times. Next, the column packing material was washed with 100 ml of PBS containing 20 mM imidazole to remove interfering proteins. Elution was then performed with 10 ml of PBS containing 50 mM, 100 mM, 150 mM, 200 mM, 300 mM, and 500 mM imidazole, and the eluents were collected. Protein purity and abundance were determined by gel electrophoresis. In this invention, MBP expressed by the pMAL-c5x empty vector was used as a control. However, because MBP does not carry a his tag, it was purified using a straight-chain starch-agarose medium. The purification steps were basically the same as for Nectin2, except that imidazole was not used for elution; instead, 10 mM and 100 mM maltose were used, and PBS was used directly for washing away interfering proteins. After obtaining MBP-pdp and MBP protein, in vitro reaction experiments were conducted. 25 mM thymidine, 1 mM EDTA-2Na, 50 mM PB (pH=7.2-7.4), and 1 μg protein were added sequentially. After reacting at 37℃ for 4 hours, the reaction was terminated with 0.1 M sodium hydroxide. The samples after the reaction were then analyzed by mass spectrometry.

[0050] The results are as follows Figure 5 As shown, compared with the MBP control group, the level of thymine was significantly increased in the reaction system with added MBP-pdp. This suggests that within Clostridium lysate, pdp catalyzes the conversion of thymine nucleosides to thymine.

[0051] Example 6 Recombinant Lactococcus lactis overexpressing PDP protein ( L.lactis PDP can promote the production of thymine in the intestine and exert an anti-obesity effect. To investigate the function of PDP protein in vivo, the pdp gene was cloned into the pNZ8149 expression vector and introduced into Lactococcus lactis NZ3900, thus constructing a recombinant strain. L.lactis::pdp. Lactococcus lactis and plasmid pNZ8149 were purchased from MoBiTec (catalog number: VS-ELS03900-01). The NICE promoter in the pNZ8149 plasmid has been replaced with gap A. From Clostridium difficile pdp The gene's C-terminus is fused with a 6×His tag and synthesized together with Usp45, LESS, and EK, each end bearing a 6×His tag. Nsp I and Xba Nsp I and Xba The ligation product was then transformed into *Lactococcus lactis* via electroporation (2500 V, 25 μF, 200 Ω). Positive recombinant clones were screened by PCR using Elliker selective agar plates and subsequently inoculated into M17 medium for static culture at 30°C. The ligation was precipitated with ethanol and hydrochloric acid. L.lactis Proteins in the PDP culture supernatant were collected and resuspended in 8M urea (prepared with Tris-HCl, pH=8). Positive clones were confirmed by Western blotting using an anti-His antibody (30401ES50, Yeasen).

[0052] Reorganization L. lactis ::pdp according to 1×10 10 Mice were administered CFU / mouse via gavage, and their intestinal contents were collected one hour later for thymine detection. The results showed that recombinant CFU / mouse... L. lactis The intestinal contents of the ::pdp group mice contained more than those of the wild type. L. lactis Higher levels of thymine ( Figure 6 ).

[0053] It is worth noting that, with 1×10 10 Mice given a high-fat diet by gavage at a dose of CFU / mice / day for 4 weeks showed that this recombinant probiotic significantly exerted an anti-obesity effect. Figure 7 These findings suggest that PDP proteins from Clostridium difficile mediate thymine production and contribute to host metabolic regulation.

[0054] The above description is only a preferred embodiment of the present invention. It should be noted that for those skilled in the art, several improvements and modifications can be made without departing from the principle of the present invention, and these improvements and modifications should also be considered within the scope of protection of the present invention.

Claims

1. Application of thymine or probiotics overexpressing pyrimidine nucleoside phosphorylase from Clostridium perfringens in the preparation of drugs for the prevention or treatment of diseases related to glucose and lipid metabolism disorders.

2. The application according to claim 1, characterized in that, The probiotics overexpressing pyrimidine nucleoside phosphorylase from Clostridium lysate include probiotic strains with a gene sequence encoding pyrimidine nucleoside phosphorylase inserted into their genome and / or probiotic strains containing a recombinant vector expressing pyrimidine nucleoside phosphorylase.

3. The application according to claim 1, characterized in that, The disorders related to glucose and lipid metabolism include at least one of the following: obesity, type 2 diabetes, metabolic syndrome, insulin deficiency, diabetes, hypertension due to insulin resistance, and cardiovascular disease.

4. The application according to claim 1, characterized in that, The disorders related to glucose and lipid metabolism include those induced by a high-fat diet.

5. The application according to claim 1, characterized in that, The drug includes at least one of the following dosage forms: tablets, capsules, liquid preparations, granules, powders, pills, and powders.

6. A drug for the prevention or treatment of diseases related to glucose and lipid metabolism disorders, characterized in that, The active ingredients include thymine and / or probiotics that overexpress pyrimidine nucleoside phosphorylase derived from Clostridium lysate.