Anti-complement protein C5 antibody or antigen binding fragment thereof and application thereof

By developing antibodies or antigen-binding fragments that specifically bind to human complement protein C5, the problem of poor efficacy of existing drugs targeting complement C5 has been solved, achieving highly efficient blocking of the complement cascade reaction and low immunogenicity.

CN121591871APending Publication Date: 2026-03-03QUAERITE BIOPHARM RESEARCH (BEIJING) CO LTD
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202511759251.2
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Priority Date
2024-11-28
Filing Date
2025-11-26
Publication Date
2026-03-03

AI Technical Summary

Technical Problem

The lack of effective drugs targeting complement C5 in current technologies makes it difficult to effectively inhibit the excessive or uncontrolled activation of the complement cascade, resulting in unmet pathogenesis mechanisms for various diseases.

Method used

Anti-human C5 protein single-domain antibodies were generated by immunizing alpacas. Using chemical cross-linking mass spectrometry and molecular dynamics simulation, antibodies or antigen-binding fragments that specifically bind to human complement protein C5 were obtained. These fragments are mainly distributed in the MG6α, MG7, CUBf, TED, and C345C domains, exhibiting high affinity and strong complement inhibitory activity. They also have small molecular weights and are easy to fuse with other targets.

Benefits of technology

It achieves high affinity binding to the C5 target, effectively blocking the complement cascade reaction, providing a low-immunogenic treatment option, and is suitable for a variety of diseases related to complement activation.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121591871A_ABST
    Figure CN121591871A_ABST
Patent Text Reader

Abstract

The invention provides an antibody specifically binding to complement protein C5 or an antigen binding fragment of the antibody, and a humanized anti-complement protein C5 antibody or an antigen binding fragment of the humanized anti-complement protein C5 antibody. Compositions comprising the antibodies or antigen binding fragments and uses thereof. A series of anti-complement protein C5 antibodies or antigen binding fragments thereof provided by the invention have epitope diversity, epitopes binding to human complement protein C5 are mainly distributed in MG6alpha, MG7, CUBf, TED and C345C structural domains, and the anti-complement protein C5 antibodies or antigen binding fragments thereof are small in molecular weight, high in affinity with complement protein C5 and strong in complement inhibition activity, and can be used for preparing anti-complement protein C5 antibodies or antigen binding fragments thereof. C5 cleavage and complement cascade reaction activation can be effectively blocked, and the compound can be potentially applied to treatment of diseases related to complement activation.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of biomedical technology, specifically to an anti-complement protein C5 antibody or its antigen-binding fragment and its applications. Background Technology

[0002] The complement cascade is a highly interacting network of proteins activated by three pathways: the classical pathway (CP), the lectin-pathway (LP), and the alternative pathway (AP). Complement protein C5 is a major component of the complement cascade, with a molecular weight of 190 kDa. Under normal physiological conditions, its concentration in human serum is approximately 80–100 µg / mL. In the terminal effect of the complement cascade, C5 is specifically cleaved by C5 convertases via either the alternative or classical / lectin pathway, producing C5a and C5b. C5b subsequently binds to C6 and C7 proteins, forming the C5bC6C7 complex, which can integrate into the phospholipid membrane and then bind to C8 protein to form a transmembrane channel. The C5bC6C7C8 complex can trigger the cyclic polymerization of C9 protein, forming the membrane attack complex (MAC), thereby mediating the lysis of target cells. C5a, with a molecular weight of approximately 11 kDa, is an anaphylatoxin that can trigger mast cell degranulation, releasing histamine and other inflammatory mediators, leading to smooth muscle contraction, increased vascular permeability, and leukocyte activation. C5a also has chemotactic effects, causing granulocytes (such as neutrophils, eosinophils, basophils, and monocytes) to migrate to areas with high C5a concentration gradients.

[0003] While a properly functioning complement system provides a robust defense against infectious microorganisms, inappropriate regulation or activation of complement is associated with the pathogenesis of a variety of diseases, including, for example, rheumatoid arthritis; lupus nephritis; immunoglobulin A nephropathy; ischemia-reperfusion injury; paroxysmal nocturnal hemoglobinuria; atypical hemolytic uremic syndrome; dense deposition disease; age-related macular degeneration; hemolysis, elevated liver enzymes, and low platelet count syndrome; thrombotic thrombocytopenic purpura; spontaneous abortion; oligoimmune vasculitis; bullous epidermolysis; recurrent miscarriage; multiple sclerosis; traumatic brain injury; and damage resulting from myocardial infarction, cardiopulmonary bypass, and hemodialysis. Therefore, inhibiting excessive or uncontrolled activation of the complement cascade can provide clinical benefit to patients with these conditions.

[0004] Currently, the complement C5 inhibitors approved by the FDA include eculizumab (trade name: SOLIRIS). ® ), ravulizumab-cwvz (product name: ULTOMIRIS)® These include avacincaptad pegol (trade name: IZERVAY™), pozelimab-bbfg (trade name: Veopoz™), and crovalimab-akkz (trade name: Piasky). Except for avacincaptad pegol, all other marketed complement inhibitors are full-length IgG antibodies.

[0005] To improve the inhibition of complement activation, existing technologies commonly employ methods such as developing novel nucleic acid or antibody drugs targeting C5 to block and inhibit complement activation; however, clinical benefits are limited. Therefore, there remains an unmet need in this field for drugs that target complement C5 with ideal efficacy. Summary of the Invention

[0006] To overcome the shortcomings of existing technologies, this application provides a novel antibody or antigen-binding fragment thereof that specifically binds to complement protein C5. The inventors of this invention used human C5 protein as an immunogen to immunize alpacas to generate anti-complement protein C5 single-domain antibodies. Peripheral blood mononuclear cells were isolated and used to establish, pan, and screen a phage display library of anti-human C5 protein single-domain antibodies, thereby obtaining a novel antibody or antigen-binding fragment thereof that specifically binds to human complement protein C5. Through chemical cross-linking mass spectrometry combined with molecular dynamics simulations, the series of anti-complement protein C5 antibodies of this invention exhibit epitope diversity, with the epitopes binding to human complement protein C5 mainly distributed in MG6α, MG7, and CUB. f The present invention contains the TED and C345C domains. Through binding characteristic tests and classical pathway hemolysis inhibition activity tests, the anti-complement protein C5 antibody or its antigen-binding fragment of the present invention has the following characteristics: (1) high affinity for C5 target antigen; (2) strong complement inhibition activity, which can effectively block the cleavage of C5 and the activation of complement cascade reaction; (3) small molecular weight, and under the same mass, single-domain antibody has a higher molar concentration and can bind more antigen molecules; (4) simple structure, which makes it easy to fuse with other target antibodies or their antigen-binding fragments, receptor domains or other functional components or compounds to form fusion constructs, and can be potentially applied to the treatment of diseases related to complement activation. At the same time, the inventors of the present invention have also obtained new, humanized anti-complement protein C5 antibodies by humanization based on the variable region sequence of the antibody or its antigen-binding fragment that specifically binds to complement protein C5, providing a choice of low immunogenic antibodies for the treatment of corresponding diseases.

[0007] In a first aspect, the present invention provides an antigenic epitope peptide of complement protein C5, said antigenic epitope peptide comprising an MG7 domain, a C345C domain, an MG6α domain, a TED domain, and / or a CUB domain derived from complement protein C5 antigen.f Antigenic epitope peptides with structural domains.

[0008] Preferably, the MG7 structural domain is as shown in SEQ ID NO: 119, the C345C structural domain is as shown in SEQ ID NO: 120, the MG6α structural domain is as shown in SEQ ID NO: 121, the TED structural domain is as shown in SEQ ID NO: 122, and the CUB... f The structural domain is shown in SEQ ID NO: 123.

[0009] Preferably, the length of the antigenic epitope peptide is 4-15 aa (e.g., 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15 aa).

[0010] Preferably, the antigenic epitope peptide comprises any of the amino acid sequences shown in SEQ ID NO: 58-68.

[0011] In a second aspect, the present invention provides a mimic of complement protein C5 antigen, the mimic comprising the antigenic epitope peptide described above.

[0012] Preferably, the complement protein C5 antigen mimic is not the full-length sequence of the complement protein C5 antigen.

[0013] In a third aspect, the present invention provides a fusion protein comprising the above-described antigenic epitope peptide and / or the above-described mimic.

[0014] A fourth aspect of the present invention provides a biomaterial comprising: 1) Genes encoding the above-mentioned antigenic epitope peptides, the above-mentioned mimics, and / or the above-mentioned fusion proteins; 2) A vector containing the gene from 1); 3) Host cells containing the gene in 1) and / or the vector in 2).

[0015] In a fifth aspect, the present invention provides an antigen-presenting cell comprising the above-described antigenic epitope peptide, the above-described mimic, the above-described fusion protein, the above-described gene, and / or the above-described vector.

[0016] A sixth aspect of the present invention provides applications of the above-described antigenic epitope peptide, the above-described mimic, the above-described fusion protein, the above-described biomaterial, and the above-described antigen-presenting cells, said applications including: 1) Use in screening, detecting, preparing and / or purifying anti-complement protein C5 antibodies or their antigen-binding fragments; 2) Use in the preparation of antigen-antibody complexes, wherein the antigen-antibody complexes comprise: 2-1) The complement protein C5 antigenic epitope peptide described above, the mimic described above, or the fusion protein described above, and, 2-2) Antibody against complement protein C5 or its antigen-binding fragment; 3) Use in the preparation and screening of medicaments (preferably vaccines) and / or diagnostic reagents for the treatment and / or prevention of complement protein C5 antigen-related diseases.

[0017] In a seventh aspect, the present invention provides an anticomplement protein C5 antibody or an antigen-binding fragment thereof, wherein the anticomplement protein C5 antibody or the antigen-binding fragment thereof is capable of binding the aforementioned antigenic epitope peptide and / or the aforementioned mimicry.

[0018] In an eighth aspect, the present invention provides an anti-complement protein C5 antibody or an antigen-binding fragment thereof, said anti-complement protein C5 antibody or antigen-binding fragment thereof comprising CDR-H1, CDR-H2 and CDR-H3 of the heavy chain variable region.

