Novel SCN10A RNAi reagents and uses thereof
By designing RNAi reagents that specifically target the SCN10A gene and utilizing the sense and antisense strands to form a double strand, the problems of tolerance and non-selective inhibition in existing pain treatments have been solved, achieving effective management and improved safety for chronic pain.
Patent Information
- Application Number
- CN202480048699.0
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Priority Date
- 2024-03-28
- Filing Date
- 2024-05-23
- Publication Date
- 2026-03-03
AI Technical Summary
Existing pain management methods suffer from tolerability and non-selective inhibition issues, making it difficult to effectively manage chronic pain. Furthermore, there is a lack of effective means to improve pain management, reduce side effects, and enhance safety.
Using novel RNA interference (RNAi) reagents, a doublet is formed by sense and antisense strands to specifically target the SCN10A gene and reduce the expression of the Nav 1.8 sodium channel. This includes the use of oligonucleotides and modified nucleotides with specific sequence identity to bind the delivery portion to improve therapeutic efficacy.
It achieves targeted knockdown of the SCN10A gene, improves pain management, reduces side effects, enhances the safety and tolerability of treatment, and provides longer-lasting pain relief with fewer side effects.
Smart Images

Figure SMS_2 
Figure SMS_3 
Figure SMS_4
Abstract
Description
[0001] References to sequence lists This application is submitted together with a sequence list in ST.26 XML. The sequence list is provided as a file named “30493_WO.xml” created on May 8, 2024, and is 1.7 megabytes in size. The sequence list information in ST.26 XML format is incorporated herein by reference in its entirety [A1.1].
[0002] This invention relates to therapeutic compounds, novel RNA interference (RNAi) agents that reduce the expression of the voltage-gated sodium channel α subunit 10 (SCN10A) gene, said gene encoding Na+. v Subunits of the Nav 1.8 or Nav 1.8 sodium channel. These RNAi agents reduce the level of the intact Nav 1.8 sodium channel and can be used to treat diseases involving the regulation of SCN10A expression and function, such as chronic pain.
[0003] Pain originates in neural pathways in response to signals of tissue damage or potential tissue damage, and may become neuropathic rather than responsive to stimuli. Neuropathic pain tends to be associated with dysfunction within the nervous system and is often chronic.
[0004] Voltage-gated sodium channels (VGSCs) play a crucial role in the generation and propagation of action potentials. Rapid influx of sodium ions via VGSCs generates the rising phase of action potentials in sensory-nociceptive neurons (Blair and Bean, The Journal of Neuroscience, December 1, 2002, 22(23):10277–10290). Nav 1.8 channels, in particular, play a significant role in regulating the firing properties of DRG neurons.
[0005] Chronic pain represents a significant unmet need affecting approximately 25% of the global population. Current treatments result in tolerance and / or non-selective inhibition of multiple VGSCs.
[0006] There remains a need for treatments for pain, including chronic pain, that exhibit, for example, one or more of the following: improved pain management compared to one or more pain therapies, including a greater reduction in pain levels or a longer duration of pain relief; therapies requiring fewer physician visits or lower doses compared to one or more pain therapies; therapies that reduce tolerability; improved toxicity profile; improved safety profile; fewer side effects; and / or improved tolerability. Invention Overview The RNAi reagents disclosed herein for the treatment of pain, including but not limited to chronic pain, may exhibit improved target knockdown, safety, and / or tolerability. The RNAi reagents of this invention may further exhibit additional improved properties, or any combination of two or more of the prior properties.
[0008] Accordingly, in some embodiments, this document discloses an SCN10A RNAi reagent comprising a sense strand and an antisense strand, wherein the antisense strand comprises a sequence complementary to a sequence selected from any of SEQ ID NO: 2-32, wherein the sense strand and the antisense strand form a bistrand. In some embodiments, the bistrand comprises a sense strand and an antisense strand that are complementary across at least 15, 16, 17, 18, 19, 20, or 21 consecutive nucleotides, or across at least 15, 16, 17, 18, 19, 20, or 21 consecutive nucleotides. In some embodiments of the bistrand, the antisense strand comprises a sequence complementary to at least 15, 16, 17, or 18 consecutive nucleotides from any of SEQ ID No: 2-32. In some embodiments of the bistrand, the antisense strand comprises a sequence complementary to 15, 16, 17, or 18 consecutive nucleotides from any of SEQ ID No: 2-32. In some embodiments of the duplex, the sense strand is 21 nucleotides long and contains any one of sequences from 33 to 63. In some embodiments of the duplex, the antisense strand is 23 nucleotides long and contains any one of sequences from SEQ ID NO: 64 to 93.
