Primer pair, probe and reagent set for detecting bombyx mori densovirus and preparation method of primer pair, probe and reagent set

Abstract

The invention discloses a primer pair, a probe and a reagent set for detecting bombyx mori densovirus and a preparation method of the primer pair, the probe and the reagent set, and relates to the technical field of biology. According to the primer pair for detecting the bombyx mori densovirus, the nucleotide sequence of an upstream primer of the primer pair is CTACGGGAGGCTTGTTGGTT; and the nucleotide sequence of the downstream primer is ACTTACCATTGGTTATAAGGGTG. The invention further discloses a probe for detecting the bombyx mori densovirus and application of the probe. A complete set of reagents for detecting BmBDV infection is established based on a real-time fluorescent quantitative PCR technology, and redundant operation generated when a detection system is configured can be effectively reduced through a preset primer pair and a probe.

Description

Technical Field

[0001] This invention relates to the field of biotechnology, specifically to a primer pair, probe, complete set of reagents, and preparation method for detecting silkworm nucleovirus. Background Technology

[0002] Bombyx mori densovirus (BmBDV) is one of the main pathogens causing viral diseases in silkworms, often resulting in huge economic losses and seriously affecting the stability of silkworm production. Establishing early diagnostic methods will buy valuable time for the prevention and control of silkworm viral diseases.

[0003] BmBDV belongs to the Dividoviridae family and can cause silkworm dysplasia, manifesting as anorexia, empty head, and softening. In the early stages of infection, it presents similar symptoms to Bombyx morinfectious flacherie virus (BmIFV), making accurate early identification of the pathogen challenging solely based on the symptoms of infected silkworms and rearing experience. Nucleic acid detection is a major future direction for identifying silkworm viral diseases; however, due to operational complexity, commercially available reagent kits for detecting BmBDV are not yet available.

[0004] Currently, there are no reports in domestic or international literature on the detection of BmBDV using real-time quantitative PCR based on pre-set primers and probes. Summary of the Invention

[0005] To address the aforementioned technical problems, the present invention aims to provide primer pairs, probes, a complete set of reagents for detecting silkworm blastoma virus and their preparation method. Based on real-time quantitative PCR technology, a complete set of reagents for detecting BmBDV infection is established. The pre-set primer pairs and probes will effectively reduce the redundant operations that occur when configuring the detection system.

[0006] The technical solution of the present invention to solve the above-mentioned technical problems is as follows: a primer pair for detecting silkworm nucleoid virus is provided, wherein the nucleotide sequence of the upstream primer is CTACGGGAGGCTTGTTGGTT; and the nucleotide sequence of the downstream primer is ACTTTACCATTTGGTTATAAGGGTG.

[0007] The present invention also provides a probe for detecting silkworm nucleoid virus, the nucleotide sequence of which is 5'-TCAATTACAACATCATCCA-3';

[0008] The probe is labeled with a FAM fluorescent group at its 5' end and a non-fluorescent quencher group NFQ-MGB at its 3' end.

[0009] The present invention also provides the application of the above-mentioned primer pairs for detecting silkworm blastocystis virus or the above-mentioned probes for detecting silkworm blastocystis virus in the preparation of a complete set of reagents or kits for detecting silkworm blastocystis virus.

[0010] The present invention also provides a complete set of reagents for detecting silkworm blastocystis virus, including the primer pairs for detecting silkworm blastocystis virus and / or the probes for detecting silkworm blastocystis virus.

[0011] This invention also provides a method for preparing the above-mentioned complete set of reagents for detecting silkworm nucleoid virus, comprising the following steps:

[0012] S1. Mix and disperse Pluronic F127, trehalose and DEPC water evenly, let stand overnight until the solution is clear, and add DEPC water to make up to 100 mL to obtain the buffer solution;

[0013] S2. Dilute the upstream primer of the primer pair with buffer, aliquot it into the bottom of a PCR tube, transfer it to room temperature and let it stand for 5-10 minutes to solidify into a transparent gel. Allow it to air dry at room temperature, and then repeat the above steps to aliquot the downstream primer and probe to obtain a complete set of reagents.

[0014] Furthermore, in step S1, the mass ratio of Pluronic F127 to trehalose is 15-25:5.

