Additional CCAAT box in low-heart-rate longevity mammal GDF11 promoter capable of reducing resting heart rate and promoting longevity

By introducing the CCAAT box into the GDF11 gene promoter and using gene editing technology, the genetic link between low heart rate and longevity was solved, achieving both reduced heart rate and extended lifespan, and providing a new approach to treating aging and heart rate-related diseases.

CN121592652APending Publication Date: 2026-03-03SHIHEZI UNIVERSITY
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202511875872.7
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-12-12
Publication Date
2026-03-03

AI Technical Summary

Technical Problem

The genetic link between low heart rate and longevity is currently unclear, and existing technologies lack effective means to promote longevity and low heart rate in mammals.

Method used

By introducing an additional CCAAT box at base positions -194 to -198 of the GDF11 gene promoter, gene editing technology was used to construct a mechanism to regulate GDF11 gene activity. Combined with sgRNA targeted editing, this resulted in heart rate reduction and anti-aging effects.

Benefits of technology

It significantly reduces resting heart rate in mammals, prolongs lifespan, and delays aging, providing an animal model for constructing a model that reduces resting heart rate and delays aging, and offering a new research and development approach for the treatment of aging and heart rate-related diseases.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121592652A_ABST
    Figure CN121592652A_ABST
Patent Text Reader

Abstract

The invention relates to the technical field of biological medicine, in particular to an extra CCAAT box in a low-heart-rate long-life mammal GDF11 promoter capable of reducing the resting heart rate and promoting longevity. According to the invention, a regulatory element capable of co-evolution with prolonged life and low heart rate is found by using bioinformatics and gene editing animals. On the basis, the invention provides a functional control region in a GDF11 gene promoter region, the functional region comprises two CCAAT boxes, and the positions of the two CCAAT boxes are respectively located at the 194th-198th basic groups of the GDF11 gene promoter. The functional control region in the GDF11 gene promoter region provided by the invention can promote the longevity, low heart rate and senescence delaying of mammals, can also be used for constructing animal models with reduced resting heart rate and / or senescence delaying, and provides a promising way for research and development of treatment means for senescence and heart rate related diseases.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of biomedical technology, and in particular to the ability of an additional CCAAT box in the GDF11 promoter of long-lived mammals with low heart rates to reduce resting heart rate and promote longevity. Background Technology

[0002] For a long time, it has been argued that mammals, regardless of lifespan, have an average of about one billion heartbeats in their lifetime (Levine, H J. “Rest heart rate and life expectancy.” Journal of the American College of Cardiology vol. 30,4 (1997): 1104-6.). While this view is somewhat simplistic, it captures the inverse relationship between mammalian lifespan and heart rate—longer-lived species typically have lower heart rates. For example, beluga whales, which live over 200 years, have a resting heart rate of about 10 beats per minute (Ponganis PJ. A Physio-Logging Journey: Heart Rates of the Emperor Penguin and Blue Whale. FrontPhysiol. 2021 Aug 3;12:721381.). In contrast, house mice have a heart rate of about 600 beats per minute and a lifespan of only 1-3 years. Besides whales, the association between low heart rate and long lifespan has been observed in various mammalian lineages, including elephants (Proboscis), camels (Artiodactyla), and horses (Perissodactyla), suggesting a convergent evolutionary trend. At the intraspecific level, lower heart rate is also associated with longer lifespan (Jensen MT. Resting heart rate and relation to disease and longevity: past, present and future. Scand J Clin Lab Invest. 2019 Feb-Apr;79(1-2):108-116.), while higher heart rate is closely associated with cardiovascular disease death and sudden cardiac death. Heart rate is influenced by genetic factors (van de Vegte YJ, Tegegne BS, Verweij N, Snieder H, van der Harst P. Genetics and the heart rate response to exercise. Cell Mol Life Sci. 2019 Jun;76(12):2391-2409.) and also by environmental factors, such as physical exercise.Meanwhile, previous studies have shown that various genetic and epigenetic factors (Hu Y, Yuan S, Du X, Liu J, Zhou W, Wei F. Comparative analysis reveals epigenomic evolution related to species traits and genomic imprinting in mammals. Innovation (Camb). 2023 Apr 28;4(3):100434.) influence mammalian lifespan. However, it remains unclear whether this association between low heart rate and longevity has a genetic basis.

