Primer combination, kit and identification method for parrot-shaped species identification
By designing specific primer combinations and long-read sequencing technology, the problems of insufficient information and sample quality limitations in parrot species identification have been solved, achieving high-precision identification of parrot species, especially the differentiation of closely related species, which is applicable to forensic identification and biodiversity monitoring.
Patent Information
- Application Number
- CN202610109664.4
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2026-01-27
- Publication Date
- 2026-03-03
AI Technical Summary
Existing parrot species identification technologies suffer from insufficient information from short fragments of single genes, making it difficult to effectively distinguish closely related species; low success rates in detecting trace or degraded samples; and a lack of efficient and accurate methods for obtaining full-length mitochondrial genome information, which makes it difficult to meet the needs of forensic identification, smuggling tracing, and biodiversity monitoring.
Design a method that includes a specific primer combination to amplify mitochondrial DNA fragments of at least 8000 bp in length, and combine it with long-read sequencing technology to obtain full-length mitochondrial genome information via nanopore or PacBio SMRT sequencing, suitable for the identification of Psittaciformes species.
It enables high-precision identification of Psittaciformes species, especially suitable for distinguishing closely related species. It can successfully obtain complete mitochondrial genome information from degraded or trace samples, and is suitable for high-throughput scenarios such as forensic identification and biodiversity monitoring.
Smart Images

Figure CN121592783A_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of DNA identification technology, and in particular to a primer combination, kit, and identification method for identifying Psittaciformes species. Background Technology
[0002] Birds of the order Psittaciformes, including parrots, macaws, budgerigars, and many other families and genera, are widely distributed in tropical and subtropical regions worldwide and possess extremely high ecological, economic, and ornamental value. However, these birds often exhibit a high degree of morphological similarity, especially in their juvenile, subadult, or egg stages. This poses a significant challenge to traditional morphological identification methods that rely on plumage color and body shape, leading to a substantial decrease in accuracy. In cases involving the illegal trade and smuggling of wildlife, criminals often evade regulations by transporting bird eggs or using trace samples such as feathers or damaged parts. These incomplete or severely degraded samples further highlight the limitations of traditional morphological identification.
[0003] To overcome the limitations of morphological identification, DNA barcoding technology has become the mainstream molecular method for species identification. This technology typically uses short fragments from mitochondrial genes, such as cytochrome c oxidase subunit I (COI), cytochrome b (Cytb), 12S rRNA, and 16S rRNA, as standard barcodes for PCR amplification and sequencing comparison. However, when applied to the highly diverse and closely related orders of Psittaciformes, the amount of genetic information provided by a single fragment is limited, often insufficient for accurate differentiation between species or even subspecies. The uneven coverage of barcode sequences in public databases (such as GenBank)—currently only about 77.33% of Psittaciformes species have usable single-gene barcode sequences—also severely restricts the reliability of identification results. Furthermore, short-fragment-based PCR amplification has poor compatibility with degraded DNA samples (such as historical specimens, weathered skeletons, and shed feathers), and when designing multiplex PCR primers covering multiple species, insufficient primer universality often leads to amplification bias, resulting in the loss of information from some species.
[0004] Existing technologies include mitochondrial fragment amplification methods based on Sanger sequencing or Illumina high-throughput sequencing. While Sanger sequencing offers high accuracy, its low throughput and high cost make it unsuitable for large-scale sample screening. Although second-generation sequencing technologies like Illumina improve throughput, their read lengths are limited (typically 100-600 bp). When assembling the full-length mitochondrial genome, they struggle to traverse complex regions such as repetitive sequences or hypervariable areas, resulting in a cumbersome assembly process and a tendency to lose important structural information. Consequently, they have inherent limitations in resolving subtle genomic differences between closely related species.
[0005] In summary, existing parrot species identification technologies suffer from the following core problems: insufficient information from short single-gene fragments, making it difficult to effectively distinguish closely related species; low success rate in detecting trace or degraded samples; and a lack of an integrated solution capable of efficiently and accurately acquiring full-length mitochondrial genome information, applicable to high-throughput, standardized applications such as forensic identification, smuggling tracing, species database establishment, and biodiversity monitoring. Therefore, developing a technology that overcomes these shortcomings and enables rapid and accurate identification of Psittaciformes species from complex samples has become a critical issue urgently needing to be addressed in this field. Summary of the Invention
[0006] The technical problem to be solved by the present invention is to overcome the shortcomings and defects mentioned in the background art and to provide a primer combination, kit and identification method for the identification of parrot species based on long read sequencing, so as to identify parrot species efficiently and accurately.