[0019] The amino acid sequence of CDR-H1 includes any of the amino acid sequences shown in IDTWG (SEQ ID NO: 23), NYNMA (SEQ ID NO: 29), or X1X2X3MG (SEQ ID NO: 118), or an amino acid sequence that has at least 80% identity with any of the amino acid sequences shown in IDTWG (SEQ ID NO: 23), NYNMA (SEQ ID NO: 29), or X1X2X3MG (SEQ ID NO: 118); The amino acid sequence of CDR-H2 includes any of the amino acid sequences shown in SEQ ID NO: 34-43, or an amino acid sequence that has at least 80% identity with any of the amino acid sequences shown in SEQ ID NO: 34-43. The amino acid sequence of CDR-H3 includes any of the amino acid sequences shown in SEQ ID NO: 45-48, 50-52, 54, RGYDX4TNYPPQPLDS (SEQ ID NO: 44), SRRANFRX5FX6SWDY (SEQ ID NO: 55), or an amino acid sequence that has at least 80% identity with any of the amino acid sequences shown in SEQ ID NO: 45-48, 50-52, 54, RGYDX4TNYPPQPLDS (SEQ ID NO: 44), SRRANFRX5FX6SWDY (SEQ ID NO: 55).

[0020] In SEQ ID NO: 118, SEQ ID NO: 44, and SEQ ID NO: 55, X can be any natural amino acid residue, such as alanine (A), arginine (R), asparagine (N), aspartic acid (D), cysteine ​​(C), glutamine (Q), glutamic acid (E), glycine (G), histidine (H), isoleucine (I), leucine (L), lysine (K), methionine (M), phenylalanine (F), threonine (T), proline (P), serine (S), tryptophan (W), tyrosine (Y), and valine (V).

[0021] In one specific embodiment of the present invention, X1 in SEQ ID NO: 118 represents I, D, N, S or L; X2 represents Y, T, V or D; X3 represents T, A, V, I, N or Q; In SEQ ID NO: 44, X4 represents G or S; In SEQ ID NO: 55, X5 represents N or Q, and X6 represents S or A.

[0022] Preferably, the CDR-H1 comprises any of the amino acid sequences shown in SEQ ID NO: 23-32 or an amino acid sequence having at least 80% identity with any of the amino acid sequences shown in SEQ ID NO: 23-32.

[0023] Preferably, the CDR-H3 comprises any of the amino acid sequences shown in SEQ ID NO: 45-54, 117, 22-33 or an amino acid sequence having at least 80% identity with any of the amino acid sequences shown in SEQ ID NO: 45-54, 117, 22-33.

[0024] In one specific embodiment of the present invention, the amino acid sequences of CDR-H1, CDR-H2, and CDR-H3 comprise any of the following groups (see Table 1 for details): A) SEQ ID NO: 23, 34, 45; B) SEQ ID NO: 24, 35, 46; C) SEQ ID NO: 25, 36, 47; D) SEQ ID NO: 26, 37, 48; E) SEQ ID NO: 27, 38, 49; F) SEQ ID NO: 28, 39, 50; G) SEQ ID NO: 29, 40, 51; H) SEQ ID NO: 30, 41, 52; I) SEQ ID NO: 31, 42, 53; J) SEQ ID NO: 32, 43, 54; K) SEQ ID NO: 31, 42, 117; L) SEQ ID NO: 27, 38, 22; M) SEQ ID NO: 27, 38, 33.

[0025] Table 1. Amino acid sequences of CDR-H1, CDR-H2, and CDR-H3 antibodies against complement protein C5.

[0026] Preferably, the amino acid sequences of CDR-H1, CDR-H2, and CDR-H3 are arranged in order from the N-terminus to the C-terminus. In this application, the amino acid division of the antibody CDR region adopts the Kabat numbering system.

[0027] The structure of the anti-complement protein C5 antibody or its antigen-binding fragment includes single-domain antibodies, chimeric antibodies, Fab fragments, Fab' fragments, Fd fragments, Fv fragments, dAb fragments, F(ab')2 fragments, single-chain antibody fragments (scFv), or linear antibodies.

[0028] The anti-complement protein C5 antibody or its antigen-binding fragment can be a single-domain antibody.

[0029] Preferably, the single-domain antibody includes a nanobody.

[0030] The anti-complement protein C5 antibody or its antigen-binding fragment can be a humanized antibody.

[0031] Preferably, the anti-complement protein C5 antibody or its antigen-binding fragment includes a humanized sequence; more preferably, the humanized modification site is located in the frame region and / or CDR region of the antibody.

[0032] In one specific embodiment of the present invention, the anti-complement protein C5 antibody or its antigen-binding fragment is a single-domain antibody. Compared with full-length IgG antibody, Fab, and scFv, single-domain antibodies have a higher molar concentration at the same mass and can bind more antigen molecules.

[0033] Preferably, the amino acid sequence of the anti-complement protein C5 antibody or its antigen-binding fragment comprises any one of the amino acid sequences in SEQ ID NO: 12-21, 75-95, 124-127, or has at least 80% identity with any one of the amino acid sequences in SEQ ID NO: 12-21, 75-95, 124-127.

[0034] In one specific embodiment of the present invention, the amino acid sequence of the anti-complement protein C5 antibody or its antigen-binding fragment is shown in any one of SEQ ID NO: 12-21, 75-95, 124-127.

[0035] The anti-complement protein C5 antibody or its antigen-binding fragment can be obtained using existing conventional techniques, such as expression in eukaryotic or prokaryotic systems.

[0036] A ninth aspect of the present invention provides an application of the above-described anti-complement protein C5 antibody or its antigen-binding fragment thereof, the application comprising: A. Application in the preparation of fusion constructs, wherein the fusion constructs include the above-mentioned anti-complement protein C5 antibody or its antigen-binding fragment and other bioactive effector molecules, wherein the other bioactive effector molecules include antibodies or their antigen-binding fragments, receptor domains or other functional components targeting other targets besides any of the above-mentioned anti-complement protein C5 antibodies or their antigen-binding fragments; Application of B in the detection of complement C5.

[0037] Preferably, the other functional components include, but are not limited to, one or more of the following: serum albumin, cytokines, transferrin, scaffold protein, oligopeptide, oligopeptide polymer, polypeptide, polypeptide polymer, polysaccharide, fatty acid chain, avidin, biotin, streptavidin, toxin, drug, nucleic acid, radionuclide and its marker, PEGylated component, complement factor or Fc fragment. More preferably, the complement factors include complement factor FH, complement factor FI, complement attenuation accelerator factor CD55, membrane cofactor MCP, complement regulatory protein CD59, C4b binding protein C4BP, or C1 inhibitor C1INH. Preferably, the receptor domain includes complement receptor CR1, complement receptor CR2, complement receptor CR3, complement receptor CR4, or immunoglobulin family complement receptor CRIg.

[0038] Preferably, the other targets are selected from VEGFA, VEGFB, VEGFC, VEGFD, VEGFR, FGF, FGFR, PlGF, PDGF, ANG2, TGF, Integrin, Integrin receptor, interleukins (such as IL-1β, IL-2, IL-3, IL-4, IL-6, IL-10, IL-12, IL-15, IL-17, IL-23, etc.), and interleukin receptors (such as IL1R1, IL2Rα, IL3R, etc.). IL4Rα, IL6R, IL10R, IL12R, IL15Rα, IL17R, IL23R, etc.), PCSK9, TNF-α, TNFR, RANKL, complement protein C3, complement protein C3b, complement factor FB, complement factor FD, complement factor FP, complement protein C1q, complement protein C1s, complement protein C4b, complement protein C2, complement protein MASP2, complement protein MASP3, complement receptor C3aR, complement receptor C5aR1, complement receptor C5aR2. GPCR, GLP1R, CD3, CD105, CD19, CD20, CD22, CD25, CD27, CD28, CD30, CD33, CD38, CD40, CD47, CD80, CD86, CD96, CD99, CD111, CD112, CD123, CD133, CD138, CD155, CD171, Claudin18.2, OX40, ICOS, CTLA4, 4-1BB, TCR, BTLA, TI M-3, LAG3, Galectin-9, PD-L1, PD-L2, PD-1, TIGIT, EGFR, Her2, PSCA, CEA, FAP, EGFRVIII, BCMA, PSMA, CA125, EphA2, C-met, L1CAM, CS1, ROR1, recombinant Mycobacterium tuberculosis fusion protein, NY-ESO-1, MUC1, MUC16, mesothelin, LewisY, GPC3, GD2, EPG, DLL3 or 5T4.

[0039] In a tenth aspect, the present invention provides a fusion construct comprising the above-described anti-complement protein C5 antibody or its antigen-binding fragment.

[0040] Preferably, the fusion construct further comprises other bioactive effector molecules, including antibodies or antigen-binding fragments of other targets besides the aforementioned anti-complement protein C5 antibody or its antigen-binding fragment, receptor domains, or other functional components.

[0041] Preferably, the functional components include, but are not limited to, one or more of the following: serum albumin, cytokines, transferrin, scaffold proteins, oligopeptides, oligopeptide polymers, polypeptides, polypeptide polymers, polysaccharides, fatty acid chains, avidin, biotin, streptavidin, toxins, drugs, nucleic acids, radionuclides and their markers, PEGylated components, complement factors, or Fc fragments.

[0042] More preferably, the complement factors include complement factor FH, complement factor FI, complement attenuation accelerator factor CD55, membrane cofactor MCP, complement regulatory protein CD59, C4b binding protein C4BP, or C1 inhibitor C1INH.

[0043] Preferably, the receptor domain includes complement receptor CR1, complement receptor CR2, complement receptor CR3, complement receptor CR4, or immunoglobulin family complement receptor CRIg.