[0003] Aging and death are inevitable. However, there are extremely long-lived species in every mammalian category, sometimes spanning several orders of magnitude. This raises the question of whether this correlation between longevity and low heart rate is convergent evolution across different evolutionary lineages of mammals. The increasing number of high-quality animal genome releases, such as those from Zoonomia (Christmas MJ, Kaplow IM, Genereux DP, Dong MX. Evolutionary constraint and innovation across hundreds of placental mammals. Science. 2023 Apr 28;380(6643):eabn3943.) and the Vertebrate Genome Project (Rhie A, McCarthy SA, Fedrigo O. Towards complete and error-free genome assemblies of all vertebrate species. Nature. 2021 Apr;592(7856):737-746.), provides unprecedented opportunities to study the genetic basis of key evolutionary innovative traits in animals. Based on this, this invention utilizes abundant mammalian genome resources, as well as heart rate and lifespan data, to explore the genetic basis of the correlation between low heart rate and longevity in mammals through a combination of comparative genomics, experimental verification, and gene editing. Summary of the Invention

[0004] The purpose of this invention is to provide an additional CCAAT box in the GDF11 promoter of long-lived mammals with low heart rates that can reduce resting heart rate and promote longevity, thereby solving the problems existing in the prior art.

[0005] To achieve the above objectives, the present invention provides the following solution:

[0006] This invention provides a functional control region in the promoter region of the GDF11 gene, wherein the conserved motif of the functional control region is CCAAT; the conserved motif is located at bases -194 to -198 of the GDF11 gene promoter.

[0007] More preferably, the bases from -194 to -198 of the GDF11 gene promoter are counted using the transcription start site (TSS) as the core benchmark.

[0008] This invention provides the application of the above-mentioned functional control region in constructing a mutant that regulates the activity of the GDF11 gene. The mutated sequence is located at bases -194 to -198 of the GDF11 gene promoter, and the sequence after the mutation at bases -194 to -198 is CCAAT.

[0009] This invention provides a mutant that regulates the activity of the GDF11 gene. The mutant sequence is located at bases -194 to -198 of the GDF11 gene promoter, and the sequence after the mutation at bases -194 to -198 is CCAAT. The accession number of the GDF11 gene promoter is NM_010272.2.

[0010] The present invention provides a biomaterial comprising the above-described mutant.

[0011] The present invention provides the application of the above-described functional control region, the above-described mutant, or the above-described biological material in any of the following:

[0012] (1) Preparation of drugs to lower heart rate;

[0013] (2) Preparation of anti-aging drugs;

[0014] (3) To prepare drugs that prolong life;

[0015] (4) Construct animal models of reduced resting heart rate and / or delayed aging.

[0016] This invention provides a drug for reducing heart rate, anti-aging, or prolonging life, the drug comprising the above-mentioned functional control region, the above-mentioned mutant, or the above-mentioned biological material.

[0017] The present invention provides an sgRNA that targets the above-mentioned functional control region, wherein the nucleotide sequence of the sgRNA is shown in any one of SEQ ID NO.27-SEQ ID NO.29.

[0018] This invention provides the application of the above-described sgRNA in any of the following:

[0019] (1) Preparation of drugs to lower heart rate;

[0020] (2) Preparation of anti-aging drugs;

[0021] (3) To prepare drugs that prolong life;

[0022] (4) Construct animal models of reduced resting heart rate and / or delayed aging.

[0023] This invention provides a drug for reducing heart rate, anti-aging, or prolonging life, the drug comprising the aforementioned sgRNA.

[0024] This invention provides a method for constructing an animal model of decreased resting heart rate and / or delayed aging, comprising the following steps:

[0025] Construct a Cas9 / gRNA expression plasmid containing the above-mentioned sgRNA, and obtain Cas9 mRNA and sgRNA by in vitro transcription;

[0026] Cas9 mRNA, sgRNA and donor oligonucleotides were co-injected into fertilized eggs and transplanted into the oviduct of surrogate animals to obtain gene-edited animals, thus obtaining the animal model of reduced resting heart rate and / or delayed aging; the sequence of the donor oligonucleotide is shown in SEQ ID NO.30.

[0027] The present invention discloses the following technical effects:

[0028] This invention utilizes bioinformatics and gene-edited animals to discover a regulatory element in which lifespan extension and low heart rate co-evolved across multiple mammalian lineages, including whales, elephants, and horses. In the genomes of long-lived mammalian lineages with low heart rates, a second CCAAT box was found to be convergentally acquired in the GDF11 promoter, a well-known cis-element in eukaryotic promoters besides the TATA box. Based on this, this invention proposes a functional control region within the GDF11 gene promoter, which includes an additional CCAAT box located at bases -194 to -198 of the GDF11 gene promoter. Functional analysis shows that this additional CCAAT box has significant regulatory activity, serving as a binding site for multiple transcription factors and participating in a complex regulatory network. To test its functional relevance, a specific embodiment of this invention obtained gene-edited mice carrying a second CCAAT box in the homologous GDF11 promoter. The gene-edited mice exhibited approximately 24.37% reduction in resting heart rate and delayed onset of age-related phenotypes. Single-cell sequencing revealed a dependent regulation of GDF11 expression, suggesting that the complex regulatory role of the second CCAAT box is a potential mechanism for these significant phenotypic changes. In summary, the results of this invention demonstrate that the convergent acquisition of the second CCAAT box in the GDF11 promoter contributes to the coordinated evolution of increased lifespan, decreased heart rate, and delayed aging in mammals, highlighting the genetic mechanism of this physiological coupling. Therefore, the functional control region in the GDF11 gene promoter provided by this invention can promote longevity, low heart rate, and delayed aging in mammals, and can also be used to construct animal models of decreased resting heart rate and / or delayed aging, providing a promising avenue for the development of therapeutics targeting aging and heart rate-related diseases.

[0029] Meanwhile, this invention also provides an sgRNA that targets the functional control region in the promoter region of the GDF11 gene. This sgRNA can accurately edit the functional control region in the promoter region of the GDF11 gene, ultimately promoting longevity, low heart rate, and delayed aging in mammals. It can also be used to construct animal models of reduced resting heart rate and / or delayed aging, thus providing a promising approach for the development of treatments for aging and heart rate-related diseases. Attached Figure Description

[0030] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.

[0031] Figure 1Synergistic gain effect of the second CCAAT box in the promoter of the GDF11 gene in long-lived mammals with low heart rates; where, a is the phylogenetic localization of large, low-heart-rate, long-lived mammals, with low-heart-rate species indicated in red, and the phylogenetic tree generated by TimeTree (timetree.org); b and c are the maximum lifespan (b) and minimum heart rate (c) of mammals used in this invention, with species having a lifespan exceeding 100 years and a minimum recorded heart rate exceeding 100 beats per minute marked with an asterisk, and species without relevant data indicated by a cross; d is candidate aging-related genes showing sequence convergence in low-heart-rate species; e is the alignment of the GDF11 promoter region;

[0032] Figure 2 Functional activity of the CCAAT box associated with low heart rate and longevity; where, a is a schematic diagram of the construction of wild-type (WT) and low heart rate-longevity-associated mutant (MT) promoter reporter vectors; b is the green fluorescent protein after transfection of cells with WT and MT promoter reporter vectors, respectively; c is the relative expression level of WT and MT promoter reporter vectors in 293T cells; d and e are the relative expression levels of WT and MT promoter reporter vectors in MDA-MB-231(d) and HeLa(e) cells, and plasmids with different transfection amounts were detected; f is the relative luciferase activity after co-transfection of MT promoter reporter vectors with different transcription factors, Student's t-test, *: p < 0.05, **: p < 0.01, ***: P < 0.001, ns: not significant;

[0033] Figure 3 Mice with the GDF11 gene edited exhibited lower heart rates and delayed aging; where a) compared to wild-type mice, GDF11 gene-edited mice acquired CCAAT boxes associated with lower heart rates and longer lifespans in the promoter regulating GDF11; b) resting heart rates of wild-type mice (n=10) and gene-edited mice (n=10); c) number of exhaustion episodes during three consecutive days of exercise in wild-type (n=18) and gene-edited mice (n=15); d) fur appearance of 13-month-old wild-type mice. e shows the comparison of femoral bone mineral content, bone surface area, bone volume, bone cross-sectional area, and trabecular pattern factor between 9-month-old wild-type mice (n=5) and gene-edited mice (n=5); f shows the olfactory test results between wild-type (n=6) and gene-edited mice (n=6); g shows the immunofluorescence staining and statistical graphs of 4′,6-diamino-2-phenylindole (DAPI) (blue), Th (green), and VAChT (red) in the hearts of wild-type (n=6) and gene-edited mice (n=6). *: p < 0.05, **: p < 0.01, ***: p < 0.001, ns: not significant;

[0034] Figure 4 Micro-CT results of the femurs of wild-type and GDF11 gene-edited mice. Figure 3 A physical image of the skeleton of E in the image. Detailed Implementation

[0035] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as a limitation of the present invention, but rather as a more detailed description of certain aspects, features, and embodiments of the present invention.

[0036] It should be understood that the terminology used in this invention is merely for describing particular embodiments and is not intended to limit the invention. Furthermore, with respect to numerical ranges in this invention, it should be understood that each intermediate value between the upper and lower limits of the range is also specifically disclosed. Any stated value or intermediate value within a stated range, as well as each smaller range between any other stated value or intermediate value within said range, is also included in this invention. The upper and lower limits of these smaller ranges may be independently included or excluded from the range.