[0007] To address the above problems, the present invention proposes the following technical solution: In a first aspect, the present invention provides a primer combination for the identification of Psittaciformes species, the primer combination comprising the following two pairs of primers: The first pair of primers has the following sequence: SEQ ID NO.1:GAACCTACACAAAAGGAATCAAAAT; SEQ ID NO.2: AACTTCTATTTTTAGGGTCACGGTC; The second pair of primers has the following sequence: SEQ ID NO.3: GACCGTGACCCTAAAAATAGAAGTT; SEQ ID NO.4:ATTTTGATTCCTTTTGTGTAGGTTC.
[0008] A further technical solution is that the primer combination is used to amplify mitochondrial DNA fragments with a length of not less than 8000 bp, preferably 8000 bp to 10000 bp.
[0009] A further technical solution is that the primer is a variant containing one or more degenerate bases based on the sequence shown in SEQ ID NO.1 to NO.4.
[0010] A further technical solution is that the degenerate base is located at the 3' end, the middle region, or the 5' end of the primer.
[0011] In a second aspect, the present invention provides a kit for identifying Psittaciformes species, comprising the primer combination described in the first aspect.
[0012] A further technical solution includes library preparation reagents for performing long-read sequencing on the amplification products of the primer combination.
[0013] A further technical solution is that the library preparation reagent is suitable for nanopore sequencing or PacBio SMRT sequencing.
[0014] A further technical solution includes a high-fidelity DNA polymerase, such as Phanta Max, Q5, or KAPAHiFi high-fidelity DNA polymerase.
[0015] Thirdly, the present invention provides a method for identifying species of the order Psittaciformes, comprising the following steps: S1. Extract genomic DNA from the sample to be tested; S2. Using the primer combination described above, long-fragment PCR amplification is performed on the mitochondrial DNA in the genomic DNA to obtain the amplification product; S3. Perform long-read sequencing on the amplified product to obtain the sequencing sequence; S4. Compare the sequencing sequence with the database to complete species identification.
[0016] A further technical solution is that the amount of starting template DNA in the identification method is in the picogram to nanogram range or above.
[0017] A further technical solution is that the sample to be tested includes a degraded or mixed sample, selected from at least one of feathers, blood, bones, eggs, or environmental DNA samples.
[0018] Fourthly, the present invention also provides the use of the primer combination, the reagent kit, or the identification method in wildlife forensic identification, tracing of smuggled samples, or biodiversity monitoring.
[0019] Compared with the prior art, the technical effects achieved by the present invention include: The primer combination provided by this invention for identifying Psittaciformes species is designed targeting conserved regions of the Psittaciformes mitochondrial genome, enabling effective amplification of samples from multiple families and genera within the order Psittaciformes and demonstrating reliable versatility. Furthermore, this primer combination can efficiently and specifically amplify long-fragment products covering the entire length of Psittaciformes mitochondria, providing tens of times more information than short-fragment products. All genetic loci in the mitochondrial genome, including protein-coding genes, rRNA genes, control regions, and intergenic regions, can be used for analysis and comparison, effectively detecting subtle but stable genetic differences between closely related species, thus achieving high-precision identification at the species and even subspecies level. Moreover, due to its ability to efficiently and specifically amplify long-fragment products covering the entire length of Psittaciformes mitochondria, and relying on the resistant degradation of mitochondrial circular structures, even fragmented DNA templates extracted from severely degraded or trace samples can sometimes be successfully assembled into a complete mitochondrial genome through long-fragment amplification and subsequent long-read sequencing, thereby overcoming the stringent limitations of existing technologies regarding sample quality.
[0020] The primer combination provided by this invention, through specific design, enables the amplification of long fragments of the mitochondrial genome of Psittaciformes. It successfully obtains complete mitochondrial sequences from difficult samples that are trace, degraded, or mixed, overcoming the limitations of traditional short-fragment methods on sample quality. Simultaneously, the obtained full-length genome information is extremely rich, providing a reliable genetic basis for high-resolution differentiation of morphologically similar closely related species.
[0021] The kit constructed based on the primer combination provided by this invention is compatible with mainstream long-read sequencing platforms, is easy to operate, and is especially suitable for scenarios requiring high-throughput and standardized output, such as forensic identification, customs inspection, and species database construction.
