Application of TGFB1I1 in prognosis and treatment of acute myeloid leukemia

Abstract

The invention provides an application of TGFB1I1 in prognosis and treatment of acute myeloid leukemia. Through database analysis and clinical index conjoint analysis, it is verified that the abnormally high expression of TGFB1I1 and t (8; the invention discloses that TGFB1I1 can be used as a high correlation between relapse and poor prognosis of t (8, 21) type AML (acute myeloid leukemia). 21) type AML prognosis recurrence risk markers are provided. It is further verified through in-vitro cell experiments that inhibition of expression of TGFB1I1 can induce AML cell apoptosis and significantly inhibit cell proliferation, and Kasumi-1 cells are promoted to differentiate into megakaryocytes. It is shown that TGFB1I1 is t (8; the risk marker of the (21) type AML can be used as a target spot for AML treatment, and a new direction is provided for AML treatment.

Description

Technical Field

[0001] This invention belongs to the field of medical biotechnology and relates to the application of TGFB1I1 as a biomarker for acute myeloid leukemia (AML), especially t(8;21) AML, specifically its application in assessing the prognosis and treatment of t(8;21) AML. Background Technology

[0002] Acute myeloid leukemia (AML) is a highly heterogeneous hematologic malignancy caused by various specific gene mutations (such as FLT3, NPM1, DNMT3A, and fusion genes), characterized by clonal expansion of myeloid blast cells in the bone marrow and / or other tissues. AML accounts for approximately 28% of acute leukemia cases in adults, but its five-year survival rate is only 31.7%, making it the subtype with the lowest survival rate among leukemias. The five-year survival rate varies significantly across age groups: approximately 62% for patients under 50 years old, 37% for patients aged 50-64, and only 9.4% for patients aged 65 and older. With the increasing prominence of population aging, the incidence of AML has been rising annually over the past decade; therefore, research and treatment of AML have become crucial issues requiring urgent attention and significant investment.

[0003] Approximately half of AML patients have non-random chromosomal translocations, including balanced translocations and chromosomal number abnormalities. The four most common translocations are 11q23 / mixed lineage leukemia (MLL)-fusion protein, t(15;17) / PML-RAR, Inv(16) / core binding factor (CBF)b-MYH11, and t(8;21) / RUNX1-RUNX1T1. Key molecular alterations caused by these events can promote tumor cell proliferation and anti-apoptosis, leading to AML transformation. The RUNX1::RUNX1T1 fusion protein, resulting from a translocation of chromosomes 8 and 21, is the most common oncogenic fusion protein in AML; however, there are currently no specific targeted drugs for RUNX1::RUNX1T1 in clinical practice. Although t(8;21) AML patients generally respond well to initial chemotherapy and have a relatively optimistic prognosis, their high clinical and biological heterogeneity leads to a relapse rate of up to 40%, with low survival rates after relapse.

[0004] Although novel therapies such as molecularly targeted therapy, monoclonal antibodies, bispecific monoclonal antibodies, immune checkpoint-related antibodies, and chimeric antigen receptor-modified T-cell (CAR-T) therapy have been shown to benefit some refractory / relapsed AML patients, their clinical application is limited by high costs, lengthy clinical trial cycles, and high complication rates. Currently, there are no standardized salvage treatment options for elderly patients, those with poor performance status, those with multiple comorbidities, and those with refractory / relapsed AML. Furthermore, AML treatments face a series of challenges, including low clinical response rates, high relapse rates, and tolerability issues. Therefore, researching efficient, cost-effective treatments with fewer adverse reactions and developing new cellular and gene targets are crucial for improving the prognosis and survival of AML patients.