[0015] Further, in step S2, the nucleotide sequence of the upstream primer of the primer pair is TATACCTGGGCACACTTGCG; the nucleotide sequence of the downstream primer is CCTCGCTCTCTTAGGCGTTC; and the nucleotide sequence of the probe is 5'-TAGTCAGCTAGTAGCGCA-3'; wherein, the 5' end of the probe is labeled with a FAM fluorescent group, and the 3' end is labeled with a non-fluorescent quencher group NFQ-MGB.

[0016] Furthermore, ensure that each PCR tube contains complete primer pairs (400 nM) and probe (200 nM) sequences.

[0017] This invention also provides a method for detecting silkworm nucleoid virus using the above-mentioned complete set of reagents, comprising the following steps:

[0018] (1) Extract the genome of the midgut and body wall tissue of the silkworm to be tested as a template;

[0019] (2) Prepare the reaction system in the PCR tubes containing the complete set of reagents;

[0020] (3) Place the reaction system in a real-time quantitative PCR instrument to perform the real-time quantitative PCR reaction and collect the fluorescence signal;

[0021] (4) If an amplification curve appears in the reaction system, the sample to be tested contains the pathogen corresponding to the amplification curve; if there is no amplification curve in the reaction system, the sample to be tested does not contain the corresponding pathogen.

[0022] Furthermore, in step (2), the volume ratio of Reaction Mix (2×), Taq Mix, ROX ReferenceDye and template in the reaction system is 12.5:0.5:0.1:2; ddH2O is subsequently added to make up to 25 µL.

[0023] Furthermore, in step (2), the reaction system may contain other reagents required for the detection of BmBDV infection by real-time quantitative PCR, specifically the reagents in the Superscript III platinum one step qRT-PCR kit, such as 2×Reaction Mix, Superscript III platinum Taq Mix, and ROX Reference Dye.

[0024] Furthermore, in step (3), the PCR reaction program is 4 ℃ for 2 min; 50 ℃ for 15 min; 95 ℃ for 2 min; 95 ℃ for 15 s, 60 ℃ for 45 s, for 40 cycles.

[0025] Furthermore, in step (3), the real-time PCR instrument is an Applied Biosystems 7500 model.

[0026] The present invention has the following beneficial effects:

[0027] 1. The complete set of reagents of the present invention can realize the early diagnosis of BmBDV infection, and buy valuable time to block the spread of the virus.

[0028] 2. This invention can significantly reduce the operational complexity of nucleic acid detection by pre-setting primer pairs and probes.

[0029] 3. The complete set of reagents of the present invention has high specificity and sensitivity in detecting BmBDV infection. The detection process is simple, fast and accurate, which is of great significance for the early diagnosis of silkworm pustulosis.

[0030] 4. The template sequence used in this invention for designing primers spans both structural and non-structural protein coding regions. This not only overcomes the disadvantage that structural sequences are prone to forming secondary structures that hinder primer binding, but also reduces the potential lack of specificity in non-structural sequences. It can effectively cope with viral mutations and balance amplification efficiency and specificity. Attached Figure Description

[0031] Figure 1 This is a schematic diagram of the complete set of reagents for detecting silkworm nucleoid virus according to the present invention;

[0032] Figure 2 This is the specific detection result of the complete set of reagents used in this invention to detect silkworm nucleoid virus;

[0033] Figure 3 The results show the sensitivity of the complete set of reagents used in this invention for detecting silkworm nucleoid virus.

[0034] Figure 4 To detect the amplification curve of BmBDV using a complete set of reagents;

[0035] Figure 5 The standard curve for detecting BmBDV using a complete set of reagents. Detailed Implementation

[0036] The principles and features of this invention are described below. The examples given are for illustrative purposes only and are not intended to limit the scope of the invention. Unless otherwise specified in the examples, conventional conditions or conditions recommended by the manufacturer should be followed. Reagents or instruments whose manufacturers are not specified are all commercially available products.

[0037] Example 1:

[0038] A complete set of reagents for detecting silkworm cysticercosis virus, comprising the primer pairs and / or the probes described above for detecting silkworm cysticercosis virus.