[0022] The method for identifying Psittaciformes species provided by this invention is efficient and reliable, particularly adept at handling old, trace, or complex samples commonly encountered in forensic evidence collection or field monitoring. By combining long-fragment amplification with long-read sequencing, the final species identification results output by this method achieve species-level or even subspecies-level resolution for Psittaciformes, demonstrating high accuracy. It is applicable to scenarios such as wildlife forensic identification, smuggling tracing, species database construction, and biodiversity monitoring. Attached Figure Description
[0023] To more clearly illustrate the technical solutions of the embodiments of the present invention, the drawings used in the following description of the embodiments will be briefly introduced. Obviously, the drawings described below are some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.
[0024] Figure 1 A flowchart of the method for identifying parrot species provided by the present invention.
[0025] Figure 2 This is a gel electrophoresis image of the long DNA fragment and barcode amplification results in Example 1 of the present invention. Detailed Implementation
[0026] The technical solutions in the embodiments of the present invention will be clearly and completely described below with reference to the accompanying drawings. Obviously, the embodiments described below are only some embodiments of the present invention, and not all embodiments. All other embodiments obtained by those skilled in the art based on the embodiments of the present invention without creative effort are within the scope of protection of the present invention.
[0027] It should be understood that, when used in this specification and the appended claims, the terms "comprising" and "including" indicate the presence of the described features, integrals, steps, operations, elements and / or components, but do not exclude the presence or addition of one or more other features, integrals, steps, operations, elements, components and / or collections thereof.
[0028] It should also be understood that the terminology used in this specification of embodiments of the invention is for the purpose of describing particular embodiments only and is not intended to limit the embodiments of the invention. As used in this specification of embodiments of the invention and the appended claims, the singular forms “a,” “an,” and “the” are intended to include the plural forms unless the context clearly indicates otherwise.
[0029] This invention provides a primer combination for identifying Psittaciformes species, the primer combination comprising the following two pairs of primers: The first pair of primers has the following sequence: SEQ ID NO.1:GAACCTACACAAAAGGAATCAAAAT; SEQ ID NO.2: AACTTCTATTTTTAGGGTCACGGTC; The second pair of primers has the following sequence: SEQ ID NO.3: GACCGTGACCCTAAAAATAGAAGTT; SEQ ID NO.4:ATTTTGATTCCTTTTGTGTAGGTTC.
[0030] It should be noted that sequences SEQ ID NO. 1-4 were chosen for primer design by splitting the full-length parrot mitochondrial genome into dual 8K sequences, considering the operability, cost-effectiveness, and data integrity of the experiment. This approach offers the potential advantage of preserving the high information content of the full-length mitochondrial genome while avoiding the risk of failure associated with amplifying extremely long fragments. Based on this, the mitochondrial genome sequences of 102 publicly published species of Psittaciformes were systematically downloaded and compiled from the NCBI database. The selected sequences cover multiple families and genera, comprehensively reflecting the sequence diversity and conservation characteristics of the mitochondrial genome in parrot groups. Sequence alignment analysis was then performed using MEGA 12.0 software to identify highly conserved regions. Two pairs of long-fragment primers covering the full length of the mitochondria were then designed using Primer3 software. The expected length of each amplified product (i.e., DNA fragment) is no less than 8000 bp, preferably between 8000 bp and 10000 bp. The actual length may vary due to inherent differences in the length of the mitochondrial genome among different Psittaciformes species.
[0031] The primer combination described above can specifically amplify the complete mitochondrial genome of Psittaciformes species. By performing two long-fragment PCRs, a near-complete mitochondrial genome loop can be covered and amplified, avoiding the failure problem caused by the low amplification efficiency of single long fragments, and is especially suitable for partially degraded DNA samples.
[0032] In some embodiments, degenerate bases (e.g., R for A / G, Y for C / T) can be introduced at certain sites in the sequences shown in SEQ ID NO. 1-4. This allows for compatibility with single nucleotide polymorphisms present in different species at this site, thereby reducing amplification bias and improving the primer's ability to capture rare or unknown species. Degenerate bases can be located anywhere in the primer (3' end, middle region, or 5' end). For example, they can be introduced at the 3' end to enhance tolerance to critical mismatches, or in the middle region to cover a wider range of variations. The types of degenerate bases are not limited to R / Y, but may also include S (C / G), W (A / T), K (G / T), etc. Furthermore, the aforementioned "variants" also include derivative sequences based on the sequences of SEQ ID NO. 1-4, with the addition, deletion, or substitution of a few (e.g., 1-3) bases, while maintaining effective binding to the target region and achieving long-fragment amplification. These designs are all within the scope of protection of this invention.