[0044] Preferably, the other targets are selected from VEGFA, VEGFB, VEGFC, VEGFD, VEGFR, FGF, FGFR, PIGF, PDGF, ANG2, TGF, Integrin, Integrin receptor, interleukins (such as IL-1β, IL-2, IL-3, IL-4, IL-6, IL-10, IL-12, IL-15, IL-17, IL-23, etc.), and interleukin receptors (such as IL1R1, IL2Rα, IL3R, etc.). IL4Rα, IL6R, IL10R, IL12R, IL15Rα, IL17R, IL23R, etc.), PCSK9, TNF-α, TNFR, RANKL, complement protein C3, complement protein C3b, complement factor FB, complement factor FD, complement factor FP, complement protein C1q, complement protein C1s, complement protein C4b, complement protein C2, complement protein MASP2, complement protein MASP3, complement receptor C3aR, complement receptor C5aR1, complement receptor C5aR2. GPCR, GLP1R, CD3, CD105, CD19, CD20, CD22, CD25, CD27, CD28, CD30, CD33, CD38, CD40, CD47, CD80, CD86, CD96, CD99, CD111, CD112, CD123, CD133, CD138, CD155, CD171, Claudin18.2, OX40, ICOS, CTLA4, 4-1BB, TCR, BTLA, TI M-3, LAG3, Galectin-9, PD-L1, PD-L2, PD-1, TIGIT, EGFR, Her2, PSCA, CEA, FAP, EGFRVIII, BCMA, PSMA, CA125, EphA2, C-met, L1CAM, CS1, ROR1, recombinant Mycobacterium tuberculosis fusion protein, NY-ESO-1, MUC1, MUC16, mesothelin, LewisY, GPC3, GD2, EPG, DLL3 or 5T4.

[0045] The structure of the antibody or its antigen-binding fragment is a single-domain antibody, a chimeric antibody, a Fab fragment, a Fab' fragment, an Fd fragment, an Fv fragment, a dAb fragment, an F(ab')2 fragment, a single-chain antibody, or a linear antibody.

[0046] Preferably, the fusion construct comprises one or more anti-complement protein C5 antibodies or antigen-binding fragments thereof, wherein the plurality may be the same or different anti-complement protein C5 antibodies or antigen-binding fragments thereof.

[0047] Preferably, the fusion construct contains one or more other bioactive molecules, which may be the same or different bioactive molecules.

[0048] The anti-complement protein C5 antibody or its antigen-binding fragment is directly or indirectly linked to other biological effector molecules.

[0049] Preferably, the indirect connection can be a connection via a connector, a functional structural domain, and / or a connector sub-connector for coupling.

[0050] The connector is selected from linker peptides, oligopeptides, oligopeptide polymers, polypeptides, polypeptide polymers, PEG, nucleic acids, polysaccharides, fatty acid chains, biotin, streptavidin, or avidin.

[0051] The functional domain is one or more of the following: Fc fragment, serum albumin, cytokines, transferrin, or scaffold protein.

[0052] The connectors used for coupling include functional group connectors.

[0053] The functional linker includes reactive groups such as thiol, amino, hydroxyl, and / or carboxyl groups, which can covalently couple anticomplement protein C5 antibody or its antigen-binding fragment to a bioactive effector molecule.

[0054] Preferably, the direct or indirect connection includes direct or indirect connection to the N-terminus, C-terminus, and / or internal residues of the anti-complement protein C5 antibody or its antigen-binding fragment and / or other target antibodies or their antigen-binding fragments.

[0055] The connection sequence of the anti-complement protein C5 antibody or its antigen-binding fragment, and other target antibodies contained in the fusion construct can be such that the N-terminus, C-terminus, and / or internal residues of one antibody are linked to the N-terminus, C-terminus, and / or internal residues of another antibody.

[0056] Preferably, the fusion construct also includes tags.

[0057] Preferably, the label is attached to the C-end of the fusion construct.

[0058] In an eleventh aspect, the present invention provides a nucleic acid encoding the aforementioned antibody or antigen-binding fragment or the aforementioned fusion construct. For example, the nucleic acid comprises DNA and / or mRNA.

[0059] In some embodiments, the nucleic acid is DNA, which encodes the antibody or antigen-binding fragment or the fusion construct described above.

[0060] Preferably, the nucleotide sequence encoding the anti-complement protein C5 antibody or its antigen-binding fragment comprises any nucleotide sequence or its degenerate sequence in SEQ ID NO: 1-10, 96-116, 128-130, 11, or has at least 80% identity with any nucleotide sequence in SEQ ID NO: 1-10, 96-116, 128-130, 11, and has the function of encoding the anti-complement protein C5 antibody or its antigen-binding fragment.

[0061] In a twelfth aspect, the present invention provides a carrier comprising the above-described nucleic acid.

[0062] The vector described can be expressed in prokaryotic or eukaryotic cells.

[0063] For example, expression vectors can be introduced into host cells through transient or stable transfection.

[0064] Preferably, the vector includes pcDNA3.1, PKS001, or PCMV3.

[0065] In a thirteenth aspect, the present invention provides a host cell comprising the aforementioned nucleic acid or the aforementioned vector.

[0066] The host cell can be a eukaryotic cell or a prokaryotic cell.

[0067] Eukaryotic cells include animal and plant cells, such as T cells, yeast cells, HEK293 cells, or CHO cells, etc.

[0068] Prokaryotic cells, such as Escherichia coli.

[0069] In a fourteenth aspect, the present invention provides a method for preparing a host cell, the method comprising introducing the above-mentioned nucleic acid or vector into a host cell.

[0070] In a fifteenth aspect, the present invention provides a method for preparing an anti-complement protein C5 antibody or its antigen-binding fragment or fusion construct thereof, the method comprising culturing the host cells described above and expressing the anti-complement protein C5 antibody or its antigen-binding fragment or the fusion construct thereof.

[0071] A sixteenth aspect of the present invention provides a product for treating, preventing, and / or diagnosing diseases, said product comprising any of the following: A) The above-mentioned anti-complement protein C5 antibody or its antigen-binding fragment; B) The aforementioned fusion construct; C) The aforementioned nucleic acids; D) The aforementioned carrier; E) The aforementioned host cells; F) The aforementioned antigenic epitope peptides; G) The aforementioned analogue; H) The aforementioned fusion protein; I) The aforementioned biological materials; or, J) The antigen-presenting cells mentioned above.

[0072] Preferably, the product may be a diagnostic kit, a drug, or a diagnostic chip, etc.

[0073] The diseases described are those related to complement activation. Further preferred examples include rheumatoid arthritis; lupus nephritis; immunoglobulin A nephropathy; ischemia-reperfusion injury; paroxysmal nocturnal hemoglobinuria; atypical hemolytic uremic syndrome; dense deposition disease; age-related macular degeneration; geographic atrophy; hemolysis, elevated liver enzymes, and low platelet count syndrome; thrombotic thrombocytopenic purpura; spontaneous abortion; oligoimmune vasculitis; bullous epidermolysis; recurrent miscarriage; multiple sclerosis; traumatic brain injury; and injuries caused by myocardial infarction, cardiopulmonary bypass, and hemodialysis, CD55-deficient protein-losing enteropathy, etc.

[0074] In a seventeenth aspect of the invention, the use of A)-J) above in the preparation and screening of products for the treatment and / or prevention of diseases related to complement activation, or in the preparation and screening of diagnostic products or tracers for diseases related to complement activation.

[0075] The diseases mentioned can include rheumatoid arthritis; lupus nephritis; immunoglobulin A nephropathy; ischemia-reperfusion injury; paroxysmal nocturnal hemoglobinuria; atypical hemolytic uremic syndrome; dense deposition disease; age-related macular degeneration; geographic atrophy; hemolysis, elevated liver enzymes and low platelet syndrome; thrombotic thrombocytopenic purpura; spontaneous abortion; oligoimmune vasculitis; bullous epidermolysis; recurrent miscarriage; multiple sclerosis; traumatic brain injury; and damage caused by myocardial infarction, cardiopulmonary bypass and hemodialysis; CD55-deficient protein loss enteropathy, etc.

[0076] The products mentioned can be drugs or vaccines, etc.

[0077] The diagnostic product may be a diagnostic kit or a diagnostic chip.

[0078] Preferably, any of the above products can be screening, detection, diagnosis, purification, tracing, treatment and / or prevention products.

[0079] In an eighteenth aspect, the present invention provides a method for detecting complement protein C5, the method comprising binding a sample to be tested with the aforementioned anti-complement protein C5 antibody or its antigen-binding fragment, and then detecting the content of the complex formed by complement protein C5 and the anti-complement protein C5 antibody or its antigen-binding fragment.

[0080] The detection method described herein is to detect the presence or content of complement protein C5. Here, "presence" refers to a qualitative analysis indicating its presence or absence, and "content" can refer to expression level or protein concentration, etc.

[0081] In a nineteenth aspect of the present invention, a method for diagnosing a disease is provided, the method comprising taking a sample, combining the sample with the diagnostic product for the disease described above (A)-J) or the disease described above, and detecting the content of a complex formed by complement protein C5 and an anti-complement protein C5 antibody or an antigen-binding fragment thereof.

[0082] The diseases described are those related to complement activation. Further preferred examples include rheumatoid arthritis; lupus nephritis; immunoglobulin A nephropathy; ischemia-reperfusion injury; paroxysmal nocturnal hemoglobinuria; atypical hemolytic uremic syndrome; dense deposition disease; age-related macular degeneration; geographic atrophy; hemolysis, elevated liver enzymes, and low platelet count syndrome; thrombotic thrombocytopenic purpura; spontaneous abortion; oligoimmune vasculitis; bullous epidermolysis; recurrent miscarriage; multiple sclerosis; traumatic brain injury; and damage caused by myocardial infarction, cardiopulmonary bypass, and hemodialysis; CD55-deficient protein-losing enteropathy, etc.

[0083] A twentieth aspect of the present invention provides a method for treating and / or preventing a disease, the method comprising applying to an individual the above-described A)-J) or the above-described product for treating and / or preventing a disease.

[0084] The diseases described are those related to complement activation. Further preferred examples include rheumatoid arthritis; lupus nephritis; immunoglobulin A nephropathy; ischemia-reperfusion injury; paroxysmal nocturnal hemoglobinuria; atypical hemolytic uremic syndrome; dense deposition disease; age-related macular degeneration; geographic atrophy; hemolysis, elevated liver enzymes, and low platelet count syndrome; thrombotic thrombocytopenic purpura; spontaneous abortion; oligoimmune vasculitis; bullous epidermolysis; recurrent miscarriage; multiple sclerosis; traumatic brain injury; and damage caused by myocardial infarction, cardiopulmonary bypass, and hemodialysis; CD55-deficient protein-losing enteropathy, etc.