[0009] In some embodiments, the RNAi reagent comprises a sense strand and an antisense strand, wherein the sense strand and the antisense strand form a duplex, which is formed by a pair of oligonucleotide sequences selected from the following: a. The sense strand has at least 90% sequence identity with SEQ ID NO:33; and the antisense strand has at least 90% sequence identity with SEQ ID NO:64; b. The sense strand has at least 90% sequence identity with SEQ ID NO:34; and the antisense strand has at least 90% sequence identity with SEQ ID NO:65; c. The sense strand has at least 90% sequence identity with SEQ ID NO:35; and the antisense strand has at least 90% sequence identity with SEQ ID NO:66; d. The sense strand has at least 90% sequence identity with SEQ ID NO:36; and the antisense strand has at least 90% sequence identity with SEQ ID NO:67; e. The sense strand has at least 90% sequence identity with SEQ ID NO:37; and the antisense strand has at least 90% sequence identity with SEQ ID NO:68; f. The sense strand has at least 90% sequence identity with SEQ ID NO:38; and the antisense strand has at least 90% sequence identity with SEQ ID NO:69; g. The sense strand has at least 90% sequence identity with SEQ ID NO:39; and the antisense strand has at least 90% sequence identity with SEQ ID NO:70; h. The sense strand has at least 90% sequence identity with SEQ ID NO:40; and the antisense strand has at least 90% sequence identity with SEQ ID NO:71; i. The sense strand has at least 90% sequence identity with SEQ ID NO:41; and the antisense strand has at least 90% sequence identity with SEQ ID NO:72; j. The sense strand has at least 90% sequence identity with SEQ ID NO:42; and the antisense strand has at least 90% sequence identity with SEQ ID NO:73; k. The sense strand has at least 90% sequence identity with SEQ ID NO:43; and the antisense strand has at least 90% sequence identity with SEQ ID NO:74; 1. The sense strand has at least 90% sequence identity with SEQ ID NO:44; and the antisense strand has at least 90% sequence identity with SEQ ID NO:75; m. The sense strand has at least 90% sequence identity with SEQ ID NO:45; and the antisense strand has at least 90% sequence identity with SEQ ID NO:76; n. The sense strand has at least 90% sequence identity with SEQ ID NO:46; and the antisense strand has at least 90% sequence identity with SEQ ID NO:77; o. The sense strand has at least 90% sequence identity with SEQ ID NO:47; and the antisense strand has at least 90% sequence identity with SEQ ID NO:78; p. The sense strand has at least 90% sequence identity with SEQ ID NO:48; and the antisense strand has at least 90% sequence identity with SEQ ID NO:79; q. The sense strand has at least 90% sequence identity with SEQ ID NO:49; and the antisense strand has at least 90% sequence identity with SEQ ID NO:80; r. The sense strand has at least 90% sequence identity with SEQ ID NO:50; and the antisense strand has at least 90% sequence identity with SEQ ID NO:81; s. The sense strand has at least 90% sequence identity with SEQ ID NO:51; and the antisense strand has at least 90% sequence identity with SEQ ID NO:82; t. The sense strand has at least 90% sequence identity with SEQ ID NO:52; and the antisense strand has at least 90% sequence identity with SEQ ID NO:83; u. The sense strand has at least 90% sequence identity with SEQ ID NO:53; and the antisense strand has at least 90% sequence identity with SEQ ID NO:84; v. The sense strand has at least 90% sequence identity with SEQ ID NO:54; and the antisense strand has at least 90% sequence identity with SEQ ID NO:85; w. The sense strand has at least 90% sequence identity with SEQ ID NO:55; and the antisense strand has at least 90% sequence identity with SEQ ID NO:86; x. The sense strand has at least 90% sequence identity with SEQ ID NO:56; and the antisense strand has at least 90% sequence identity with SEQ ID NO:87; y. The sense strand has at least 90% sequence identity with SEQ ID NO:57; and the antisense strand has at least 90% sequence identity with SEQ ID NO:88; z. The sense strand has at least 90% sequence identity with SEQ ID NO:58; and the antisense strand has at least 90% sequence identity with SEQ ID NO:89; aa. The sense strand has at least 90% sequence identity with SEQ ID NO:59; and the antisense strand has at least 90% sequence identity with SEQ ID NO:90; bb. The sense strand has at least 90% sequence identity with SEQ ID NO:60; and the antisense strand has at least 90% sequence identity with SEQ ID NO:91; The sense strand has at least 90% sequence identity with SEQ ID NO:61; and the antisense strand has at least 90% sequence identity with SEQ ID NO:92; dd. The sense strand has at least 90% sequence identity with SEQ ID NO:62; and the antisense strand has at least 90% sequence identity with SEQ ID NO:93; or ee. The sense strand has at least 90% sequence identity with SEQ ID NO:63; and the antisense strand has at least 90% sequence identity with SEQ ID NO:66.
[0010] In some implementations, the RNAi reagent comprises a pair of sense and antisense strands as described in Tables 2, 3A and 3B.
[0011] In some embodiments, the RNAi reagent comprises a delivery moiety. In some embodiments, the delivery moiety is a lipophilic delivery moiety. In some embodiments, the delivery moiety is conjugated to a nucleotide at position 12 or 13 starting from the 5' end of the sense strand. In some embodiments, the lipophilic delivery moiety optionally has Formula I or 2'-O-hexadecyl. In some embodiments, the sense strand and antisense strand each independently comprise one or more modified nucleotides, and optionally, the internucleotide bonds between one or more nucleotides of the sense strand or antisense strand are modified nucleotide bonds. In some embodiments, one or more modified nucleotides are independently 2'-fluoromodified nucleotides or 2'-O-methylmodified nucleotides. In some embodiments, each nucleotide of the sense strand and each nucleotide of the antisense strand is modified.