[0037] Unless otherwise stated, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art. While only preferred methods and materials have been described herein, any methods and materials similar or equivalent to those described herein may be used in the implementation or testing of this invention. All references to this specification are incorporated by way of citation to disclose and describe methods and / or materials associated with those references. In the event of any conflict with any incorporated reference, the content of this specification shall prevail.

[0038] Various modifications and variations can be made to the specific embodiments described in this specification without departing from the scope or spirit of the invention, as will be apparent to those skilled in the art. Other embodiments derived from this specification will also be apparent to those skilled in the art. This specification and embodiments are merely exemplary.

[0039] The terms “include,” “including,” “have,” “contain,” etc., used in this article are all open-ended terms, meaning that they include but are not limited to.

[0040] The primers used in this invention are shown in Tables 1 and 2. The primers in Table 1 are used for subsequent vector construction, Q-PCR and mouse genotype identification.

[0041] Table 1. Specific information about the primers

[0042]

[0043] Table 2. Specific information about the primers

[0044]

[0045] Example 1: Sequence mining associated with low heart rate and longevity

[0046] With the increasing abundance of mammalian genome data and the emergence of multiple genome sequence alignment results, we have access to a wealth of resources for comparative genomic analysis. This example utilizes multiple alignment results of 470 mammalian genome sequences available in the UCSC Genome Explorer (https: / / genome.ucsc.edu / cgi-bin / hgTrackUi?db=hg38&g=cons470way). Based on this dataset, this example extracts representative mammalian species with reported heart rates (…). Figure 1 Of these, 30 were low heart rate (LHR) species and 23 were non-low heart rate (NLHR) species. In the multiple genome alignment of 470 pathways, canines (Canis lupus), equines (Equus asinus), hippos (Hippopotamus amphibius), mice (Mus musculus), rabbits (Oryctolagus cuniculus), and sperm whales (Physeter catodon) were each represented by two distinct genome assemblies, and both genome assemblies of these species were included in the analysis of this embodiment.

[0047] Then, this embodiment scanned the genomes of these 53 mammal species to identify: 1. Conserved gene regions in low-heart-rate mammals: gene regions that are identical in low-heart-rate mammals but different in all non-low-heart-rate mammals. 2. Acceleration gene regions in LHR mammals: these gene regions are identical in NLHR mammals but differ in all LHR mammals. Because multiple sequence alignments contain a large number of low-quality genomic sequences, especially from certain cetacean species, this embodiment allows for a certain sequence deletion rate during analysis; for both LHR and NLHR mammals, the deletion rate is limited to no more than 50%. When identifying conserved gene regions in LHR mammals, the total deletion rate for these species is limited to 10%. Similarly, when identifying acceleration gene regions, the total deletion rate for NLHR mammals is also limited to 10%. Furthermore, this embodiment divides LHR mammals into four taxa (elephants, white rhinoceroses – equines, camels, and hippos – cetaceans). When identifying conserved gene regions in LHR mammals, this embodiment ensures that no entire taxa are omitted during alignment. This embodiment identified a total of 968 conserved gene regions and one acceleration gene region specific to LHR mammals. Next, this embodiment examined whether these regions were located in gene coding or regulatory regions. For gene annotation, this embodiment used the human GRCh38 reference genome annotation. For regulatory regions, this embodiment referenced the ENCODE candidate cis-regulatory elements (cCREs) registry in the human genome (The ENCODE Project Collaboration, 2020).

[0048] Finally, to identify genomic regions potentially associated with low heart rate and longevity in mammals, this embodiment examined whether genes affected by the identified regions were related to longevity or aging. Genes associated with longevity and aging were collected from GenAge (https: / / genomics.senescence.info / genes / index.html) and Aging Atlas (https: / / ngdc.cncb.ac.cn / aging / age_related_genes).

[0049] The results are as follows Figure 1 As shown in the figure. The results showed that the candidate aging-related gene with sequence convergence in low heart rate species was the GDF11 gene; then, by comparing the sequence of the GDF11 gene promoter region, a mutation was found at bases -194 to -198 of the GDF11 gene promoter in low heart rate species, and the mutated sequence was CCAAT.