[0005] Leukemia stem cells (LSCs) express a large number of proteins associated with multidrug resistance, possess strong anti-apoptotic capabilities, and are primarily in the quiescent phase (G0 phase), making them insensitive to conventional chemotherapy drugs and able to evade chemotherapy and radiotherapy. When LSCs enter the cell cycle, they rapidly proliferate and become a source of leukemia relapse, a significant reason for the persistence of the leukemia pathology. Therefore, LSC resistance to chemotherapy drugs is a major challenge in leukemia treatment. Based on these unmet needs in AML treatment, identifying and developing AML-related tumor markers that can both influence AML proliferation and inhibit relapse, and developing corresponding targeted small molecule inhibitors, will help improve the efficacy of AML treatment, restore patients' anti-tumor immunity, and ultimately prolong patient survival.

[0006] Transforming growth factor β-1-induced transcript 1 (TGFB1I1), initially identified as a gene induced by H2O2 and TGF-β1, is a protein containing the focal adhesion scaffold LIM. TGFB1I1 is highly expressed in vascular smooth muscle cells of various organs and can shuttle between the focal adhesion and the nucleus in response to oxidants. Furthermore, TGFB1I1 is involved in the transcriptional regulation of multiple genes: TGFB1I1 has been reported to upregulate TGF-β signaling by directly interacting with and neutralizing Smad7 in myofibroblast cell lines; Xue Liang et al. (The roles and mechanisms of TGFB1 in acute myeloid leukemia chemoresistance. Cell Signal. 2024 Apr; 116:111027.) found significantly elevated TGFB1 levels in patients with relapsed or refractory (R / R) AML and drug-resistant strains, and that blocking the TGFB signaling pathway could enhance the chemosensitivity of drug-resistant cells by inhibiting SOX4 expression and metabolic reprogramming. As a factor that induces TGFB1 expression, and considering the effects of TGFB1I1 molecules on tumor cells and the immune microenvironment, it is speculated that it could be explored as a potential therapeutic target in AML. Summary of the Invention

[0007] Based on the above research, this invention aims to provide new biomarkers and therapeutic targets for assessing the prognostic recurrence risk of AML, especially t(8;21) AML.

[0008] The technical approach of this invention is as follows: Preliminary research was conducted on the target gene TGFB1I1 of RUNX1::RUNX1T1, and clinical studies revealed that high expression of TGFB1I1 was significantly associated with patient relapse and poor prognosis. Furthermore, transcriptome sequencing (RNA-seq) was performed on bone marrow mononuclear cell samples from healthy individuals and patients with newly diagnosed and relapsed AML. The results showed that TGFB1I1 expression was significantly higher in both newly diagnosed and relapsed AML patients than in the healthy group. Simultaneously, RNA-seq was performed by knocking down TGFB1I1 in AML cells, revealing that knocking down TGFB1I1 could induce AML cell apoptosis and significantly inhibit its proliferation by regulating megakaryocyte differentiation and platelet function signaling pathways. Therefore, it is hypothesized that TGFB1I1 can serve as a target for the diagnosis and treatment of t(8;21) AML leukemia.

[0009] The first objective of this invention is to provide the use of TGFB1I1 in the preparation of a diagnostic and prognostic assessment kit for t(8;21) type AML and the corresponding prognostic assessment kit; the second objective is to provide the use of TGFB1I1 inhibitors in the preparation of pharmaceutical compositions for treating t(8;21) type AML, and further to provide compositions using the inhibitor as an active ingredient.

[0010] The specific technical solution adopted in this invention is as follows:

[0011] In a first aspect, the present invention provides the use of TGFB1I1 in the preparation of a diagnostic and prognostic assessment kit for t(8;21) type AML.

[0012] Preferably, the kit includes reagents for detecting the expression level of TGFB1I1 in biological samples. In the specific embodiments section of this invention, transcriptome sequencing (RNA-seq) is used to detect the expression level of TGFB1I1; therefore, the kit provided by this invention includes reagents for performing transcriptome sequencing (RNA-seq) on bone marrow mononuclear cells extracted from biological samples.