[0012] Other embodiments provide the use of the RNAi reagent of the present invention in pain therapy, including the use of the therapy for chronic pain. Embodiments also provide methods for treating pain, including but not limited to chronic pain, comprising administering a therapeutic dose of the RNAi reagent of the present invention or a pharmaceutical composition thereof to a subject. Invention Details The RNAi reagent described in this article comprises sense and antisense strands, each of which is an oligonucleotide. As used herein, "nucleotide" means an organic compound having a nucleoside (nucleobase such as adenine, cytosine, guanine, thymine, or uracil; and a pentose such as ribose or 2'-deoxyribose) and a phosphate group. "Nucleotide" can be "modified nucleotide". "Nucleotide" can serve as a monomeric unit of nucleic acid polymers such as deoxyribonucleic acid (DNA) and ribonucleic acid (RNA).
[0014] As used herein, “oligonucleotide” means a short nucleic acid compound (e.g., less than about 100 nucleotides in length). Oligonucleotides can be single-stranded (ss) or double-stranded (ds). Oligonucleotides may or may not have double-stranded regions. As a set of non-limiting examples, oligonucleotides can be, but are not limited to, small interfering RNA (siRNA), microRNA (miRNA), short hairpin RNA (shRNA), Dicer substrate interfering RNA (DsiRNA), or antisense oligonucleotides (ASO).
[0015] As used herein, "ribonucleotide" means a nucleotide having ribose as its pentose sugar and containing a hydroxyl group at its 2' position. Modified ribonucleotides are ribonucleotides with one or more modifications or substitutions of atoms other than hydrogen at the 2' position, including modifications or substitutions of nucleobases, sugars, or phosphate groups.
[0016] As used herein, "modified internucleotide bond" means an internucleotide bond with one or more chemical modifications compared to a reference internucleotide bond having a phosphodiester bond. Modified internucleotide bonds can be non-naturally occurring bonds.
[0017] As used herein, a “modified nucleotide” means a nucleotide having one or more chemical modifications when compared to a corresponding reference nucleotide selected from the following: adenine ribonucleotide, guanine ribonucleotide, cytosine ribonucleotide, uracil ribonucleotide, adenine deoxyribonucleotide, guanine deoxyribonucleotide, cytosine deoxyribonucleotide, and thymidine deoxyribonucleotide. A modified nucleotide may be a non-naturally occurring nucleotide. For example, a modified nucleotide may have one or more chemical modifications, or any combination thereof, in its sugar, nucleotide, and / or phosphate groups. Additionally, or alternatively, a modified nucleotide may have one or more chemical moieties conjugated to a corresponding reference nucleotide.
[0018] As used herein, “phosphate analog” means a chemical moiety that mimics the electrostatic and / or steric properties of a phosphate group. In some embodiments, the phosphate analog is placed at the 5' terminal nucleotide of the oligonucleotide in place of the 5'-phosphate. The 5' phosphate analog may include a phosphatase-resistant bond. Examples of phosphate analogs include, but are not limited to, 5' phosphonates, such as 5'-methylenephosphonate (5'-MP) and 5'-(E)-vinylphosphonate (5'-VP). The oligonucleotide may have a phosphate analog at the 4'-carbon position of the sugar at the 5' terminal nucleotide (referred to as a “4'-phosphate analog”). An example of a 4'-phosphate analog is an oxymethylphosphonate, wherein the oxygen atom of the oxymethyl group is bonded to the sugar moiety (e.g., at its 4'-carbon) or an analog thereof. See, for example, International Patent Application Publication No. WO 2018 / 045317.
[0019] Other modifications have been developed for the 5' end of oligonucleotides (see, for example, International Patent Application No. WO 2011 / 133871; U.S. Patent No. 8,927,513; and Prakash et al. (2015)). Nuc. Acids Res. 43:2993-3011).