[0085] This invention provides a novel anti-complement protein C5 antibody or its antigen-binding fragment, preferably a single-domain antibody, which has the potential to exhibit lower immunogenicity in the human body due to the inherent advantages of single-domain antibodies. The anti-complement protein C5 antibody or its antigen-binding fragment of this invention exhibits strong complement inhibitory activity. In hemolytic inhibition activity experiments, a series of single-domain antibodies were able to inhibit the complement cascade reaction activated by the classical pathway CP. Currently, FDA-approved complement C5 inhibitors are in IgG or PEGylated RNA molecular forms; no single-domain antibody form of complement protein C5 inhibitors is currently available for clinical use. This invention screens a series of anti-complement protein C5 single-domain antibodies with strong complement inhibitory activity. These single-domain antibodies can inhibit the cleavage of complement protein C5 by C5 convertase. Compared with PEGylated RNA and IgG forms, single-domain antibodies have smaller molecular weights, better water solubility, and simpler manufacturing processes. This invention has the potential to be applied to the treatment of diseases related to complement activation.

[0086] As used herein, the term "fusion construct" defines the fusion of an anti-complement protein C5 antibody or its antigen-binding fragment thereof with another compound. The fusion construct may comprise one or more anti-complement protein C5 antibodies or their antigen-binding fragments, which may be identical or different. The fusion construct may also comprise one or more other compounds, which may also be identical or different. The compounds may be protein compounds or non-protein compounds. When the compound is a protein compound or the fusion construct comprises only multiple anti-complement protein C5 antibodies or their antigen-binding fragments, the fusion construct may also be referred to as a fusion protein. When the compound is fused with an anti-complement protein C5 antibody or its antigen-binding fragment in a conjugated form, the fusion construct may also be referred to as a conjugate.

[0087] The "medicine" described in this invention can be used to treat humans or non-human animals, such as non-human mammals. The medicine may contain pharmaceutically acceptable carriers, excipients, or salts commonly found in the art.

[0088] The drug can be administered via any suitable route of administration, such as gastrointestinal (e.g., oral) or non-gastrointestinal (e.g., intravenous, intramuscular, subcutaneous, intradermal, intra-organ, intranasal, intraocular, intravenous, intracerebral, intrathecal, transdermal, rectal, etc.).

[0089] The drug can be in any suitable dosage form, such as a gastrointestinal or non-gastrointestinal dosage form, preferably including but not limited to tablets, pills, powders, granules, capsules, lozenges, syrups, liquids, emulsions, microemulsions, suspensions, injections, sprays, aerosols, powder inhalers, lotions, ointments, plasters, pastes, patches, eye drops, nasal drops, sublingual tablets, suppositories, aerosols, effervescent tablets, pellets, gels, etc. All dosage forms of the drug can be prepared according to conventional pharmaceutical manufacturing methods.

[0090] The drug may contain, by weight, 0.01-99.5% (specifically, 0.01%, 0.1%, 0.5%, 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 99%, 99.5%) of the anti-complement protein C5 antibody or its antigen-binding fragment or fusion construct, the nucleic acid, the vector, the host cell, etc.

[0091] The drug can be prepared as a reagent with a protein concentration of 1-300 mg / mL (e.g., 1, 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 105, 110, 115, 120, 130, 140, 150, 160, 170, 180, 190, 200, 210, 220, 230, 240, 250, 260, 270, 280, 290, 300 mg / mL).

[0092] The single-dose dosage of the drug can be 0.1-3000 mg, for example 0.1, 0.2, 0.5, 0.75, 1, 1.25, 1.5, 1.75, 2, 2.25, 2.5, 3, 5, 10, 20, 50, 80, 100, 150, 200, 250, 300, 350, 400, 450, 500, 550, 600, 650, 700, 750, 800, 850, 900, 950, 1000, 1500, 2000, 2500, 3000 mg.

[0093] The term "pharmaceutically acceptable" as used in this invention refers to the biological activity and characteristics of the active substances in the applied product that neither significantly stimulate the organism nor inhibit it.

[0094] The terms "method" or "application" used in this invention are interchangeable and can be used for the purpose of diagnosing, preventing, and / or treating diseases, or for the purpose of diagnosing, preventing, and treating non-diseases.

[0095] The “cell” involved in this invention includes cells that may or may not develop into individuals.

[0096] The "antigen-binding fragment" described in this invention is a portion of an antibody that retains the specific binding activity of the antibody; that is, any part of the antibody is capable of specifically binding to an epitope on the antibody's target molecule. It includes, for example, Fab, Fab', F(ab')2, Fv, Fd, and variants of these fragments. For example, the heavy and / or light chains of the antibody, the variable regions of the heavy and / or light chains of the antibody, or single or more CDRs from the heavy or light chains of the antibody. Single-domain antibodies are antibodies whose variable domain of heavy chain (VHH) has independent antigen-binding activity. Single-domain antibodies include nanobodies.

[0097] Chimeric antibodies are antibodies in which a portion of the heavy chain and / or light chain originates from a specific source or species, while the remainder of the heavy chain and / or light chain originates from different sources or species.

[0098] Single-chain antibodies are antibodies composed of variable regions of the heavy chain and light chain linked together by linkers.

[0099] Fab is a monovalent segment composed of VL, VH, CL and CH1 domains.

[0100] Fab' is a Fab fragment with one or more cysteine ​​residues at the C-terminus of the CH1 domain.

[0101] F(ab')2 is a divalent segment containing two Fab segments connected by disulfide bonds in the hinge region.

[0102] Fd is an Fd fragment composed of VH and CH1 domains.

[0103] Fv is a fragment composed of the VL and VH domains of the antibody single arm.

[0104] dAb fragments are antibody fragments composed of VH domains.

[0105] The "linear antibody" described in this invention comprises one or more pairs of antibody fragments tandemly connected together. The antibody fragments may be Fd segments (VH-CH1), single-chain antibodies (scFv), antibody fragments (Fab), or single-domain antibodies (VHH). These fragments are tandemly connected by linker peptides to form a continuous antibody structure.

[0106] Wherein, VH represents the variable region of the heavy chain, VL represents the variable region of the light chain, CH represents the constant region of the heavy chain, and CL represents the constant region of the light chain.

[0107] The term "comprising" or "including" as used in this invention is an open-ended expression. When used to describe the sequence of a protein or nucleic acid, the protein or nucleic acid may be composed of the sequence, or may have additional amino acids or nucleotides at one or both ends of the protein or nucleic acid, but still have the same or similar activity as the original sequence.

[0108] The "homology" or "identity" referred to in this invention means that, in the use of protein or nucleotide sequences, those skilled in the art can adjust the sequences according to actual work needs, so that the used sequences, compared with sequences obtained by existing technologies, have (including but not limited to) 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, 20%, 21%, 22%, 23%, 24%, 25%, 26%, 27%, 28%, 29%, 30%, 31%, 32%, 33%, 34%, 35%, 36%, 37%, and 38%. 39%, 40%, 41%, 42%, 43%, 44%, 45%, 46%, 47%, 48%, 49%, 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 70%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8%, 99.9% homology / identity.

[0109] The "humanized antibody" described in this invention refers to an antibody whose framework region or the entire antibody is encoded by a human antibody gene. In one specific embodiment of this invention, the CDR region of the antibody has not been modified.

[0110] The “PEGylated component” mentioned in this invention can be understood as the component formed after the other functional components mentioned above have been modified by PEGylation.

[0111] The "individual" referred to in this invention can be a human or a non-human mammal. The non-human mammal can be a wild animal, a zoo animal, an economic animal, a pet, a laboratory animal, etc. Preferably, the non-human mammal includes, but is not limited to, pigs, cattle, sheep, horses, donkeys, foxes, raccoon dogs, minks, camels, dogs, cats, rabbits, mice (e.g., rats, mice, guinea pigs, hamsters, gerbils, chinchillas, squirrels) or monkeys, etc.

[0112] The term "treatment" as used in this invention refers to slowing down, interrupting, preventing, controlling, stopping, reducing, or reversing a sign, symptom, disorder, condition, or progression or severity of a disease after it has begun to develop, but does not necessarily involve the complete elimination of all disease-related signs, symptoms, conditions, or disorders.

[0113] The term "prevention" as used in this invention refers to a method implemented to prevent or delay the occurrence of a disease, condition, or symptom in the body.

[0114] The term "diagnosis" as used in this invention refers to determining whether a patient has had a disease or condition in the past, at the time of diagnosis, or in the future, or determining the progression of a disease or its possible future progression. Attached Figure Description

[0115] The embodiments of the present invention will now be described in detail with reference to the accompanying drawings, wherein: Figure 1 This study demonstrated the classical complement inhibition activity of the anticomplement protein C5 nanobody.

[0116] Figure 2 The study demonstrated the inhibitory activity of the anti-complement protein C5 nanobody on C5a release.

[0117] Figure 3 The image shows the interaction between human complement protein C5 and anti-complement protein C5 nanobody NA008 (…). Figure 3 A), HA010 ( Figure 3 B), GA088 Figure 3 C), HA094 Figure 3 The molecular docking results of D) and the molecular dynamics simulation results ( Figure 3 E- Figure 3 H).

[0118] Figure 4: Showing the humanized anti-complement protein C5 nanobody NA008-Hz18k ( Figure 4A ) and HA010-Hz24b ( Figure 4B The binding and dissociation curves of human complement protein C5 in the SPR affinity test.

[0119] Figure 5: Showing the HA010 humanized nanobody ( Figure 5A ), NA008 humanized antibody ( Figure 5B GA088 humanized antibody ( Figure 5C ), HA094 humanized antibody ( Figure 5D It exhibits hemolytic inhibitory activity against the classical pathway.

[0120] Figure 6 The study demonstrated the inhibitory activity of the humanized nanobody against complement protein C5 in inhibiting C5a release. Detailed Implementation

[0121] The technical solutions of the embodiments of the present invention will be clearly and completely described below with reference to the accompanying drawings. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention.