[0050] Example 2: Verification of CCAAT box activity at the cellular level

[0051] 1. Construction of recombinant vectors

[0052] To assess the impact of the additional CCAAT box in the promoter of the GDF11 gene in low-heart-rate, long-lived mammals (low-heart-rate and long-lived mutants, abbreviated as MU) on function, overlap extension PCR was used to amplify the target site and introduce specific site mutations to obtain mutant fragments. The nucleotide sequences of the mutant fragments are shown in SEQ ID NO.27-SEQ ID NO.29, specifically: GATGAAGAGACCGAAAGATGAGG, SEQ ID NO.27; CCGAAAGATGAGGGGGAGGGGGG, SEQ ID NO.28; CCCCCCTCCCCCTCATCTTTCGG, SEQ ID NO.29. The obtained mutant fragments were cloned upstream of the pGL3-Promoter vector. This invention studies the GDF11 gene as a promoter, which requires recognition of the upstream promoter before expressing the downstream detection protein (i.e., green fluorescent protein), hence the need for upstream placement in the vector. Prior to this, the SV40 promoter was removed from the pGL3-Promoter vector using SacI and HindIII restriction enzymes. Subsequently, the mutant fragment was inserted into the SacI and HindIII restriction sites to construct the recombinant pGL3-MU-Promoter vector. The wild-type (WT) sequence, as shown in SEQ ID NO.30, was amplified by PCR: CGCTCCGTCTGTCCCCGATCTCTCTGACTCGGTCCCTCACGGCCTCTCCCCCCCTCCCCCCAATATCTCGGTCTCTTCATCTTTCTCTGGACCCGTGCTCGCTCGTGTTCTCTCTCTCTCTCTC, and this sequence was also cloned into the pGL3-Promoter vector to generate the pGL3-WT-Promoter vector as a control.

[0053] 2. Dual-luciferase reporter gene assay

[0054] 293T cells and HeLa cells were obtained from the Shanghai Institute of Cell Biology, Chinese Academy of Sciences. The MDA-MB-231 cell line was purchased from the American Type Culture Collection (ATCC).

[0055] All cells were cultured in DMEM (Gibco, China) containing 10% sheep fetal serum (Hyclone) and 1% sterile penicillin-streptomycin mixture (Solarbio, Beijing) at 37°C and 5% carbon dioxide.

[0056] Cells were seeded into 12-well plates one day prior to transfection. When cells reached approximately 90% confluence, transfection was performed using Lipofectamine 2000 (Invitrogen, Carlsbad, USA). Cells were transfected using either the pGL3-MU-Promoter or pGL3-WT-Promoter recombinant vector. Green fluorescent protein particles (Pmax-EGFP) were co-transfected as a control for transfection efficiency, while the pRL-TK human chorionic gonadotropin in situ hybridization vector served as an internal normalization control. Transfection was performed in serum-free DMEM medium, which was replaced with serum-containing DMEM medium after 6 hours. Cells were then cultured for another 24 hours, and a luciferase reporter gene assay was used to identify functional variants at disease-associated loci. Subsequently, cells were lysed using lysis buffer (derived from reagents in the dual-luciferase reporter gene assay system), and the supernatant was collected for analysis. Luciferase activity was measured using a dual-luciferase reporter gene assay system (from Beijing Solbo Biotechnology Co., Ltd., according to the manufacturer's instructions). This activity reflected the activity of the GDF11 promoter in animals with low and high heart rates.

[0057] 3. Effects of transcription factors on CCAAT box activity

[0058] To investigate the effects of transcription factors on CCAAT box activity, open reading frame (ORF) sequences of six transcription factors—HDAC3, HDAC1, Cut1, SP1, SP2, and Grg4—were obtained from the NCBI database.