[0020] The term "percentage sequence identity" for a reference nucleic acid sequence is defined as the percentage of nucleotides, nucleosides, or nucleosides in a candidate sequence that are identical to those in the reference nucleic acid sequence after optimal alignment of the sequences and the introduction of gaps or overhangs where necessary to achieve maximum percentage sequence identity. Alignments used to determine percentage nucleic acid sequence identity can be performed in various ways within the art, for example, using publicly available computer software programs such as those described in Current Protocols in Molecular Biology (Ausubel et al., ed., 1987, Supp. 30, Section 7.7.18, Table 7.7.1), and including BLAST, BLAST-2, ALIGN, or Megalign (DNASTAR), Clustal W2.0, or Clustal X2.0 software. Those skilled in the art can determine appropriate parameters for measuring alignment, including any algorithms required to achieve maximum alignment across the full length of the sequences to be compared. The percentage of “sequence identity” can be determined by comparing two best-aligned sequences in a comparison window, where the nucleic acid sequence fragments in the comparison window may contain additions or deletions (e.g., vacancies or overhangs) compared to a reference sequence (which does not contain additions or deletions) for the best alignment of the two sequences. The percentage can be calculated by determining the number of positions in which the same nucleotide, nucleoside, or nucleotide appears in both sequences to obtain the number of matching positions, dividing the number of matching positions by the total number of positions in the comparison window, and multiplying the result by 100 to obtain the percentage of sequence identity. The output is the percentage identity of the subject sequence with respect to the query sequence. In some embodiments, the percentage sequence identity is calculated using PID3 to determine the percentage of identical nucleotide residues between the two strands, which is the number of identical nucleotide residues divided by the total number of the shortest nucleotides in the two sequences, and then multiplied by 100. See, for example, Raghava, G., Barton, GJ Quantification of the variation in percentage identity for protein sequencealignments. BMC Bioinformatics 7, 415 (2006). In this document, in one embodiment, alignment is performed using Clustal W2.0. In another embodiment, alignment is performed using Clustal X2.0. In either of the foregoing embodiments, after Clustal alignment, PID3 is used to calculate the percentage of identical nucleotide residues between the two strands.
[0021] As used herein, “complementary” or “complementarity” refers to a structural relationship between two nucleotides, nucleosides, or nucleobases (e.g., on two opposing nucleic acids or in opposing regions, such as hairpins, on a single nucleic acid strand) that allows the two nucleotides to form base pairs with each other. For example, a purine nucleotide of a nucleic acid complementary to a pyrimidine nucleotide of an opposing nucleic acid can be base-paired together by forming hydrogen bonds with each other. Complementary nucleotides can be base-paired in a canonical Watson-Crick manner, meaning adenine pairs with thymine or uracil, and guanine pairs with cytosine, or in any other manner that allows for the formation of a stable double helix. Similarly, two nucleic acids can have regions of multiple nucleotides that are complementary to each other to form complementary regions. As used herein, a “complementary region” refers to a nucleotide sequence of a nucleic acid that is complementary to an antiparallel nucleotide sequence to allow hybridization between the two nucleotide sequences under appropriate hybridization conditions (e.g., in phosphate-buffered saline, in vivo, etc.). In some embodiments, antisense oligonucleotides include regions that are complementary to the target mRNA sequence.
[0022] As used herein, "double helix" refers to a structure formed under suitable conditions through hydrogen bonds between complementary bases of two antiparallel nucleotide sequences. Double helixes can also form even when the two strands are not perfectly complementary, or when debased nucleotides are present.
[0023] As used herein, “iRNA,” “iRNA reagent,” “RNAi,” “RNAi reagent,” “siRNA,” and “RNA interference agent” refer to a reagent containing RNA and mediating targeted cleavage of RNA transcripts via RNA interference, for example, through the RNA-induced silencing complex (RISC) pathway. In some embodiments, the sense and antisense strands of the RNAi reagent are 21-23 nucleotides in length. In other embodiments, the sense and antisense strands may be longer, for example, 25-30 nucleotides in length, in which case the longer RNAi sequence is first processed by the Dicer enzyme. iRNA attenuates, inhibits, regulates, or reduces the expression of target genes in cells.
[0024] As used herein, “conjugated,” “conjugated,” or “conjugated” means a covalent bond, whether direct or indirect. For example, the sense or antisense strand disclosed herein may be covalently bonded to the delivery moiety to facilitate intracellular entry into CNS tissues. In some embodiments, the sense or antisense strand is directly covalently bonded to the delivery moiety. In other embodiments, the sense or antisense strand is indirectly conjugated via a linker; that is, the sense or antisense strand is covalently bonded to an atom of the linker, and the linker is in turn covalently bonded to the delivery moiety.
[0025] As used herein, "connector" means a structure used to conjugate a nucleotide (e.g., an oligonucleotide) to a targeting ligand or delivery moiety. In some embodiments, a connector may be "unstable" or "cleavable," meaning that the connector can be cleaved (e.g., by acidic pH or an enzyme). In other embodiments, a connector may be "stable" or "uncleavable," meaning that the connector is not cleaved under physiological conditions.
[0026] As used herein, for example, “reduced expression,” “reduced expression,” or “lower expression” refers to a reduction in the amount or level of RNA transcripts and / or proteins encoded by a gene in a cell, cell population, sample, or subject, and / or a reduction in the level of gene activity, compared to an appropriate reference (e.g., reference cells, cell population, sample, or subject). For example, introducing the RNAi reagent of this invention (e.g., an oligonucleotide having an antisense strand having a nucleotide sequence complementary to or a portion thereof to SCN10A mRNA) into cells can result in a reduction in the amount or level of mRNA, protein, and / or activity, compared to cells not treated with the RNAi reagent of this invention. Specifically, and as used herein, “reduced SCN10A expression” refers to a reduction in the amount or level of SCN10A mRNA, the level of SCN10A protein, and / or the activity of SCN10A protein in a cell, cell population, sample, or subject, compared to an appropriate reference (e.g., reference cells, cell population, tissue, or subject) not treated with the RNAi reagent of this invention.