[0122] Example 1: Construction of an alpaca immune and antibody library 1.1 Alpaca Immunity In this embodiment, human C5 protein (purchased from Comptech, catalog number: A120) was used as an immunogen to immunize alpacas and generate anti-complement protein C5 nanobodies. Specifically, two adult alpacas over 8 months of age were selected and immunized with 1 mg of human C5 protein per animal per dose. During the immunization process, 1 mg of human C5 was mixed with Freund's complete adjuvant and emulsified, and then injected subcutaneously at multiple sites (more than 8 sites) on the back of the alpacas. After the first immunization, a second and third immunization were performed at 14-day intervals. Blood was collected on the 7th day after each immunization, and the serum was separated by centrifugation for ELISA titer detection. After the third immunization, ELISA testing confirmed that the titers of both animals met the requirements for library construction. 100 mL of peripheral blood was collected from each animal for mononuclear cell (PBMC) isolation and phage library construction.

[0123] 1.2 Construction of anti-complement protein C5 nanobody phage library Total RNA was extracted from isolated alpaca PBMCs using Trizol, and cDNA was reverse transcribed. The variable region VH fragment (approximately 700 bp in length) was amplified twice using nanobody-specific primers. The amplified fragment and the pcomb3X vector were digested with SfiI enzyme (NEB, catalog number R0123L), mixed in an appropriate ratio, and ligated using T4 ligase (Vazyme, catalog number C301). After ligation, the mixture was used for electrotransformation of XL1-Blue competent cells. The transformation library capacity for the alpaca was calculated based on the colony growth of the competent cell dilutions on antibiotic-containing plates: 4.02 * 10-1 for the first alpaca. 8 The second alpaca is 1.6 x 10 cm. 9 .

[0124] Example 2: Phage display, panning, and screening of anti-complement protein C5 nanobodies 2.1 Phage Library Selection This embodiment employs a solid-phase method for phage library binding activity panning (binding to human complement C5). Specifically, the panning process is as follows: 1) The high-affinity enzyme-linked immunosorbent assay (ELISA) plate was coated with human complement protein C5 antigen (purchased from Comptech, catalog number: A120) overnight. After washing the plate with 0.1% PBST, it was blocked with 3% skim milk powder at room temperature for 1 hour. The blocking solution was discarded and the plate was washed for later use.

[0125] 2) Add approximately 5 × 10⁻⁶ to the sealed antigen plate. 11 The quantitative library was incubated with the antigen at 37°C for 2 hours.

[0126] 3) Wash the plate 6 times with 0.1% PBST.

[0127] 4) After elution with Glycine-HCl eluent, adjust the pH to 7.4 with Tris-HCl; 5) Mix the above eluent with Escherichia coli XL1-Blue, incubate at 37°C for 30 min, and then shake to culture.

[0128] 6) After rescuing the phage, the amplified antibody 1st library was obtained by shaking and culturing overnight at 30°C.

[0129] 7) Repeat steps 1) to 6) to obtain the second library.

[0130] The amplified libraries enriched under the condition of coating human complement protein C5 were diluted 10-fold and subjected to antigen binding ELISA test. The results were all positive, as shown in Table 2. This indicates that phages binding human complement protein C5 were enriched, and phage monoclonal binding screening can be carried out.

[0131] Table 2. Detection results of human C5 binding in phage libraries enriched with human complement protein C5.

[0132] 2.2 Phage monoclonal screening and sequencing Single colonies were selected from a second-round phage library enriched with human complement protein C5 for phage expression, and positive clones were screened by detecting the ELISA binding activity of the phage expression supernatant with human complement protein C5. Specifically, the experimental procedure was as follows: 1) Coat human complement protein C5 in 96-well plates at a protein concentration of 0.5 µg / mL and incubate overnight at 4°C.

[0133] 2) Sealing: 3% milk powder, 200 µL / well, incubate at room temperature for 1 hour.

[0134] 3) Add 100 µL of phage expression supernatant diluted 10-fold to each well and incubate at room temperature for 1 hour.

[0135] 4) Add anti-M13 antibody (purchased from: Sinocare, catalog number: 11973-MM05T-H) as the detection antibody at a concentration of 0.2 µg / mL, 100 µL / well, and incubate at room temperature for 1 hour.

[0136] 5) Add 200 µL of TMB chromogenic buffer per well, incubate for 20 minutes, then add 50 µL of stop buffer per well. Measure OD450 using a microplate reader.

[0137] After DNA sequencing and codon translation, the amino acid sequences of a series of nanobodies were obtained, totaling 193 unique sequences. Tables 3 and 4 provide the full-length nucleic acid sequences and amino acid sequences of the preferred nanobodies. The amino acid sequences of the CDR regions (CDR-H1, CDR-H2, CDR-H3) defined according to the Kabat principle are shown in Table 5.

[0138] Table 3. Nucleotide sequences of anti-complement protein C5 nanobodies

[0139] Table 4. Amino acid sequence of anti-complement protein C5 antibody

[0140] Table 5. Amino acid sequence of the CDR region of the anti-complement protein C5 nanobody

[0141] Example 3 Expression of anti-complement protein C5 nanobodies A secretion signal peptide, MDAMKRGLCCVLLLCGAVFVSPS (SEQ ID NO: 56), was added to the N-terminus of the nanobodies, and 6xHis was added to the C-terminus. DNA sequences encoding each nanobodies were obtained through gene synthesis and then ligated into the expression vector pCDNA3.1(+) via NheI and XhoI restriction sites. After accurate plasmid sequencing and endotoxin-free extraction, the plasmids were transfected into suspension 293F cells (Gibco, 11-625-019) using PEI (purchased from Polysciences, catalog number: 02371) for transient expression. The cell culture supernatant was purified using a Ni-NTA affinity chromatography column. Protein purity was assessed by reducing and non-reducing SDS-PAGE.

[0142] Example 4: Detection of the binding activity of anti-complement protein C5 nanobodies This embodiment uses ELISA to detect the activity of the nanobody obtained in Example 3 in binding to human complement protein C5. Specifically, human C5 protein (purchased from Comptech, catalog number: A120) was diluted to 2 μg / ml with coating buffer (purchased from Yuanye Biotechnology, catalog number: R20934) and added to an ELISA plate, 100 μL / well, and incubated overnight at 4°C. After blocking with 5% skim milk powder and washing with PBST (PBS containing 0.1% Tween 20, pH=7.4), 100 μL of serially diluted nanobody solution was added, and the plate was incubated at 37°C for 1 hour. After washing with PBST, HRP-labeled mouse anti-His tag monoclonal antibody (purchased from Proteintech, catalog number: HRP-66005) diluted 1:7000 was added, and the plate was incubated at 25°C for 45 minutes. After washing the plate with PBST, add 100 μL of TMB (purchased from Tiangen Biotech, catalog number: PA107-01) to each well. Incubate at 37℃ for 15 minutes, then add 100 μL of ELISA stop solution (purchased from Solarbio, catalog number: C1058). Measure the absorbance (OD450) at 450 nm using a Thermo Scientific Multiskan SkyHigh microplate reader.

[0143] Four-parameter fitting was performed on the ELISA dose-response data of the anticomplement protein C5 nanobody and C5 to calculate EC. 50 The values ​​are shown in Table 6. The results indicate that, under the experimental conditions of this embodiment, all different anti-complement protein C5 nanobodies exhibit high affinity for the C5 antigen, EC... 50 The value is between 0.08 and 0.21 nM.

[0144] Table 6. EC5 of anti-complement protein C5 nanobodies binding to human complement protein C5 50 Value Summary

[0145] Example 5: Inhibitory activity of anti-complement protein C5 nanobody against complement protein C5 activation 5.1 Anti-complement protein C5 nanobody inhibits hemolysis caused by activation of the classical complement pathway. This embodiment uses an in vitro erythrocyte hemolysis experiment to test the inhibitory effect of anti-C5 nanobody on hemolysis via the classical pathway.

[0146] For the classic pathway-dependent hemolytic activity test, GVB was used. ++ (Purchased from: Comptech, Catalog No.: B102) Used for cell washing and sample preparation. Take an appropriate amount of sheep red blood cells, centrifuge at 800 rcf for 5 min, and wash with an equal volume of GVB. ++Resuspend the cells, repeating the process three times. Sensitize the resuspended sheep red blood cells with hemolysin (purchased from Yuanye Biotechnology, catalog number: S25861-10), then store at 4°C for later use. Use GVB... ++ A gradient dilution buffer was prepared for the anti-complement protein C5 nanobody. The antibody dilution buffer was mixed with human serum (GeminiBio, catalog number: 100-512), followed by the addition of 100 μL of sensitized sheep erythrocytes. The mixture was inverted and incubated at 37°C for 60 minutes. The sample was inverted and mixed every 20 minutes. A negative control group and a blank control group were included in each experiment. The negative control group consisted of the experimental system without antibody dilution buffer to detect hemolysis induced by human serum, while the blank control group consisted of only sensitized sheep erythrocytes and GVB. ++ The experimental system was used to detect background values. The ARC1905 treatment group (purchased from MedChemExpress, catalog number: HY-147080) served as the positive control group. ARC1905 is the active ingredient of IZERVAY™, in PEGylated RNA molecular form. Its nucleic acid sequence is CGCCGCGGUCUCAGGCGCUGAGUCUGAGUUUACCUGCGU (SEQ ID NO: 57). After 60 minutes of incubation, EDTA was added to each sample to terminate the reaction, and the sample was centrifuged at 4°C for 5 minutes. 100 μL of supernatant from each sample was transferred to a 96-well microplate, and the absorbance at 412 nm was measured using a ThermoScientific (model: Multiskan SkyHigh) microplate reader. The hemolysis inhibition rate was calculated using the following method:

[0147] The antibody concentration versus inhibition rate was plotted as a curve and fitted with four parameters to calculate the IC50. 50 Value. Results of classical pathway CP hemolytic activity assay and IC5 of anti-complement protein C5 nanobody. 50 like Figure 1 As shown in Table 7, nanobodies such as NA008 and HA094 exhibited good inhibitory activity in the classical pathway-activated hemolysis assay. Among them, NA008, GA088, and GB018 showed the highest inhibitory activity (IC50) against classical pathway hemolysis. 50 The values ​​were 8.772, 16.52, and 23.44 nM, respectively, while the positive control was 41.21 nM, which was better than the positive control.