[0059] Primers were designed using Primer 5.0 software, as shown in Table 2. Restriction endonuclease sites were selected based on the multiple cloning site of the pcDNA3.1(+) vector and the target sequence. After PCR amplification, the target gene fragment was digested with the corresponding restriction endonuclease to generate sticky ends, and then ligated into the pcDNA3.1(+) vector using a DNA ligation kit (Dalian Taile Biotechnology Co., Ltd.). This yielded six expression constructs: pcDNA3.1(+)-HDAC3, pcDNA3.1(+)-HDAC1, pcDNA3.1(+)-Cut1, pcDNA3.1(+)-SP1, pcDNA3.1(+)-SP2, and pcDNA3.1(+)-Grg4. After sequence verification, 293T cells were co-transfected with each transcription factor construct along with either the pGL3-MU-Promoter or pGL3-WT-Promoter recombinant vector. In addition, combinations of pcDNA3.1(+)-HDAC3, pcDNA3.1(+)-Cut1, and pcDNA3.1(+)-Grg4 were randomly co-transfected into 293T cells with either the pGL3-MU-Promoter or pGL3-WT-Promoter recombinant vectors. The pRL-TK vector was used as an internal control for normalization, and pcDNA3.1(+) served as a negative control. This vector, containing Pmax-eGFP, was used as a transfection efficiency marker. Pmax-eGFP is a plasmid expressing green fluorescent protein and emits green fluorescence; the intensity of the light indicates the extent of plasmid transfection. When Pmax is co-transfected with other plasmids, the greater the transfection of Pmax, the greater the transfection of the other plasmids. Luciferase activity was measured according to the above method to assess the effect of transcription factors on the additional CCAAT box activity acquired in long-lived, low-heart-rate mammals. The results are as follows: Figure 2 As shown in the figure. The results show that, through cloning and constructing eukaryotic expression vectors for multiple transcription factors, this embodiment found that CUT1, HDAC3, and GRG4 significantly inhibited luciferase expression in the lhrlMT reporter vector, while HDAC1, SP1, and SP2 significantly enhanced its expression. There are synergistic regulatory effects among transcription factors; co-transfection of GRG4 with HDAC3, GRG4 with CUT1, or CUT1 with HDAC3 all produced stronger expression inhibition effects, but the inhibitory effects did not further accumulate when all three were co-transfected. These results confirm the functional relevance of the CCAAT box, unique to low-heart-rate, long-lived mammals, and reveal the complexity of its regulatory network.

[0060] Example 3: Animal-level verification of CCAAT box activity

[0061] 1. Verification by breeding mice with the CCAAT mutation

[0062] To verify the in vivo regulatory function of the additional CCAAT box in the GDF11 gene promoter in extending lifespan, this embodiment used CRISPR-Cas9 gene editing technology to convert the natural CTCAT sequence (reference sequence: NM_010272.2) in the GDF11 gene promoter of C57BL / 6J mice into CCAAT. Specifically, a single guide RNA (sgRNA) was designed using the online CRISPR / Cas9 sgRNA design tool (http: / / crispr.mit.edu / ), and approximately 200 base pairs flanking the target sequence were input. sgRNA-A1, sgRNA-B1, and sgRNA-B2 (sgRNA-A1: GATGAAGAGACCGAAAGATGAGG, SEQ ID NO.27; sgRNA-B1: CCGAAAGATGAGGGGGAGGGGGG, SEQ ID NO.28; sgRNA-B2: CCCCCCCTCCCCCTCATCTTTCGG, SEQ ID NO.29) were selected based on their proximity to the target site and low predicted off-target activity, with scores of 0.65, 0.57, and 0.61, respectively. Based on its optimal score and location, sgRNA-A1 was selected for subsequent mouse editing; the donor oligonucleotide sequence is shown in SEQ ID NO.30. The sgRNA and donor nucleotides were synthesized by Shanghai SangGene Biotechnology Co., Ltd.

[0063] gRNA-A1 was cloned into the Cas9 / gRNA expression plasmid (pCAG-T7-Cas9), with SacI and HindIII restriction endonucleases as restriction sites, generating the recombinant plasmid pCAG-T7-Cas9-gRNA-A1. This plasmid was then transfected into *E. coli* DH5α, and positive clones were selected and sequenced using specific primers (TGAGCGTCGATTTTTGTGATGCTCGTCAG, SEQ ID NO. 31) for verification.

[0064] The validated plasmid was then transcribed in vitro using the MEGAscript™ T7 Transcription Kit (ThermoFisherScientific). Cytidine and uridine in the kit were replaced with modified nucleotides; pCAG-T7-Cas9-gRNA-A1 was transcribed in vitro according to the kit instructions, followed by RNA poly(A) tailing and purification.

[0065] Female C57BL / 6J mice were subjected to superovulation treatment by injection of human chorionic gonadotropin (HCG, a product of Beijing Solbo Biotechnology Co., Ltd.) to induce ovulation. On the night of HCG injection, female mice were mated with male mice at a 2:1 ratio. Synchronized estrus female mice were mated with castrated male mice to serve as surrogate mothers. The following day, female mice with vaginal plugs were euthanized, and the oviducts were dissected and placed in culture medium on a 37°C heated plate. Embryos were flushed from the ampulla of the oviduct until cumulus cells detached, and then transferred to fresh KSOM embryo culture medium (Merck, MR-101-D) for repeated flushing. A mixture of in vitro transcribed and purified Cas9 mRNA, sgRNA-A1, and donor oligonucleotides (Cas9 mRNA, sgRNA-A1, and donor oligonucleotides in a mass ratio of 3:1:2) was injected into the pronucleus of mouse zygotes. Fertilized eggs were cultured to the two-cell stage in an incubator. Embryos with intact morphology and good cell division were then transferred to the oviducts of surrogate mother mice for natural development until full term. For F0 generation mice, genomic DNA was extracted from tail sections and identified using specific primers (SEQ ID NO.11-SEQ ID NO.12). PCR products were sequenced to confirm editing of the GDF11 promoter region, yielding homozygous Mu mice.