[0027] As used herein, "patient" refers to any mammal, including cats, dogs, mice, rats, primates, and humans, that expresses or has been modified to express the human Nav 1.8 gene. Furthermore, "patient" and "subject" are used interchangeably.
[0028] As used herein, “treatment” or “treating” refers to all processes in which there may be a reduction, control, delay, or cessation of the symptoms or progression of the conditions or diseases disclosed herein, or an improvement in the symptoms or symptoms of the conditions or diseases, without necessarily indicating the complete elimination of all symptoms or symptoms of the conditions or diseases. Treatment includes the administration of RNAi agents or pharmaceutical compositions thereof for the treatment of diseases or conditions in mammals, including humans.
[0029] This document discloses an RNAi reagent having a sense strand and an antisense strand, wherein the sense strand and antisense strand are modified to reduce the expression of the SCN10A gene. One embodiment is an RNAi reagent having a sense strand and an antisense strand, wherein the antisense strand is complementary to the mRNA transcript of the SCN10A gene, and wherein the antisense strand and the sense strand form a double helix.
[0030] In some embodiments, the RNAi agent reduces the expression of the SCN10A gene in cells. In other embodiments, the RNAi agent reduces the expression of the SCN10A gene in human DRG cells. In other embodiments, the RNAi agent reduces the expression of the SCN10A gene in vivo.
[0031] As described above, the RNAi reagent can be modified. Accordingly, in a further embodiment, the antisense strand or sense strand optionally contains one or more modified nucleotides, and optionally the internucleotide bonds between one or more nucleotides of the sense strand or antisense strand are modified internucleotide bonds.
[0032] In one embodiment, the RNAi reagent comprises a sense strand and an antisense strand, wherein the antisense strand comprises a sequence complementary to a sequence selected from any one of SEQ ID NO: 2-32, wherein the sense strand and the antisense strand form a duplex, and optionally wherein each of the sense strand and the antisense strand independently comprises one or more modified nucleotides, and optionally wherein the internucleotide bond between one or more nucleotides of the sense strand or the antisense strand is a modified internucleotide bond.
[0033] In a further embodiment, the antisense strand comprises a 3' overhang of two nucleotides. In a further embodiment, the antisense strand and the sense strand are independently 15 to 50 nucleotides long. In a further embodiment, the antisense strand and the sense strand are independently 18 to 23 nucleotides long. In a further embodiment, the antisense strand is 23 nucleotides long. In a further embodiment, the sense strand is 21 nucleotides long. In a further embodiment, the antisense strand is 23 nucleotides long, and the sense strand is 21 nucleotides long.
[0034] In some embodiments, the RNAi comprises a sense strand and an antisense strand forming a duplex, wherein the antisense strand is 23 nucleotides long and the sense strand is 21 nucleotides long. In some embodiments of the duplex, the antisense strand comprises a sequence complementary to at least 15, 16, 17, or 18 consecutive nucleotides selected from any of SEQ ID NO: 2-32. In some embodiments, the duplex comprises a sense strand and an antisense strand that are complementary across at least 15, 16, 17, 18, 19, 20, or 21 consecutive nucleotides, or across at least 15, 16, 17, 18, 19, 20, or 21 consecutive nucleotides. In a further embodiment, the antisense strand comprises a sequence from any of SEQ ID NO: 64 to 93. In a further embodiment, the sense strand comprises a sequence from any of SEQ ID NO: 33 to 63. In some embodiments, the RNAi reagent comprises a duplex comprising the sense and antisense strand pairs listed in Table 2, Table 3A, or Table 3B. In some embodiments of the double helix, the sense strand comprises SEQ ID NO: 35, and the antisense strand comprises SEQ ID NO: 66. In some embodiments, the sense strand comprises SEQ ID NO: 39, and the antisense strand comprises SEQ ID NO: 70.