[0013] Of course, the expression level of TGFB1I1 can also be detected by quantitative PCR amplification. The primer sequences for qPCR amplification are as follows:

[0014] Forward sequence: TACAGCACGGTATGCAAGCC (SEQ ID NO.1);

[0015] Reverse sequence: GCAACCGATCTAGCTCACAGAG (SEQ ID NO.2).

[0016] Therefore, the kit of the present invention may also contain PCR primers for specific detection of TGFB1I1, the primer sequences of which are shown in SEQ ID NO.1-2.

[0017] In a further preferred embodiment, the biological sample described in this invention is selected from the patient's bone marrow tissue, from which bone marrow mononuclear cells can be extracted for transcriptome sequencing (RNA-seq), or DNA can be extracted and then amplified by PCR.

[0018] In a second aspect, the present invention provides a diagnostic and prognostic kit for t(8;21) type AML, which includes reagents for detecting the expression level of TGFB1I1 in biological samples.

[0019] As described above, the reagent is preferably a reagent for performing transcriptome sequencing (RNA-seq) on bone marrow mononuclear cells extracted from biological samples, or a PCR primer for specifically detecting TGFB1I1, with primer sequences as shown in SEQ ID NO.1-2 above.

[0020] In a third aspect, the present invention provides the use of a TGFB1I1 inhibitor in the preparation of a pharmaceutical composition for treating t(8;21) type AML.

[0021] TGFB1I1 inhibitors can be selected from small molecule compounds that inhibit TGFB1I1, reagents that inhibit or silence the TGFB1I1 gene, or reagents that promote TGFB1I1 protein metabolism.

[0022] In the specific embodiments section of this invention, TGFB1I1 shRNA was used as a TGFB1I1 inhibitor, and the results showed that it could delay the occurrence of AML mouse leukemia.

[0023] The nucleic acid sequence of the TGFB1I1 shRNA is shown below:

[0024] shTGFB1I1-1350:CGGTTGCTTCAGGAACTTAAT (SEQ ID NO.3);

[0025] shTGFB1I1-0099: CGGTTGCTTCAGGAACTTAAT (SEQ ID NO. 4).

[0026] In a fourth aspect, the present invention provides a pharmaceutical composition for treating t(8;21) type AML, comprising an active component and a carrier, wherein the active component comprises the aforementioned TGFB1I1 inhibitor.

[0027] The beneficial protections and effects of this invention are as follows:

[0028] This invention, through database analysis and combined analysis with clinical indicators, verified a strong correlation between abnormally high expression of TGFB1I1 and relapse and poor prognosis of t(8;21) type AML, revealing that TGFB1I1 can serve as a biomarker for the risk of relapse in t(8;21) type AML. Further in vitro cell experiments verified that inhibiting TGFB1I1 expression induces AML cell apoptosis and significantly inhibits cell proliferation, while promoting Kasumi-1 cell differentiation into megakaryocytes. The findings of this invention demonstrate that TGFB1I1 is a risk biomarker for t(8;21) type AML and can serve as a target for AML treatment, providing a new direction for AML therapy. Attached Figure Description

[0029] Figure 1 The diagram shows high expression of TGFB1I1 in t(8;21) AML patient cells: A: Venn diagram of upregulated genes and TGFβ signaling pathway genes in t(8;21) AML (AML-M2) patients and AML relapsed patients compared to normal controls; B: CD34+ Venn diagram of genes upregulated after RUNX1::RUNX1T1 overexpression in HSC cells and genes downregulated after RUNX1::RUNX1T1 knockdown in kasumi-1 cells, and genes of the TGFβ signaling pathway; C: Heatmap of TGFβ signaling pathway gene expression levels in normal individuals, AML-M2, and AML relapse patients; D: GSEA analysis results of genes upregulated in AML-M2 patients compared to normal individuals.