[0033] This invention also provides a kit for identifying Psittaciformes species, comprising the primer combination described above.
[0034] Understandably, kits typically include core primers and key reaction components to enable different operators to reliably and repeatedly complete the entire process from DNA to a sequenceable library. In some embodiments, kits for identifying Psittaciformes species also include library preparation reagents for long-read sequencing of the amplification products of the primer combinations.
[0035] In some embodiments, the library preparation reagents are suitable for nanopore sequencing or PacBio SMRT sequencing. Examples include: end-repair / A-tailing modules, adapter ligation reagents, and purification magnetic beads for nanopore sequencing; or template preparation reagents and polymerase conjugation reagents for PacBio SMRT sequencing. The kit can be configured with general or dedicated library preparation modules suitable for one or more platforms. This invention is not limited to specific brand-name library preparation reagents; any commercially available or self-prepared reagents that achieve the same function are included.
[0036] In some embodiments, the kit for identifying Psittaciformes species also includes a high-fidelity DNA polymerase. Its high fidelity ensures the accuracy of the amplified sequence, avoiding misinterpretations due to amplification errors in subsequent analyses, and successfully amplifying products long enough to be at least 8000 bp (e.g., 8000 bp, 10000 bp, 12000 bp). Suitable high-fidelity DNA polymerases include Phanta Max, Q5, KAPA HiFi, PrimeSTAR GXL, NEB Q5® Hot Start, etc. Other polymerases with high fidelity and long-fragment amplification capabilities can be used equivalently. The composition of the reaction buffer (e.g., Mg...) 2+ The concentration and pH value can be adjusted for adaptability according to the optimal conditions of the selected enzyme, and this invention does not limit these adjustments.
[0037] See Figure 1 This invention also provides a method for identifying species of the order Psittaciformes, comprising the following steps: S1. Extract genomic DNA from the sample to be tested.
[0038] In some embodiments, the test samples include degraded or mixed samples selected from at least one of feathers, blood, bones, eggs, or environmental DNA samples. Mixed samples (such as mixtures of multiple parrot feathers) can be analyzed by sequence clustering after sequencing. Feathers (with follicles), blood (fresh or blood cards), bones (fossils or modern bone fragments), and eggs (egg membranes or shell residues) are typical test targets. Environmental DNA samples refer to mixtures of DNA extracted from habitat soil, water, nest swabs, or smuggling container swabs, requiring specific environmental DNA extraction and enrichment steps.
[0039] In practice, genomic DNA can be extracted from the sample using commercially available genomic DNA extraction kits, such as kits for animal tissues / blood (e.g., DNeasy Blood & Tissue Kit, QIAamp DNAMini Kit), or kits specifically optimized for trace or degraded samples (e.g., QIAseq FX DNA Library Kit). For feather samples, feather follicles or feather roots can be harvested; for bones or eggshells, grinding or decalcification pretreatment is required; for environmental DNA samples, biological material must first be enriched through a filter membrane. The extraction process follows the kit's standard procedures, and the DNA is ultimately dissolved in elution buffer or TE buffer. It should be understood that any method that can effectively release and purify total DNA containing mitochondrial DNA from the sample is suitable for this step.
[0040] S2. Using the primer combination described above, perform long-fragment PCR amplification on the mitochondrial DNA in the genomic DNA to obtain the amplification product.
[0041] In some embodiments, the amount of starting template DNA in the identification method is in the picogram to nanogram range or higher. The identification method of this invention is highly tolerant to varying amounts of starting template DNA. Under optimized conditions, even with a starting template amount as low as 100-500 picograms (pg), specific amplification products for subsequent sequencing and identification can still be successfully obtained by appropriately increasing the number of PCR cycles (e.g., to 35-40 cycles). In routine operation, a template amount of 1-10 nanograms (ng) is sufficient to obtain stable and excellent amplification results. For samples with extremely high DNA concentrations, appropriate dilution is also acceptable.
[0042] In practice, using the specific primer combination provided by this invention for long-fragment PCR amplification is a key step. Exemplary PCR reaction systems and procedures are shown in Tables 1 and 2. The amplification products can be verified by 1% agarose gel electrophoresis; a clear, single target band should appear around approximately 8000 bp.