[0039] The primer pair used to detect silkworm nucleovirus has the following nucleotide sequence: upstream primer CTACGGGAGGCTTGTTGGTT; downstream primer ACTTTACCATTTGGTTATAAGGGTG.

[0040] The probe used to detect silkworm nucleovirus has a nucleotide sequence of 5'-TCAATTACAACATCATCCA-3'; the 5' end of the probe is labeled with a FAM fluorescent group, and the 3' end is labeled with a non-fluorescent quencher group NFQ-MGB.

[0041] The preparation method of the above-mentioned complete set of reagents for detecting silkworm nucleoid virus includes the following steps:

[0042] S1. Mix 20 g Pluronic F127, 5 g trehalose and DEPC water pre-cooled to 4 ℃, vortex or shake vigorously, let stand at 4 ℃ overnight until the solution is clear, and add pre-cooled DEPC water to make up to 100 mL to obtain the buffer solution.

[0043] S2. Dilute the upstream primer of the pre-cooled primer pair with buffer, aliquot it into the bottom of a PCR tube, and incubate at room temperature for 5-10 minutes to solidify into a transparent gel. Allow it to air dry at room temperature. Then, repeat the above steps to aliquot the downstream primer and probe sequentially, ensuring that each PCR tube contains complete primer (400 nM) and probe (200 nM) sequences to obtain a complete reagent kit. Figure 1 As shown.

[0044] The primer pairs and probes described above were designed using conventional methods based on the BmBDV genome sequence indexed in GenBank. The template sequences used to design the primers spanned both structural and non-structural protein coding regions. Conserved regions were selected to synthesize the pUC57-NSP plasmid standard.

[0045] Example 2:

[0046] A method for detecting silkworm nucleovirus using the above-mentioned complete reagent kit includes the following steps:

[0047] (1) Extract the genome of the midgut and body wall tissue of the silkworm to be tested as a template;

[0048] (2) Prepare the reaction system in the PCR tube of the complete set of reagents; the reaction system contains 12.5 µL of Reaction Mix (2×), 0.5 µL of Taq Mix, 0.1 µL of ROX Reference Dye, 2 µL of template, and add ddH2O to make up to 25 µL;

[0049] (3) Place the reaction system in a real-time quantitative PCR instrument and perform real-time quantitative PCR reaction to collect fluorescence signals; the PCR reaction program is 4 ℃ 2 min; 50 ℃ 15 min; 95 ℃ 2 min; 95 ℃ 15 s, 60 ℃ 45 s, 40 cycles;

[0050] (4) If an amplification curve appears in the reaction system, the sample to be tested contains the pathogen corresponding to the amplification curve; if there is no amplification curve in the reaction system, the sample to be tested does not contain the corresponding pathogen.

[0051] Example 3:

[0052] The pUC57-pk1 plasmid (sequence from BmNPV), pUC57-arif1 plasmid (sequence from BmNPV), pMD19-T-VP1 plasmid (sequence from BmCPV), pMD19-T-RDRP plasmid (sequence from BmIFV), and double-distilled water were used as specific detection templates. The pUC57-NSP plasmid was used as a positive control. Real-time quantitative PCR was used for amplification, and the specificity of the reagent kit was evaluated based on the results; the results are as follows. Figure 2As shown.

[0053] Depend on Figure 2 It can be seen that, except for pUC57-NSP, no typical positive amplification curves appeared in the other reaction systems, indicating that the complete set of reagents for detecting BmBDV in Example 1 did not react with other plasmids used as templates, and has good specificity.

[0054] Example 4:

[0055] The pUC57-NSP plasmid standard was serially diluted 10-fold, from 1×10⁻⁶. 3 copies / μL-1×10 0 The kit was divided into four dilutions (copies / μL) and used as templates for real-time quantitative PCR. The lowest detection limit of this reagent kit was determined based on the experimental results. The results are as follows: Figure 3 As shown.

[0056] Depend on Figure 3 It can be seen that the lowest detection limit in the real-time quantitative PCR system can reach 1×10⁻⁶. 1 The results show that the reagent kit has high sensitivity even in competitive and inhibitory reaction systems.