[0148] Table 7. Anticomplement protein C5 nanobody classical pathway CP hemolytic activity assay

[0149] 5.2 Inhibitory effect on in vitro C5 cleavage and release of C5a This embodiment performed a hemolysis experiment according to the method in Example 5.1, and confirmed the inhibitory effect of the anti-complement protein C5 nanobody on the release of C5a from human serum by detecting the C5a content in the supernatant. Specifically, the C5a ELISA kit (purchased from Micro Vue, catalog number: A021) was used, and the C5a content in the supernatant of the hemolysis experiment was detected according to the product instructions. Results of the anti-human C5 nanobody inhibiting C5a release and IC50 values ​​are presented. 50 Values ​​such as Figure 2 As shown in Table 8. The results show that the nanobodies NA008, HA010, GA088, and HA094 exhibit a significant dose-response relationship in inhibiting C5 cleavage and C5a release, with an IC50 value of [missing value]. 50 Values ​​between 21.7 and 23.5 nM were superior to the positive control (IC50). 50 Value: 27.8 nM).

[0150] Table 8. Tests on the inhibition of C5 cleavage and C5a release by anti-complement protein C5 nanobodies.

[0151] Example 6: Binding epitope analysis of anti-complement protein C5 nanobodies This embodiment utilizes chemical cross-linking mass spectrometry to deduce the binding epitopes of anti-complement protein C5 nanobodies NA008, HA010, GA088, and HA094 to C5. Specifically, the procedure is as follows: 1) The nanobody was mixed with 0.5 mg / mL C5 (purchased from Comptech, catalog number: A120) at a molar ratio of 2:1 and incubated at 4°C for 1 h to obtain the complex.

[0152] 2) Add 12.5 mM BS3 (Catalog No. C15178241, Macklin) to crosslink the complex and incubate at room temperature for 30 min.

[0153] 3) Add 50 mM tris-HCl pH 8.0 (product number T1150, Solarbio) to terminate crosslinking.

[0154] 4) Separate the cross-linked samples using 4%-20% SDS-PAGE (catalog number 36270ES10, Yeasen).

[0155] 5) The cross-linked protein complex was cleaved using trypsin (product number: T8658-1VL, manufacturer: Sigma).

[0156] 6) The obtained cutting products were analyzed by mass spectrometry.

[0157] The results are shown in Table 9. The crosslinking sites between NA008 and C5 are mainly distributed in the MG6α domain and the C345C domain; the crosslinking sites between HA010 and C5 are mainly distributed in the CUB domain. f The crosslinking sites of GA088 and C5 are mainly distributed in the MG7 and C345C domains; the crosslinking sites of HA094 and C5 are mainly distributed in the TED and CUB domains. f Structural domains and the C345C structural domain. C5 structural domains, MG7 structural domain, C345C structural domain, MG6α structural domain, TED structural domain, and CUB. f The amino acid sequences of the domains are shown in SEQ ID NO: 119-123.

[0158] Table 9. Crosslinking information between anti-complement protein C5 antibodies NA008, HA010, GA088, and HA094 and human complement protein C5.

[0159] Based on mass spectrometry analysis, the structures of the NA008-C5, HA010-C5, GA088-C5, and HA094-C5 complexes were simulated using molecular docking and molecular dynamics simulations. Specifically, using HADDOCK 2.4 with cross-linking sites as constraints, molecular docking was performed between C5 and anti-C5 antibodies, with the structure of C5 obtained from the RCSB protein database (PDB:3CU7). The structures of the anti-C5 antibodies NA008, HA010, GA088, and HA094 were predicted using alphafold2. Molecular dynamics simulations (MD) were performed using GROMACS 2020.05 software, with the molecular docking results used as the initial structures. These structures were placed in a periodic cubic box with a side length of 1.2 nm, and the NaCl concentration was set to 0.15 mol / L to simulate the ion concentration under physiological conditions while ensuring the system's electroneutrality. The maximum descent method was used for energy minimization, with a maximum of 5000 steps to optimize the system structure. The V-rescale algorithm was used to maintain the system temperature at 310 K, and the Parrinello-Rahman algorithm was used to maintain the system pressure at 1 bar. The formal simulation lasted 50 ns with a time step of 2 fs, and all simulations used the CHARMM36 force field. The RMSD values ​​during the simulation were calculated using the "gmx rms" module of GROMACS2020.05 software to evaluate the stability of C5, the anti-C5 antibody, and their complex. The RMSD calculation formula is as follows:

[0160] Where N is the number of atoms, m i It is atomic mass, r i(t1) is the spatial coordinate vector of the λh atom at time t1. i (t2) is the coordinate vector of this atom in the reference structure, fitted using the least squares method. The first frame of the simulation (0 ns) is defined as the reference structure, with its atom coordinate vector being r. i (t0). In molecular dynamics simulations of the C5-NA008, C5-HA010, C5-GA088, and C5-HA094 complexes, the RMSD values ​​of the C5 complexes tended to stabilize, indicating that anti-C5 antibodies could stably bind to the corresponding C5 domains, such as... Figure 3 As shown.

[0161] Example 7: Humanization of Anti-complement protein C5 nanobody 7.1 Humanization of anti-complement protein C5 nanobody This embodiment utilizes the CDR transplantation method to humanize the camel-derived nanobodies NA008, HA010, GA088, and HA094 screened in Example 2. Specifically, the parent antibody's V region sequence was first compared and queried using the antibody databases IGBLAST and IMGT to determine the human germline with the highest similarity. After defining the parent antibody's CDR and frame region, the human antibody's frame region sequence with the highest homology was combined with the three CDR region sequences of the parent antibody to construct humanized antibodies. Reversion mutations to the parent sequence were introduced into some selected frames to design antibody sequences with different degrees of humanization.

[0162] Antibody sequences with different degrees of humanization were designed based on the parent sequences of NA008, HA010, GA088, and HA094. Their amino acid and nucleotide sequence numbers are shown in Tables 10, 11, 12, and 13.

[0163] Humanized anti-complement protein C5 nanobodies were obtained through gene synthesis, plasmid construction, and transient expression in suspension 293F cells.

[0164] Table 10 Summary of the design of humanized anticomplement protein C5 antibody NA008

[0165] Table 11 Summary of the design of humanized anti-complement protein C5 antibody HA010

[0166] Table 12 Summary of the design of humanized anti-complement protein C5 antibody GA088

[0167] Table 13 Summary of the design of humanized anti-complement protein C5 antibody HA094

[0168] 7.2 Binding activity of humanized nanobodies to human complement protein C5 In this embodiment, the ELISA method described in Example 4 was used to evaluate the ELISA binding activity of the humanized antibody to human C5 and a comparative analysis was performed with the parental antibody.

[0169] The results showed that for the HA010 humanized nanobody, its EC binding to human complement protein C5 was... 50 The values ​​are shown in Table 14. The binding activity of the HA010 humanized nanobody to human C5 is basically equivalent to that of the parent antibody HA010, EC5. 50 The values ​​ranged from 0.13 to 0.64 nM, with HA010-Hz25, HA010-Hz24b, HA010-Hz24e, HA010-Hz24g, and HA010-Hz24c showing binding activity closer to that of the parent antibody.

[0170] Table 14. Detection of binding activity between HA010 humanized nanobody and human-C5

[0171] For the NA008 humanized nanobody, its EC binding to human complement protein C5 50 The values ​​are shown in Table 15. The binding activity of the NA008 humanized nanobody to human C5 is basically equivalent to that of the parent antibody NA008, EC 100%. 50 The values ​​ranged from 0.12 to 0.35 nM, with NA008-Hz18j, NA008-Hz18k, and NA008-Hz18ra showing binding activity closer to that of the parent antibody.

[0172] Table 15. Detection of binding activity between NA008 humanized nanobody and human-C5

[0173] For the GA088 humanized nanobody, its EC5 binding to human complement protein C5 50 The values ​​are shown in Table 16. The binding activity of the GA088 humanized nanobody to human C5 is basically equivalent to that of the parent antibody GA088.

[0174] Table 16. Detection of binding activity between GA088 humanized nanobody and human-C5

[0175] EC for HA094 humanized nanobody bound to human complement protein C5 50The values ​​are shown in Table 17. The binding activity of the HA094 humanized nanobody to human C5 is basically equivalent to that of the parent antibody HA094, EC50. 50 The values ​​ranged from 0.24 to 0.35 nM, with HA094-Hz8 and HA094-Hz8b showing binding activity closer to that of the parent antibody.

[0176] Table 17. Detection of binding activity between HA094 humanized nanobody and human-C5

[0177] The binding kinetics of humanized anti-C5 nanobodies NA008-Hz18k and HA010-Hz24b to human C5 were detected using the surface plasmon resonance (SPR) method. Specifically, a Biacore 8K instrument (Cytiva) was used to capture human-C5 using a CM5 chip (Comptech). The antibodies were diluted with HBS-EP mobile phase buffer (0.01 M HEPES pH 7.4, 0.15 M NaCl, 3 mM EDTA, 0.005% v / v Tween 20). The antigen-immobilized chip was used to perform binding experiments with different concentrations of antibody molecules, with a binding time of 120 seconds and a dissociation time of 150 seconds. The binding rate (ka), dissociation rate (kd), and equilibrium dissociation constant (K) of complement protein C5 binders to human-C5 were obtained using a "1:1 binding" model. D The results are detailed in Figure 4 and Table 18. The results indicate that the humanized anti-complement protein C5 nanobodies NA008-Hz18k and HA010-Hz24b both exhibit high affinity for human C5 protein. Among them, NA008-Hz18k shows the highest affinity (K) for human C5 protein. D ) is 7.08 x 10 -10 The affinity of M,HA010-Hz24b for human C5 protein (K D ) is 1.96 x 10 -9 M.