[0043] Table 1 PCR reaction system Table 2 PCR reaction procedure S3. After mixing the amplification products with equal mass, construct a library and perform long-read sequencing to obtain the sequencing sequence.
[0044] In practice, the amplified products are sequenced to obtain complete sequence information. First, the PCR products are purified using magnetic beads (such as AMPure XP Beads) to remove primers and salts. Then, sequencing libraries are prepared using a library preparation kit compatible with the long-read sequencing platform. For example, for the Oxford Nanopore platform, the Ligation Sequencing Kit can be used, and the steps include DNA end repair / A-tailing, adapter ligation, and library purification; for the PacBio platform, the SMRTbell Prep Kit can be used. After quality control, the prepared libraries are sequenced, such as using the Oxford Nanopore MinION / GridION or PacBio Sequel / Revio system. The sequencing output is a long-read raw signal or sequence file covering the full length of the amplified fragment.
[0045] S4. Compare the sequencing sequence with the database to complete species identification.
[0046] In practice, species identification is accomplished through bioinformatics analysis. First, the raw sequencing data undergoes quality filtering and adapter removal to obtain high-quality sequences. Then, through clustering and correction of mitochondrial genome fragments and parameterized assembly of the entire mitochondrial genome, a complete mitochondrial genome assembly sequence is obtained. These sequences are then compared with a locally constructed or online Psittaciformes mitochondrial genome reference database. The database contains full-length mitochondrial sequences of Psittaciformes downloaded from NCBI GenBank. Identification results are determined based on the highest alignment score and sequence consistency percentage. Finally, an identification report is generated, containing information such as sample ID, matching species, similarity, and coverage.
[0047] Example 1: Species identification verification of multiple parrot samples To verify the effectiveness, universality, and accuracy of the primer combinations, kits, and identification methods described in this invention, representative parrot samples covering multiple genera were selected for testing. The sample type was parrot muscle tissue DNA. The specific implementation process is as follows: DNA extraction from samples Use a standard tissue genome extraction kit, such as the Novizan Animal Tissue Magnetic Bead Extraction Kit.
[0048] 2. Long-fragment PCR amplification Using extracted genomic DNA as a template, long-fragment PCR amplification was performed using the specific primer combination described in this invention (sequences shown in SEQ ID NO. 1-4). The reaction system in Table 1 was used, with approximately 5-10 ng of template DNA. The PCR reaction procedure is shown in Table 2. 5 μL of the amplification product was analyzed by 1% agarose gel electrophoresis. All samples showed a clear, single, bright band around approximately 8000 bp. Figure 2 This indicates that the target fragment was successfully amplified.
[0049] 3. Sequencing library construction and sequencing PCR amplification products were purified using magnetic beads. Subsequently, the purified DNA was end-repaired and ligated using QiCarbon's rapid library construction kit to construct sequencing libraries. The prepared libraries were loaded into a QiCarbon 384-channel sequencing chip and run on a QiCarbon 3841 sequencer to obtain FAST5 sequence data.
[0050] 4. Bioinformatics Analysis and Species Identification The sequencing data were processed using a self-developed bioinformatics analysis workflow. First, QNome QPreasy software was used to identify bases in the fast5 format data, converting them to fastq format sequence files while filtering out low-quality bases with a Q-score < 7. The QNome Barcoding Kit software (QNome QPreasy) was used to split the sequence data of different samples based on barcode labels, removing cross-contamination sequences. NanoFilt software was used to filter and remove low-quality and abnormally long sequences, retaining high-quality sequences with a length between 2000 and 10000 bp and an average Q-score greater than 10 for subsequent analysis. To effectively distinguish between different species origins or different 8K-length amplified fragments in the sequencing results, the study first used isONclust software to perform reference-free sequence clustering on the quality-controlled sequences. Subsequently, for sequences within each independent cluster, multiple sequence alignment was performed using a multiple sequence alignment tool, and further polishing and correction were performed using Medaka software. After obtaining the preliminary consistent sequences, they were aligned to a self-built parrot-specific reference database to accurately identify the species affiliation of each sequence cluster. Sequences determined to originate from the same species were merged, and the genome of the species with the highest alignment score and most complete coverage was selected as the backbone for parameter-based assembly. During assembly, guided by this backbone sequence, contiguous group coverage and omission repair were performed using the consistent sequences. Iterative optimization was used to address the circular structure and highly repetitive regions of the mitochondrial genome, ultimately obtaining the complete mitochondrial genome assembly sequence of the sample. Finally, this consistent sequence was aligned with the locally integrated parrot mitochondrial genome reference database (using the BLASTN algorithm), and the species classification was determined based on the highest sequence similarity. The results are shown in Table 3.