[0066] 2. Exercise experiment of mice on a treadmill

[0067] Endurance tests were conducted on 5-month-old homozygous Mu mice (n=10) and wild-type mice (n=10). To acclimatize these mice to a treadmill (model XR-PT-10B, Shanghai Xinrun Information Technology Co., Ltd., Shanghai, China), they were trained for three consecutive days to walk at a speed of 10 m / min for 1 minute each day before the formal experiment. Motor performance was assessed by exhaustion time. In the exhaustion test, the mice were fasted for 6 hours before exercise. They were placed on a treadmill with an 11° inclined track. The exercise protocol began with an activated electric shock grid at a speed of 10 m / min for 30 seconds. The speed was then increased by 1 m / min every 3 minutes until reaching 20 m / min, and maintained at this speed until exhaustion. The electric shock parameters were set as follows: intensity 2 mA, tolerance time 10 seconds, and frequency 50 Hz. Once the system detected exhaustion in the experimental animal through stimulus feedback, it automatically recorded the exhaustion time and immediately stopped the stimulation.

[0068] 3. Echocardiographic examination of mice

[0069] Five-month-old homozygous Mu (n=10) and wild-type (WT) mice underwent echocardiography to assess heart rate and cardiac function. Prior to measurement, hair was removed from the chest and abdomen using small animal electric scissors, and the chest area was cleaned with depilatory cream (Lurankino; Ucsys, Guangzhou, China) to reduce ultrasound attenuation. Mice were placed on a heating pad to maintain normal body temperature. Anesthesia was administered using isoflurane via a universal animal anesthesia machine (RWD-R620-S1, Shenzhen, China). Isoflurane induction was performed by the same operator: mice were placed in the anesthesia induction chamber and pre-anesthetized with 2% isoflurane for 2 minutes. Anesthetized mice were then fixed in a supine position on the animal operating platform with their noses placed in a specialized mask with a small nasal cone and treated with 1.5% isoflurane. Acoustic coupling gel (Morphan, Shanghai, China) was applied to the chest surface to optimize visualization of the cardiac chambers and myocardial wall motion. Cardiac ultrasound examination was performed using the Philips HD11XE ultrasound system (Philips, Netherlands) and equipped with the L15-7io probe (Philips, Netherlands).

[0070] 4. MicroCT scanning and analysis of bone mineral density in mouse skeletons

[0071] Micro-computed tomography (MicroCT) analysis was performed on the femurs of 4-month-old homozygous Mu (n=3) and wild-type mice (n=3) to assess skeletal differences by measuring basic skeletal parameters. Skeletal measurements were performed using a Skyscan 1276 X-ray micro-computed tomography scanner (MicroCT, Bruker, USA). All measurements and analyses were performed using the Scaner software of the Skyscan 1276 MicroCT. During the examination, the mouse femurs were scanned at a voltage of 60 kV, a current of 200 μA, and a scan resolution of 6.5 μm. Three-dimensional image reconstruction was performed using NRecon software (v.1.6.9), and three-dimensional analysis was performed using CTAn (v.1.18) software, while bone mineral density (BMD) in the region of interest was measured. The baseline was set at the bottom end of the femoral genu growth plate, and the medullary canal region 1 mm below it was defined as the region of interest (ROI 1) for three-dimensional reconstruction.

[0072] 5. Staining

[0073] Immunofluorescence was performed on the hearts of 11-month-old female MT (n=6) and WT (n=6) mice to label sympathetic and parasympathetic nerve fibers with tyrosine hydroxylase (Th) and vesicular acetylcholine transporter (VAChT), respectively. Mice were deeply anesthetized by intraperitoneal injection of 15% urethane, perfused with 20 mL of 1×PBS followed by 20 mL of 4% paraformaldehyde (PFA). The hearts were fixed overnight in 4% PFA at 4°C, cryoprotected in 20% and 30% sucrose, embedded in the optimal cutting temperature (OCT), frozen at -80°C, and sectioned at 50 μm. Sections were blocked in PBST containing 2% BSA for 2 hours, and then subjected to primary antibodies (rabbit anti-th, Sigma-Aldrich T8700, 1:100; goat anti-vacht, Millipore ABN100, 1:100) at 4°C. After washing with PBST, sections were incubated with secondary antibodies (goat anti-rabbit - Alexa Fluor 488, Thermo Fisher Scientific A-11008; donkey anti-goat - Alexa Fluor 555, Abcamab150130, 1:500) in room temperature for 1 hour, reverse stained with DAPI, washed, and mounted. Imaging was performed on a Leica confocal laser scanning microscope (LSCM, Leica Microsystems, Heidelberg, Germany), and nerve density was quantified using FIJI / ImageJ (v. 2.14.0).