[0035] In some implementations of RNAi reagents, the sense strand and antisense strand form a double helix, and wherein: a. The sense strand has at least 90% sequence identity with SEQ ID NO:33; and the antisense strand has at least 90% sequence identity with SEQ ID NO:64; b. The sense strand has at least 90% sequence identity with SEQ ID NO:34; and the antisense strand has at least 90% sequence identity with SEQ ID NO:65; c. The sense strand has at least 90% sequence identity with SEQ ID NO:35; and the antisense strand has at least 90% sequence identity with SEQ ID NO:66; d. The sense strand has at least 90% sequence identity with SEQ ID NO:36; and the antisense strand has at least 90% sequence identity with SEQ ID NO:67; e. The sense strand has at least 90% sequence identity with SEQ ID NO:37; and the antisense strand has at least 90% sequence identity with SEQ ID NO:68; f. The sense strand has at least 90% sequence identity with SEQ ID NO:38; and the antisense strand has at least 90% sequence identity with SEQ ID NO:69; g. The sense strand has at least 90% sequence identity with SEQ ID NO:39; and the antisense strand has at least 90% sequence identity with SEQ ID NO:70; The sense strand has at least 90% sequence identity with SEQ ID NO:40; and the antisense strand has at least 90% sequence identity with SEQ ID NO:71. i. The sense strand has at least 90% sequence identity with SEQ ID NO:41; and the antisense strand has at least 90% sequence identity with SEQ ID NO:72; j. The sense strand has at least 90% sequence identity with SEQ ID NO:42; and the antisense strand has at least 90% sequence identity with SEQ ID NO:73; k. The sense strand has at least 90% sequence identity with SEQ ID NO:43; and the antisense strand has at least 90% sequence identity with SEQ ID NO:74; 1. The sense strand has at least 90% sequence identity with SEQ ID NO:44; and the antisense strand has at least 90% sequence identity with SEQ ID NO:75; m. The sense strand has at least 90% sequence identity with SEQ ID NO:45; and the antisense strand has at least 90% sequence identity with SEQ ID NO:76; n. The sense strand has at least 90% sequence identity with SEQ ID NO:46; and the antisense strand has at least 90% sequence identity with SEQ ID NO:77; o. The sense strand has at least 90% sequence identity with SEQ ID NO:47; and the antisense strand has at least 90% sequence identity with SEQ ID NO:78; p. The sense strand has at least 90% sequence identity with SEQ ID NO:48; and the antisense strand has at least 90% sequence identity with SEQ ID NO:79; q. The sense strand has at least 90% sequence identity with SEQ ID NO:49; and the antisense strand has at least 90% sequence identity with SEQ ID NO:80; r. The sense strand has at least 90% sequence identity with SEQ ID NO:50; and the antisense strand has at least 90% sequence identity with SEQ ID NO:81; s. The sense strand has at least 90% sequence identity with SEQ ID NO:51; and the antisense strand has at least 90% sequence identity with SEQ ID NO:82; t. The sense strand has at least 90% sequence identity with SEQ ID NO:52; and the antisense strand has at least 90% sequence identity with SEQ ID NO:83; u. The sense strand has at least 90% sequence identity with SEQ ID NO:53; and the antisense strand has at least 90% sequence identity with SEQ ID NO:84; v. The sense strand has at least 90% sequence identity with SEQ ID NO:54; and the antisense strand has at least 90% sequence identity with SEQ ID NO:85; w. The sense strand has at least 90% sequence identity with SEQ ID NO:55; and the antisense strand has at least 90% sequence identity with SEQ ID NO:86; x. The sense strand has at least 90% sequence identity with SEQ ID NO:56; and the antisense strand has at least 90% sequence identity with SEQ ID NO:87; y. The sense strand has at least 90% sequence identity with SEQ ID NO:57; and the antisense strand has at least 90% sequence identity with SEQ ID NO:88; z. The sense strand has at least 90% sequence identity with SEQ ID NO:58; and the antisense strand has at least 90% sequence identity with SEQ ID NO:89; aa. The sense strand has at least 90% sequence identity with SEQ ID NO:59; and the antisense strand has at least 90% sequence identity with SEQ ID NO:90; bb. The sense strand has at least 90% sequence identity with SEQ ID NO:60; and the antisense strand has at least 90% sequence identity with SEQ ID NO:91; The sense strand has at least 90% sequence identity with SEQ ID NO:61; and the antisense strand has at least 90% sequence identity with SEQ ID NO:92; dd. The sense strand has at least 90% sequence identity with SEQ ID NO:62; and the antisense strand has at least 90% sequence identity with SEQ ID NO:93; or ee. The sense strand has at least 90% sequence identity with SEQ ID NO:63; and the antisense strand has at least 90% sequence identity with SEQ ID NO:66.