[0030] Figure 2 The study showed that TGFB1I1 was highly expressed in AML patient cells and was significantly associated with poor prognosis: A: TGFB1I1 expression in AML and healthy individuals in the GEPIA database; B: TGFB1I1 expression in t(8;21) AML and healthy individuals in the MILE database; C: TGFB1I1 expression in an AML-M2 patient at initial onset, partial remission after treatment, and complete remission; D: TGFB1I1 expression in bone marrow mononuclear cells of 8 newly diagnosed AML patients, 5 relapsed AML patients, 8 AML patients in complete remission, and 6 healthy individuals; E: The relationship between TGFB1I1 expression and prognosis in the TCGA database.

[0031] Figure 3 The results show that TGFB1I1 knockdown leads to inhibited proliferation and increased apoptosis in AML cells: A: qPCR verification of the TGFB1I1 knockdown effect in Kasumi-1 cells; B: CKK8 assay to observe the effect of TGFB1I1 knockdown on cell proliferation in Kasumi-1 cells; C: Flow cytometry to observe the effect of TGFB1I1 knockdown on apoptosis in Kasumi-1 cells; D and E: Statistical results of Figure C.

[0032] Figure 4 The results of GSEA analysis of RNA-seq from TGFB1I1 knockdown cells were shown. TGFB1I1 knockdown promotes megakaryocyte differentiation: A, the formation of the β-CATENIN-TCF transcriptional activation complex; B, the regulation of megakaryocyte differentiation and platelet function-related genes by the reactant RUNX1. Detailed Implementation

[0033] The implementation of the present invention will be described in detail below with reference to the embodiments of the present invention. The following embodiments are implemented under the premise of the technical solution of the present invention, and detailed implementation methods and specific operation processes are given. However, the protection scope of the present invention is not limited to the following embodiments.

[0034] Unless otherwise specified, the experimental methods used in the following examples are conventional methods, performed according to the techniques or conditions described in the literature in this field or according to the product instructions. Unless otherwise specified, the materials and reagents used in the following examples are commercially available.

[0035] I. TGFB1I1 is highly expressed in t(8;21) AML patients with initial and relapsed disease.

[0036] A Venn diagram was used to compare upregulated genes and TGFβ signaling pathway genes in normal individuals, t(8;21) AML (AML-M2) patients, and AML relapsed patients. The results are as follows: Figure 1 As shown in A; simultaneously analyze CD34. + Venn diagram of genes upregulated by RUNX1::RUNX1T1 overexpression in HSC cells, genes downregulated by RUNX1::RUNX1T1 knockdown in kasumi-1 cells, and genes in the TGFβ signaling pathway. Figure 1 B). It was found that the expression level of TGFB1I1 was significantly increased when RUNX1::RUNX1T1 was overexpressed, and the expression level of TGFB1I1 was significantly decreased after RUNX1::RUNX1T1 was knocked down, indicating that TGFB1I1 is a key gene in AML in the TGFβ signaling pathway.

[0037] A heatmap analysis of TGFβ signaling pathway gene expression levels in healthy individuals, AML-M2 patients, and AML relapsed patients, combined with GSEA analysis of upregulated genes in AML-M2 patients, revealed increased TGFB1I1 gene expression in AML-M2 and AML relapsed patients compared to healthy individuals. Figure 1 C), and GSEA analysis of upregulated genes in AML-M2 patients compared to normal individuals showed that TGFB1I1 was enriched in several signaling pathways. Figure 1 D) indicates that TGFB1I1 plays an important role in t(8;21)AML, i.e., AML-M2.

[0038] II. TGFB1I1 expression was significantly correlated with t(8;21) AML recurrence and prognosis.

[0039] Analysis of the GEPIA database revealed that TGFB1I1 expression in t(8;21) AML patient cells was significantly higher than that in normal individuals. Figure 2 A and 2B), and high expression is associated with poor prognosis ( Figure 2E). This indicates the feasibility of treating AML by screening for small molecule inhibitors of TGFB1I1. Furthermore, we performed RNA-seq sequencing on samples from 8 newly diagnosed AML patients, 5 relapsed AML patients, 8 AML patients in complete remission, and 6 healthy controls' bone marrow mononuclear cells. The results showed that, compared with normal controls, the expression of TGFB1I1 was significantly upregulated in both newly diagnosed and relapsed AML patients (E). Figure 2 D). Notably, one patient had the highest TGFB1I1 expression at initial onset, which decreased by half after partial remission, and was almost completely absent after complete remission. Figure 2 C). III. Knockdown of TGFB1I1 induces apoptosis in AML cells and significantly inhibits cell proliferation.