[0057] Example 5:

[0058] With 10 8 copies / μL-10 4 Using standard plasmids at five concentration gradients (copies / μL) as templates, a standard curve for real-time quantitative PCR was established, and the correlation coefficient R was calculated. 2 Amplification efficiency (E value) and standard equation. Standard curve ( Figure 4 and Figure 5 The results show that: Y = -3.259 × X + 46.78, R 2 =0.999, E=102%. This indicates that the correlation coefficient of the real-time quantitative PCR system is good and the amplification efficiency is high.

[0059] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of the present invention should be included within the protection scope of the present invention.

Claims

1. A primer pair for detecting silkworm nucleovirus, characterized in that, The nucleotide sequence of the upstream primer of the primer pair is CTACGGGAGGCTTGTTGGTT; the nucleotide sequence of the downstream primer is ACTTTACCATTTGGTTATAAGGGTG.

2. A probe for detecting silkworm nucleovirus, characterized in that, The nucleotide sequence of the probe is 5'-TCAATTACAACATCATCCA-3'; The probe is labeled with a FAM fluorescent group at its 5' end and a non-fluorescent quencher group NFQ-MGB at its 3' end.

3. The use of the primer pair for detecting silkworm blastocystis virus as described in claim 1 or the probe for detecting silkworm blastocystis virus as described in claim 2 in the preparation of a complete set of reagents or kits for detecting silkworm blastocystis virus.

4. A complete set of reagents for detecting silkworm nucleoid virus, characterized in that, This includes the primer pair for detecting silkworm cysticercosis virus as described in claim 1 and / or the probe for detecting silkworm cysticercosis virus as described in claim 2.

5. The method for preparing the complete set of reagents for detecting silkworm nucleoid virus as described in claim 4, characterized in that, Includes the following steps: S1. Mix and disperse Pluronic F127, trehalose and DEPC water evenly, let stand overnight until the solution is clear, and add DEPC water to make up to 100 mL to obtain the buffer solution; S2. Dilute the upstream primer of the primer pair with buffer, aliquot it into the bottom of a PCR tube, transfer it to room temperature and let it stand for 5-10 minutes to solidify into a transparent gel. Allow it to air dry at room temperature, and then repeat the above steps to aliquot the downstream primer and probe to obtain a complete set of reagents.

6. The method for preparing a complete set of reagents for detecting silkworm nucleoid virus as described in claim 5, characterized in that, In step S1, the mass ratio of Pluronic F127 to trehalose is 15-25:

5.

7. The method for preparing a complete set of reagents for detecting silkworm nucleoid virus as described in claim 5, characterized in that, In step S2, the nucleotide sequence of the upstream primer of the primer pair is TATACCTGGGCACACTTGCG; the nucleotide sequence of the downstream primer is CCTCGCTCTCTTAGGCGTTC; and the nucleotide sequence of the probe is 5'-TAGTCAGCTAGTAGCGCA-3'. The 5' end of the probe is labeled with a FAM fluorescent group, and the 3' end is labeled with a non-fluorescent quencher group NFQ-MGB.

8. A method for detecting silkworm nucleoid virus using the complete set of reagents described in claim 4, characterized in that, Includes the following steps: (1) Extract the genome of the midgut and body wall tissue of the silkworm to be tested as a template; (2) Prepare the reaction system in the PCR tubes containing the complete set of reagents; (3) Place the reaction system in a real-time quantitative PCR instrument to perform the real-time quantitative PCR reaction and collect the fluorescence signal; (4) If an amplification curve appears in the reaction system, the sample to be tested contains the pathogen corresponding to the amplification curve; if there is no amplification curve in the reaction system, the sample to be tested does not contain the corresponding pathogen.

9. The method for detecting silkworm nucleoid virus using a complete set of reagents as described in claim 8, characterized in that, In step (2), the volume ratio of Reaction Mix (2×), Taq Mix, ROX Reference Dye and template in the reaction system is 12.5:0.5:0.1:

2.

10. The method for detecting silkworm nucleoid virus using a complete set of reagents as described in claim 8, characterized in that, In step (3), the PCR reaction program is 4 ℃ for 2 min; 50 ℃ for 15 min; 95 ℃ for 2 min; 95 ℃ for 15 s, 60 ℃ for 45 s, for 40 cycles.

Images