[0178] Table 18 Results of the binding kinetics of humanized anti-complement protein C5 nanobody to C5.

[0179] 7.3 Humanized nanobodies inhibit activation of the classical complement pathway This embodiment uses the method described in Example 5.1 to evaluate the hemolytic activity of the humanized nanobody via the classical pathway and compares it with that of the parental antibody. The method described in Example 5.2 is used to evaluate the inhibitory activity of the humanized nanobody against C5 cleavage and C5a release.

[0180] The results showed that for the humanized HA010 antibody, its classical pathway hemolytic inhibition activity as a function of concentration and IC50 value were consistent. 50 Values ​​such as Figure 5A As shown in Table 19, the HA010 humanized nanobody basically maintained the solubility inhibitory activity of the parent antibody, IC50. 50 The values ​​ranged from 39.1 to 57.55 nM, with HA010-Hz24e, HA010-Hz24b, HA010-Hz24g, and HA010-Hz24c showing hemolytic inhibitory activity closer to that of the maternal antibody.

[0181] Table 19 Detection of hemolysis inhibitory activity of HA010 humanized nanobody via classical pathway

[0182] For the NA008 humanized antibody, the classical pathway hemolysis inhibitory activity versus concentration curve and IC50 value are shown. 50 Values ​​such as Figure 5B As shown in Table 20, the NA008 humanized nanobody has basically the same activity as the parent antibody NA008, with an IC50 value of [missing information]. 50 The values ​​ranged from 39.62 to 61.36 nM, among which NA008Hz18j, NA008-Hz18N, NA008-Hz18k, NA008-Hz18L and NA008-Hz18ra were closer to the hemolytic inhibitory activity of the maternal antibody.

[0183] Table 20 Detection of hemolysis inhibitory activity of NA008 humanized nanobody via classical pathway

[0184] For the GA088 humanized antibody, the classical pathway hemolysis inhibitory activity versus concentration curve and IC50 value are shown. 50 Values ​​such as Figure 5C As shown in Table 21, its hemolytic inhibitory activity is similar to that of the maternal antibody GA088.

[0185] Table 21 Detection of hemolysis inhibitory activity of GA088 humanized nanobody via classical pathway

[0186] For the humanized HA094 antibody, the classical pathway hemolytic inhibition activity versus concentration curve and IC50 value are shown. 50 Values ​​such as Figure 5D As shown in Table 22, the HA094 humanized nanobody basically maintained the solubility inhibitory activity of the parent antibody, IC50. 50 The values ​​ranged from 36.86 to 50.94 nM, with HA094-Hz2 and HA094-Hz8 showing hemolytic inhibitory activity closer to that of the maternal antibody.

[0187] Table 22 Detection of hemolysis inhibitory activity of HA094 humanized nanobody via classical pathway

[0188] 7.4 Inhibitory effect of humanized nanobodies on in vitro C5 cleavage and release of C5a This embodiment performed a hemolysis experiment according to the method in Example 5.1, and confirmed the inhibitory effect of the anti-complement protein C5 nanobody on the cleavage and release of C5a from human serum by detecting the C5a content in the supernatant. Specifically, the C5a content in the supernatant of the hemolysis experiment was detected using a C5a ELISA kit (purchased from Micro Vue, catalog number: A021) according to the product instructions. The results are as follows: Figure 6 As shown in Table 23, all the different humanized nanobodies tested could inhibit the cleavage and release of C5a from complement protein C5 in a dose-dependent manner, with an IC50 value of 1.5%. 50 The value is between 20.81 and 45.44 nM.

[0189] Table 23 Detection of C5a release inhibition activity of representative humanized nanobodies

[0190] The preferred embodiments of the present invention have been described in detail above. However, the present invention is not limited to the specific details in the above embodiments. Within the scope of the technical concept of the present invention, various simple modifications can be made to the technical solution of the present invention, and these simple modifications all fall within the protection scope of the present invention.

[0191] It should also be noted that the various specific technical features described in the above specific embodiments can be combined in any suitable way without contradiction. In order to avoid unnecessary repetition, the present invention will not describe the various possible combinations separately.

Claims

1. An antigenic epitope peptide of complement protein C5, characterized in that, The antigenic epitope peptide includes the MG7 domain, C345C domain, MG6α domain, TED domain, and / or CUB domain derived from complement protein C5 antigen. f Antigenic epitope peptides with structural domains.

2. The antigenic epitope peptide according to claim 1, characterized in that, The length of the antigenic epitope peptide is 4-15 aa.

3. The antigenic epitope peptide according to claim 1 or 2, characterized in that, The antigenic epitope peptide comprises any of the amino acid sequences shown in SEQ ID NO: 58-68.

4. A mimic of complement protein C5 antigen, characterized in that, The mimicry includes the antigenic epitope peptide according to any one of claims 1-3.

5. A fusion protein, characterized in that, The fusion protein comprises the antigenic epitope peptide of any one of claims 1-3 and / or the mimic of claim 4.

6. A biomaterial, characterized in that, The biomaterials include: 1) A gene encoding the antigenic epitope peptide of any one of claims 1-3, the mimic of claim 4, and / or the fusion protein of claim 5; 2) A vector containing the gene from 1); 3) Host cells containing the gene in 1) and / or the vector in 2).

7. An antigen-presenting cell, characterized in that, The antigen-presenting cells comprise the antigen epitope peptide of any one of claims 1-3, the mimic of claim 4, the fusion protein of claim 5, the gene of claim 6, and / or the vector of claim 6.

8. The application of the antigenic epitope peptide according to any one of claims 1-3, the mimicry according to claim 4, the fusion protein according to claim 5, the biomaterial according to claim 6, and the antigen-presenting cell according to claim 7, characterized in that, The applications include: 1) Use in screening, detecting, preparing and / or purifying anti-complement protein C5 antibodies or their antigen-binding fragments; 2) Use in the preparation of antigen-antibody complexes, wherein the antigen-antibody complexes comprise: 2-1) The complement protein C5 antigenic epitope peptide according to any one of claims 1-3, the mimic according to claim 4, or the fusion protein according to claim 5, and, 2-2) Antibody against complement protein C5 or its antigen-binding fragment; 3) Use in the preparation and screening of pharmaceuticals and / or diagnostic reagents for the treatment and / or prevention of complement protein C5 antigen-related diseases.

9. An anti-complement protein C5 antibody or its antigen-binding fragment, characterized in that, The anti-complement protein C5 antibody or its antigen-binding fragment can bind to the antigenic epitope peptide of any one of claims 1-3 and / or the mimic of claim 4.

10. An anti-complement protein C5 antibody or its antigen-binding fragment, characterized in that, The anti-complement protein C5 antibody or its antigen-binding fragment comprises CDR-H1, CDR-H2, and CDR-H3 of the heavy chain variable region; wherein, a) The amino acid sequence of CDR-H1 contains any of the amino acid sequences shown in IDTWG (SEQ ID NO: 23), NYNMA (SEQ ID NO: 29), or X1X2X3MG (SEQ ID NO: 118), or an amino acid sequence that has at least 80% identity with any of the amino acid sequences shown in IDTWG (SEQ ID NO: 23), NYNMA (SEQ ID NO: 29), or X1X2X3MG (SEQ ID NO: 118); b) The amino acid sequence of CDR-H2 contains any of the amino acid sequences shown in SEQ ID NO: 34-43, or has at least 80% identity with any of the amino acid sequences shown in SEQ ID NO: 34-43; c) The amino acid sequence of CDR-H3 includes any of the amino acid sequences shown in SEQ ID NO: 45-48, 50-52, 54, RGYDX4TNYPPQPLDS (SEQ ID NO: 44), SRRANFRX5FX6SWDY (SEQ ID NO: 55), or an amino acid sequence that has at least 80% identity with any of the amino acid sequences shown in SEQ ID NO: 45-48, 50-52, 54, RGYDX4TNYPPQPLDS (SEQ ID NO: 44), SRRANFRX5FX6SWDY (SEQ ID NO: 55).

11. The anti-complement protein C5 antibody or its antigen-binding fragment according to claim 10, characterized in that, In SEQ ID NO: 118, X1 is selected from: I, D, N, S or L; X2 is selected from: Y, T, V or D; X3 is selected from: T, A, V, I, N or Q; In SEQ ID NO: 44, X4 is selected from G or S; In SEQ ID NO: 55, X5 is selected from N or Q, and X6 is selected from S or A.

12. The anti-complement protein C5 antibody or its antigen-binding fragment according to claim 10 or 11, characterized in that, The amino acid sequences of CDR-H1, CDR-H2, and CDR-H3 comprise any of the following groups: A) SEQ ID NO: 23, 34, 45; B) SEQ ID NO: 24, 35, 46; C) SEQ ID NO: 25, 36, 47; D) SEQ ID NO: 26, 37, 48; E) SEQ ID NO: 27, 38, 49; F) SEQ ID NO: 28, 39, 50; G) SEQ ID NO: 29, 40, 51; H) SEQ ID NO: 30, 41, 52; I) SEQ ID NO: 31, 42, 53; J) SEQ ID NO: 32, 43, 54; K) SEQ ID NO: 31, 42, 117; L) SEQ ID NO: 27, 38, 22; M) SEQ ID NO: 27, 38, 33.

13. The anti-complement protein C5 antibody or its antigen-binding fragment according to any one of claims 10-12, characterized in that, The anti-complement protein C5 antibody or its antigen-binding fragment has been humanized, and the modification site of the humanized sequence is located in the frame region and / or CDR region of the antibody.

14. The anti-complement protein C5 antibody or its antigen-binding fragment according to any one of claims 10-13, characterized in that, The anti-complement protein C5 antibody or its antigen-binding fragment includes single-domain antibodies, chimeric antibodies, Fab fragments, Fab' fragments, Fd fragments, Fv fragments, dAb fragments, F(ab')2 fragments, single-chain antibody fragments (scFv), or linear antibodies.

15. The anti-complement protein C5 antibody or its antigen-binding fragment according to any one of claims 10-14, characterized in that, The amino acid sequence of the anti-complement protein C5 antibody or its antigen-binding fragment includes any one of the amino acid sequences in SEQ ID NO: 12-21, 75-95, 124-127, or has at least 80% identity with any one of the amino acid sequences in SEQ ID NO: 12-21, 75-95, 124-127.