[0036] In some implementations of RNAi reagents, the duplex comprises a sense strand and an antisense strand, wherein: a. The sense chain contains SEQ ID NO:94, and the antisense chain contains SEQ ID NO:132; b. The sense chain contains SEQ ID NO:95, and the antisense chain contains SEQ ID NO:133; c. The sense chain contains SEQ ID NO:96, and the antisense chain contains SEQ ID NO:134; d. The sense chain contains SEQ ID NO:97, and the antisense chain contains SEQ ID NO:135; e. The sense chain contains SEQ ID NO:98, and the antisense chain contains SEQ ID NO:136; f. The sense chain contains SEQ ID NO:99, and the antisense chain contains SEQ ID NO:137; g. The sense chain contains SEQ ID NO:100, and the antisense chain contains SEQ ID NO:138; h. The sense chain contains SEQ ID NO:101, and the antisense chain contains SEQ ID NO:139; i. The sense chain contains SEQ ID NO:102, and the antisense chain contains SEQ ID NO:140; j. The sense chain contains SEQ ID NO:103, and the antisense chain contains SEQ ID NO:141; k. The sense chain contains SEQ ID NO:104, and the antisense chain contains SEQ ID NO:142; l. The sense chain contains SEQ ID NO:105, and the antisense chain contains SEQ ID NO:143; m. The sense chain contains SEQ ID NO:106, and the antisense chain contains SEQ ID NO:144; n. The sense chain contains SEQ ID NO:107, and the antisense chain contains SEQ ID NO:145; o. The sense chain contains SEQ ID NO:108, and the antisense chain contains SEQ ID NO:146; p. The sense chain contains SEQ ID NO:109, and the antisense chain contains SEQ ID NO:147; q. The sense chain contains SEQ ID NO:110, and the antisense chain contains SEQ ID NO:148; r. The sense chain contains SEQ ID NO:111, and the antisense chain contains SEQ ID NO:149; s. The sense chain contains SEQ ID NO:112, and the antisense chain contains SEQ ID NO:150; t. The sense chain contains SEQ ID NO:113, and the antisense chain contains SEQ ID NO:151; u. The sense chain contains SEQ ID NO:114, and the antisense chain contains SEQ ID NO:152; v. The sense chain contains SEQ ID NO:115, and the antisense chain contains SEQ ID NO:153; w. The sense chain contains SEQ ID NO:116, and the antisense chain contains SEQ ID NO:154; x. The sense chain contains SEQ ID NO:117, and the antisense chain contains SEQ ID NO:155; y. The sense chain contains SEQ ID NO:118, and the antisense chain contains SEQ ID NO:156; z. The sense chain contains SEQ ID NO:119, and the antisense chain contains SEQ ID NO:157; aa. The sense chain contains SEQ ID NO:120, and the antisense chain contains SEQ ID NO:158; bb. The sense chain contains SEQ ID NO:121, and the antisense chain contains SEQ ID NO:159; cc. The sense chain contains SEQ ID NO:122, and the antisense chain contains SEQ ID NO:160; dd. The sense chain contains SEQ ID NO:123, and the antisense chain contains SEQ ID NO:161; ee. The sense chain contains SEQ ID NO:96, and the antisense chain contains SEQ ID NO:162; ff. The sense chain contains SEQ ID NO:96, and the antisense chain contains SEQ ID NO:163; gg. The sense chain contains SEQ ID NO:96, and the antisense chain contains SEQ ID NO:164; hh. The sense chain contains SEQ ID NO:96, and the antisense chain contains SEQ ID NO:165; ii. The sense chain contains SEQ ID NO:96, and the antisense chain contains SEQ ID NO:166; jj. The sense chain contains SEQ ID NO:124, and the antisense chain contains SEQ ID NO:162; kk. The sense chain contains SEQ ID NO:124, and the antisense chain contains SEQ ID NO:163; ll. The sense chain contains SEQ ID NO:124, and the antisense chain contains SEQ ID NO:164; mm. The sense chain contains SEQ ID NO:12; and the antisense chain contains SEQ ID NO:165; The sense chain contains SEQ ID NO:124, and the antisense chain contains SEQ ID NO:166; oo. The sense chain contains SEQ ID NO:124, and the antisense chain contains SEQ ID NO:134; pp. The sense chain contains SEQ ID NO:125, and the antisense chain contains SEQ ID NO:162; The sense chain contains SEQ ID NO:125, and the antisense chain contains SEQ ID NO:163; rr. The sense chain contains SEQ ID NO:125, and the antisense chain contains SEQ ID NO:164; The sense chain contains SEQ ID NO:125, and the antisense chain contains SEQ ID NO:165; The sense chain contains SEQ ID NO:125, and the antisense chain contains SEQ ID NO:166; uu. The sense chain contains SEQ ID NO:125, and the antisense chain contains SEQ ID NO:134; vv. The sense chain contains SEQ ID NO:126, and the antisense chain contains SEQ ID NO:162; The sense chain contains SEQ ID NO:126, and the antisense chain contains SEQ ID NO:163; xx. The sense chain contains SEQ ID NO:126, and the antisense chain contains SEQ ID NO:164; yy. The sense chain contains SEQ ID NO:126, and the antisense chain contains SEQ ID NO:165; zz. The sense chain contains SEQ ID NO:126, and the antisense chain contains SEQ ID NO:166; aaa. The sense chain contains SEQ ID NO:126, and the antisense chain contains SEQ ID NO:134; bbb. The sense chain contains SEQ ID NO:127, and the antisense chain contains SEQ ID NO:167; ccc. The sense chain contains SEQ ID NO:127, and the antisense chain contains SEQ ID NO:168; ddd. The sense chain contains SEQ ID NO:127, and the antisense chain contains