[0074] 6. Results

[0075] Experimental results are as follows Figure 3 and Figure 4 As shown. The results showed that: In this embodiment, tyrosine hydroxylase (Th) and vesicular acetylcholine transporter (VAChT) immunostaining was used to observe the sympathetic and parasympathetic nerves that jointly innervate the heart rate. The results showed that GDF11 gene-edited mice (MT) were Th-positive (Student's t-test, P=1.71×10⁻⁶). -5The density of nerves in wild-type mice and Vächt-positive (Student's-test, P=0.00717) mice was significantly higher than that in wild-type controls, increasing by 99.26% and 124.33%, respectively, indicating enhanced and younger cardiac nerve distribution. Resting heart rate, hair, femoral bone mineral content, bone surface area, bone volume, bone cross-sectional area, and trabecular pattern factor were investigated in wild-type and GDF11 gene-edited mice. GDF11 gene-edited mice had significantly lower resting heart rate than wild-type mice. At the same age (13 months), wild-type mice showed white hair, while GDF11 gene-edited mice did not. Compared to wild-type mice, GDF11 gene-edited mice showed significantly increased femoral bone mineral content, bone surface area, bone volume, and bone cross-sectional area, significantly decreased trabecular pattern factor, decreased sense of smell, and significantly increased exhaustion time during exercise over three consecutive days. In conclusion, GDF11 gene-edited mice exhibit lower heart rate and delayed aging.

[0076] The embodiments described above are merely preferred embodiments of the present invention and are not intended to limit the scope of the present invention. Various modifications and improvements made by those skilled in the art to the technical solutions of the present invention without departing from the spirit of the present invention should fall within the protection scope defined by the claims of the present invention.

Claims

1. The functional control region in the promoter region of the GDF11 gene, characterized in that, The conserved motif of the functional control region is CCAAT; the conserved motif is located at bases -194 to -198 of the GDF11 gene promoter.

2. The application of the functional control region described in claim 1 in constructing mutants regulating GDF11 gene activity, characterized in that, The mutated sequence is located at bases -194 to -198 of the GDF11 gene promoter, and the sequence after the mutation at bases -194 to -198 is CCAAT.

3. A mutant regulating the activity of the GDF11 gene, characterized in that, The mutant sequence is located at bases -194 to -198 of the GDF11 gene promoter, and the sequence after the mutation at bases -194 to -198 is CCAAT; the accession number of the GDF11 gene promoter is NM_010272.

2.

4. A biomaterial comprising the mutant of claim 3.

5. The use of the functional control region of claim 1, the mutant of claim 3, or the biomaterial of claim 4 in any of the following: (1) Preparation of drugs to lower heart rate; (2) Preparation of anti-aging drugs; (3) To prepare drugs that prolong life; (4) Construct animal models of reduced resting heart rate and / or delayed aging.

6. A drug for lowering heart rate, anti-aging, or prolonging life, characterized in that, The drug comprises the functional control region of claim 1, the mutant of claim 3, or the biological material of claim 4.

7. An sgRNA targeting the functional control region of claim 1, characterized in that, The nucleotide sequence of the sgRNA is shown in any one of SEQ ID NO.27-SEQ ID NO.

29.

8. The use of the sgRNA according to claim 7 in any of the following: (1) Preparation of drugs to lower heart rate; (2) Preparation of anti-aging drugs; (3) To prepare drugs that prolong life; (4) Construct animal models of reduced resting heart rate and / or delayed aging.

9. A drug for lowering heart rate, anti-aging, or prolonging life, characterized in that, The drug comprises the sgRNA of claim 7.

10. A method for constructing an animal model of decreased resting heart rate and / or delayed aging, characterized in that, Includes the following steps: Construct a Cas9 / gRNA expression plasmid containing the sgRNA described in claim 7, and obtain Cas9 mRNA and sgRNA by in vitro transcription; Cas9 mRNA, sgRNA and donor oligonucleotides were co-injected into fertilized eggs and transplanted into the oviduct of surrogate animals to obtain gene-edited animals, thus obtaining the animal model of reduced resting heart rate and / or delayed aging; the sequence of the donor oligonucleotide is shown in SEQ ID NO.30.