[0051] Table 3. Identification Results As shown in Table 3, high-depth, high-quality full-length or near-full-length mitochondrial genome sequences (range 16,760 bp - 17,942 bp) were successfully obtained from all seven test samples. Through comparison with databases, all samples yielded clear species identification results, with matching similarities exceeding 99.4%. Notably, the sequence of sample A5 (A5_consensus) showed extremely high similarity to the reference sequences of two closely related species, *Aratinga solstitialis* and *Aratinga maculata* (99.78% and 99.69%, respectively), which directly demonstrates that the full-length mitochondrial information provided by this invention can effectively reflect and distinguish subtle genetic differences between closely related species.
[0052] The above results fully demonstrate that the primer combinations, kits, and identification methods provided by this invention can stably and efficiently obtain full-length mitochondrial genome sequences from various types of parrot samples, and achieve high-precision and high-reliability identification at the species level. In particular, they demonstrate a strong ability to distinguish closely related species, fully achieving the intended purpose and technical effect of this invention.
[0053] In the above embodiments, the descriptions of each embodiment have different focuses. For parts that are not described in detail in a certain embodiment, please refer to the relevant descriptions in other embodiments.
[0054] The above description describes specific embodiments of the present invention, but the scope of protection of the present invention is not limited thereto. Any person skilled in the art can easily conceive of various equivalent modifications or substitutions within the technical scope disclosed in the present invention, and these modifications or substitutions should all be covered within the scope of protection of the present invention. Therefore, the scope of protection of the present invention should be determined by the scope of the claims.
Claims
1. A primer combination for identifying Psittaciformes species, characterized in that, The primer combination comprises the following two pairs of primers: The first pair of primers has the following sequence: SEQ ID NO.1:GAACCTACACAAAAGGAATCAAAAT; SEQ ID NO.2: AACTTCTATTTTTAGGGTCACGGTC; The second pair of primers has the following sequence: SEQ ID NO.3: GACCGTGACCCTAAAAATAGAAGTT; SEQ ID NO.4:ATTTTGATTCCTTTTGTGTAGGTTC.
2. The primer combination as described in claim 1, characterized in that, The primer combination is used to amplify mitochondrial DNA fragments with a length of not less than 8000 bp.
3. The primer combination as described in claim 1, characterized in that, The primers are variants based on the sequences shown in SEQ ID NO.1 to NO.4, containing one or more degenerate bases.
4. A kit for identifying Psittaciformes species, characterized in that, Includes the primer combination described in any one of claims 1-3.
5. The kit according to claim 4, characterized in that, It also includes library preparation reagents for performing long-read sequencing on the amplification products of the primer combination.
6. The kit according to claim 4, characterized in that, It also includes high-fidelity DNA polymerase.
7. A method for identifying species of the order Psittaciformes, characterized in that, Includes the following steps: S1. Extract genomic DNA from the sample to be tested; S2. Using the primer combination described in any one of claims 1-3, perform long-fragment PCR amplification on the mitochondrial DNA in the genomic DNA to obtain the amplification product; S3. Perform long-read sequencing on the amplified product to obtain the sequencing sequence; S4. Compare the sequencing sequence with the database to complete species identification.
8. The identification method as described in claim 7, characterized in that, The amount of starting template DNA in the identification method is in the picogram to nanogram range or above.
9. The identification method as described in claim 7, characterized in that, The test sample includes degraded or mixed samples, selected from at least one of feathers, blood, bones, eggs, or environmental DNA samples.
10. The use of the primer combination according to any one of claims 1-3, the kit according to any one of claims 4-6, or the identification method according to any one of claims 7-9 in the forensic identification of wild animals, tracing the source of smuggled samples, establishing a database of Psittaciformes species, or monitoring biodiversity.
Citation Information
Patent Citations
Specific primers for bloody parrot EST (expressed sequence tags) microsatellite markers and application of specific primers
CN104357574A
Primer composition and kit for identifying testudinate species and application of primer composition and kit
CN121087188A
Etchning cleaning composition and method for etching and cleaning using the same
KR1020250141015A