16. A fusion construct, characterized in that, The fusion construct comprises the anti-complement protein C5 antibody or its antigen-binding fragment as described in any one of claims 9-15.

17. The fusion construct according to claim 16, characterized in that, The fusion construct further includes other bioactive effector molecules, including antibodies targeting other targets besides the anti-complement protein C5 antibody or its antigen-binding fragment as described in any one of claims 9-15, receptor domains, or other functional components. Preferably, the other functional components include one or more of the following: serum albumin, cytokines, transferrin, scaffold protein, oligopeptide, oligopeptide polymer, polypeptide, polypeptide polymer, polysaccharide, fatty acid chain, avidin, biotin, streptavidin, toxin, drug, nucleic acid, radionuclide and its marker, PEGylated component, complement factor or Fc fragment. More preferably, the complement factors include complement factor H (FH), complement factor I (FI), complement decay-accelerating factor (CD55), membrane cofactor protein (MCP), complement regulatory protein CD59 (CD59), C4b-binding protein (C4BP), or C1 inhibitor (C1INH). Preferably, the receptor domain includes complement receptor 1 (CR1), complement receptor 2 (CR2), complement receptor 3 (CR3), complement receptor 4 (CR4), or a complement receptor of the Immunoglobulin Family (CRIg). Preferably, the other targets are selected from vascular endothelial growth factor A (VEGFA), vascular endothelial growth factor B (VEGFB), vascular endothelial growth factor C (VEGFC), vascular endothelial growth factor D (VEGFD), vascular endothelial growth factor receptor (VEGFR), fibroblast growth factor (FGF), fibroblast growth factor receptor (FGFR), placental growth factor (PIGF), platelet-derived growth factor (PDGF), angiopoietin-2 (ANG2), transforming growth factor (TGF), integrin, and integrin receptor. Receptors, interleukins (such as IL-1β, IL-2, IL-3, IL-4, IL-6, IL-10, IL-12, IL-15, IL-17, IL-23, etc.), interleukin receptors (such as IL-1R1, IL-2Rα, IL-3R, IL-4Rα, IL-6R, IL-10R, IL-12R, IL-15Rα, IL-17R, IL-23R, etc.), proprotein convertase subtilisin / kexin type 9 (PCSK9), α-tumor necrosis factor (TNFα), tumor necrosis factor receptor (TNFR), receptor activator of nuclear factor-κB ligand (RANKL), complement protein C3 (Complement Component 3, ...C3), Complement Component 3b (C3b), Complement Factor B (FB), Complement Factor D (FD), Complement Factor FP (Properdin), Complement Component 1q (C1q), Complement Component 1s (C1s), Complement Component 4b (C4b), Complement Component 2 (C2), Mannan-Binding Lectin Serine Protease 2 (MASP2), Mannan-Binding Lectin Serine Protease 3 (MASP3), Complement Component 3a Receptor (C3aR), Complement Component 5a Receptor 1 1, C5aR1), Complement Component 5a Receptor 2 (C5aR2), G Protein-Coupled Receptor (GPCR), Glucagon-like peptide-1 receptor (GLP1R), Cluster of Differentiation 3 (CD3), Cluster of Differentiation 105 (CD105), Cluster of Differentiation 19 (CD19), Cluster of Differentiation 20 (CD20), Cluster of Differentiation 22 (CD22), Cluster of Differentiation 25 (CD25), Cluster of Differentiation 27 (CD27), Cluster of Differentiation 28 (CD28), Cluster of Differentiation 30 (CD28).Clusters of Differentiation (CD30), Cluster of Differentiation 33 (CD33), Cluster of Differentiation 38 (CD38), Cluster of Differentiation 40 (CD40), Cluster of Differentiation 47 (CD47), Cluster of Differentiation 80 (CD80 / B7-1), Cluster of Differentiation 86 (CD86 / B7-2), Cluster of Differentiation 96 (CD96), Cluster of Differentiation 99 (CD99), Cluster of Differentiation 111 (CD111), Cluster of Differentiation 112 (CD112), Cluster of Differentiation 123 (CD123), Cluster of Differentiation 133 (CD123). 133 (CD133), Cluster of Differentiation 138 (CD138), Cluster of Differentiation 155 (CD155), Cluster of Differentiation 171 (CD171), Claudin 18.2 (CLDN18.2), Tumor necrosis factor receptor superfamily member 4 (TNFRSF4 / OX40 / CD134), Inducible T-Cell Co-Stimulator (ICOS), Cytotoxic T-lymphocyte-associated protein 4 (CTLA4), Tumor necrosis factor receptor superfamily member 9 (CD133),TNFRSF9 / 4-1BB / CD137), T cell antigen receptor (TCR), B- and T-Lymphocyte Attenuator (BTLA), T cell immunoglobulin domain and mucin domain-3 (TIM-3), Lymphocyte Activation Gene 3 (LAG3), Galectin-9 (GAL9), Programmed cell death 1 ligand 1 (PD-L1), Programmed cell death 1 ligand 2 (PD-L2), Programmed cell death protein 1 (PD-1), T cell immune receptor with Ig and ITIM domains (TIGIT), Epidermal growth factor receptor (EPF) The following receptors are listed: EGFR, human epidermal growth factor receptor-2 (HER2), prostate stem cell antigen (PSCA), carcinoembryonic antigen (CEA), familial adenomatous polyposis (FAP), epidermal growth factor receptor variant type III (EGFRvIII), B cell maturation antigen (BCMA), prostate specific membrane antigen (PSMA), carbohydrate antigen 125 (CA125), tyrosine protein kinase receptor A2 (EphA2), and cellular-mesenchymal epithelial transition factor (CME).c-Met, L1-Cell Adhesion Molecule (L1CAM), Signaling Lymphocytic Activation Molecule Family Member 7 (SLAMF7 / CS1), Receptor tyrosine kinase-like orphan receptor 1 (ROR1), Recombinant Mycobacterium Tuberculosis Fusion Protein, New York esophageal squamous cell carcinoma-1 (NY-ESO-1), Mucin 1 (MUC1), Mucin 16 (MUC16), Mesothelin, Cluster of Differentiation 174 (LewisY / CD174), Glypican 3 3, GPC3), disialoganglioside-GD2 (GD2), eukaryotic division factor-like and proliferation-associated protein (EPG), Delta-Like Ligand 3 (DLL3), or trophoblast glycoprotein (TPBG / 5T4).

18. A nucleic acid, characterized in that, The nucleic acid described herein encodes the anti-complement protein C5 antibody or its antigen-binding fragment as described in any one of claims 9-15, or encodes the fusion construct as described in any one of claims 16-17.

19. The nucleic acid according to claim 18, characterized in that, The nucleic acid comprises any nucleotide sequence or degenerate sequence of SEQ ID NO: 1-10, 96-116, 128-130, 11, or a nucleotide sequence having at least 80% identity with any nucleotide sequence of SEQ ID NO: 1-10, 96-116, 128-130, 11, and having the function of encoding an anti-complement protein C5 antibody or an antigen-binding fragment thereof.

20. A carrier, characterized in that, The vector comprises the nucleic acid as described in any one of claims 18-19.

21. A host cell, characterized in that, The host cell comprises the nucleic acid of any one of claims 18-19 or the vector of claim 20.

22. A method for preparing an anti-complement protein C5 antibody or its antigen-binding fragment as described in any one of claims 9-15, or a fusion construct as described in any one of claims 16-17, characterized in that, The preparation method includes culturing the host cells of claim 21 to express the anti-complement protein C5 antibody or its antigen-binding fragment or the fusion construct.

23. A product for treating, preventing, and / or diagnosing diseases, characterized in that, The products for treating, preventing, and / or diagnosing diseases include any of the following: A) The anti-complement protein C5 antibody or its antigen-binding fragment as described in any one of claims 9-15; B) The fusion construct according to any one of claims 16-17; C) The nucleic acid according to any one of claims 18-19; D) The carrier according to claim 20; E) The host cell according to claim 21; F) The antigenic epitope peptide according to any one of claims 1-3; G) The simulant as described in claim 4; H) The fusion protein according to claim 5; I) The biomaterial according to claim 6; or, J) The antigen-presenting cells according to claim 7.

24. The use of an antigenic epitope peptide according to any one of claims 1-3, a mimic according to claim 4, a fusion protein according to claim 5, a biomaterial according to claim 6, an antigen-presenting cell according to claim 7, an anti-complement protein C5 antibody or its antigen-binding fragment according to any one of claims 9-15, a fusion construct according to any one of claims 16-17, a nucleic acid according to any one of claims 18-19, a vector according to claim 20, or a host cell according to claim 21 in the preparation and screening of products for the treatment and / or prevention of complement activation-related diseases, or in the preparation and screening of diagnostic products or tracers for complement activation-related diseases.

25. The application according to claim 24, characterized in that, The diseases described are selected from rheumatoid arthritis (RA); lupus nephritis (LN); immunoglobulin A nephropathy; ischemia-reperfusion injury (IRI); paroxysmal nocturnal hemoglobinuria (PNH); atypical hemolytic uremic syndrome (aHUS); dense deposit disease (DDD); age-related macular degeneration (AMD); geographic atrophy (GA); hemolysis, elevated liver enzymes, and low platelet count syndrome (HELLP); thrombotic thrombocytopenic purpura (TTP); and spontaneous abortion. Abortion (SAB); Pauci-immune vasculitis; epidermolysis bullosa (EB); recurrent miscarriage (RM); multiple sclerosis (MS); traumatic brain injury (TBI); and damage caused by myocardial infarction, cardiopulmonary bypass, and hemodialysis; CD55 deficiency with hyperactivation of complement, angiopathic thrombosis, and protein-losing enteropathy (CHAPLE).

26. A method for detecting complement protein C5, characterized in that, The detection method includes binding the sample to be tested with any of the anti-complement protein C5 antibodies or their antigen-binding fragments as described in claims 9-15, and then detecting the content of the complex formed by complement protein C5 and the anti-complement protein C5 antibody or its antigen-binding fragments.