[0040] To clarify the role of TGFB1I1 in t(8;21) leukemia, we packaged the virus with the TGFB1I1 shRNA plasmid to infect t(8;21) AML cells and studied the effect of TGFB1I1 knockdown on cell growth and proliferation in Kasumi-1 cells. Since the shRNA plasmid expresses a puromycin reporter gene downstream of the TGFB1I1 short hairpin sequence as a marker, we used puromycin to screen positive LSC cells 48 hours after infection with the TGFB1I1 shRNA virus.

[0041] The results are as follows Figure 3 As shown, compared with the control group, the mRNA and protein expression levels of TGFB1I1 in Kaumi-1 cells of the TGFB1I1 shRNA knockdown group were significantly reduced, indicating that the TGFB1I1 knockdown cell model constructed using shRNA was successfully established (3A); the CCK8 assay showed that the proliferation efficiency of Kaumi-1 cells decreased significantly after 48 h of puromycin screening ( Figure 3 B); Simultaneously, flow cytometry analysis of apoptosis experiments showed that, compared to the control group, in TGFB1I1 Early apoptotic cells of Kaumi-1 cells (Annexin-V) in the knockdown group + PI - Significantly increased ( Figure 3 C and 3D), late apoptosis (Annexin-V) + PI + ) also increased significantly ( Figure 3 C and 3E).

[0042] IV. Knockdown of TGFB1I1 promotes megakaryocyte differentiation

[0043] RNA-seq and GSEA analysis of TGFB1I1 knockdown Kasumi-1 cells revealed a significant enrichment of RUNX1-regulated genes involved in megakaryocyte differentiation and platelet function after TGFB1I1 knockdown. Figure 4 This suggests that knocking down TGFB1I1 may promote the differentiation of Kasumi-1 cells into megakaryocytes.

[0044] The embodiments of the present invention have been described in detail above, but the present invention is not limited to the embodiments described. Those skilled in the art can make various equivalent modifications or substitutions without departing from the spirit of the present invention, and these equivalent modifications or substitutions are all included within the scope defined by the claims of this application.

Claims

1. Use of TGFB1I1 in the preparation of a diagnostic and prognostic kit for t(8;21) type AML.

2. The use according to claim 1, characterized in that, The kit contains reagents for detecting the expression level of TGFB1I1 in biological samples.

3. The use according to claim 1, characterized in that, The reagents are selected from reagents for genome sequencing of DNA extracted from biological samples, or PCR primers for specific detection of TGFB1I1, and the primer sequences are shown in SEQ ID NO.1-2.

4. The use according to claim 1, characterized in that, The biological sample was selected from the patient's bone marrow tissue.

5. A diagnostic and prognostic assessment kit for t(8;21) type AML, characterized in that, It contains reagents for detecting the expression level of TGFB1I1 in biological samples.

6. The early obesity assessment kit according to claim 5, characterized in that: in, The reagents comprise reagents for genome sequencing of DNA extracted from biological samples, or PCR primers for specific detection of the TGFB1I1, the primer sequences of which are shown in SEQ ID NO.1-2.

7. Application of TGFB1I1 inhibitors in the preparation of drug compositions for treating t(8;21) type AML.

8. The application according to claim 7, characterized in that, The inhibitor is selected from TGFB1I1 shRNA, and its nucleic acid sequence is shown in SEQ ID NO.3 and 4.

9. A pharmaceutical composition for treating t(8;21) type AML, characterized in that, It includes an active component and a carrier, wherein the active component includes the TGFB1I1 inhibitor as described in claim 7 or 8.

Images