SEQ ID NO:169; eee. The sense chain contains SEQ ID NO:128, and the antisense chain contains SEQ ID NO:170; fff. The sense chain contains SEQ ID NO:128, and the antisense chain contains SEQ ID NO:171; ggg. The sense chain contains SEQ ID NO:128, and the antisense chain contains SEQ ID NO:172; hhh. The sense chain contains SEQ ID NO:129, and the antisense chain contains SEQ ID NO:173; iii. The sense chain contains SEQ ID NO:129, and the antisense chain contains SEQ ID NO:174; jjj. The sense chain contains SEQ ID NO:129, and the antisense chain contains SEQ ID NO:175; kkk. The sense chain contains SEQ ID NO:130, and the antisense chain contains SEQ ID NO:176; lll. The sense chain contains SEQ ID NO:130, and the antisense chain contains SEQ ID NO:177; mmm. The sense chain contains SEQ ID NO:130, and the antisense chain contains SEQ ID NO:178; nnn. The sense chain contains SEQ ID NO:131, and the antisense chain contains SEQ ID NO:179; ooo. The sense chain contains SEQ ID NO:131, and the antisense chain contains SEQ ID NO:180; ppp. The sense chain contains SEQ ID NO:131, and the antisense chain contains SEQ ID NO:181; qqq. The sense chain contains SEQ ID NO:232, and the antisense chain contains SEQ ID NO:233; The sense chain contains SEQ ID NO:234, and the antisense chain contains SEQ ID NO:235; sss. The sense chain contains SEQ ID NO:236, and the antisense chain contains SEQ ID NO:233; The sense chain contains SEQ ID NO:237, and the antisense chain contains SEQ ID NO:233; uuu. The sense chain contains SEQ ID NO:238, and the antisense chain contains SEQ ID NO:239; vvv. The sense chain contains SEQ ID NO:240, and the antisense chain contains SEQ ID NO:239; www. The sense chain contains SEQ ID NO:238, and the antisense chain contains SEQ ID NO:235; xxx. The sense chain contains SEQ ID NO:240, and the antisense chain contains SEQ ID NO:235; yyy. The sense chain contains SEQ ID NO:241, and the antisense chain contains SEQ ID NO:235; zzz. The sense chain contains SEQ ID NO:238, and the antisense chain contains SEQ ID NO:242; aaaa. The sense chain contains SEQ ID NO:232, and the antisense chain contains SEQ ID NO:239; The sense chain contains SEQ ID NO:240, and the antisense chain contains SEQ ID NO:242; The sense chain contains SEQ ID NO:94, and the antisense chain contains SEQ ID NO:182; The sense chain contains SEQ ID NO:95, and the antisense chain contains SEQ ID NO:183; The sense chain contains SEQ ID NO:96, and the antisense chain contains SEQ ID NO:184; The sense chain contains SEQ ID NO:97, and the antisense chain contains SEQ ID NO:185; gggg. The sense chain contains SEQ ID NO:98, and the antisense chain contains SEQ ID NO:186; hhhh. The sense chain contains SEQ ID NO:99, and the antisense chain contains SEQ ID NO:187; iiii. The sense chain contains SEQ ID NO:100, and the antisense chain contains SEQ ID NO:188; jjjj. The sense chain contains SEQ ID NO:101, and the antisense chain contains SEQ ID NO:189; kkkk. The sense chain contains SEQ ID NO:102, and the antisense chain contains SEQ ID NO:190; The sense chain contains SEQ ID NO:103, and the antisense chain contains SEQ ID NO:191; mmmm. The sense chain contains SEQ ID NO:104, and the antisense chain contains SEQ ID NO:192; The sense chain contains SEQ ID NO:105, and the antisense chain contains SEQ ID NO:193; oooo. The sense chain contains SEQ ID NO:106, and the antisense chain contains SEQ ID NO:194; pppp. The sense chain contains SEQ ID NO:107, and the antisense chain contains SEQ ID NO:195; The sense chain contains SEQ ID NO:108, and the antisense chain contains SEQ ID NO:196; The sense chain contains SEQ ID NO:109, and the antisense chain contains SEQ ID NO:197; The sense chain contains SEQ ID NO:110, and the antisense chain contains SEQ ID NO:198; The sense chain contains SEQ ID NO:111, and the antisense chain contains SEQ ID NO:199; uuuu. The sense chain contains SEQ ID NO:112, and the antisense chain contains SEQ ID NO:200; vvvv. The sense chain contains SEQ ID NO:113, and the antisense chain contains SEQ ID NO:201; www. The sense chain contains SEQ ID NO:114, and the antisense chain contains SEQ ID NO:202; xxxx. The sense chain contains SEQ ID NO:115, and the antisense chain contains SEQ ID NO:203; yyyy. The sense chain contains SEQ ID NO:116, and the antisense chain contains SEQ ID NO:204; zzzz. The sense chain contains SEQ ID NO:117, and the antisense chain contains SEQ ID NO:205; aaaaa. The sense chain contains SEQ ID NO:118, and the antisense chain contains SEQ ID NO:206; bbbbb. The sense chain contains SEQ ID NO:119, and the antisense chain contains SEQ ID NO:207; ccccc. The sense chain contains SEQ ID NO:120, and the antisense chain contains SEQ ID NO:208; The sense chain contains SEQ ID NO:121, and the antisense chain contains SEQ ID NO:209; eeeee. The sense chain contains SEQ ID NO:122, and the antisense chain contains SEQ ID NO:210; fffff. The sense chain contains SEQ ID NO:123, and the antisense chain contains SEQ ID NO:211; ggggg. The sense chain contains SEQ ID NO:96, and the antisense chain contains SEQ ID NO:212; hhhhh. The sense chain contains SEQ ID NO:96, and the antisense chain contains SEQ ID NO:213; iiiii. The sense chain contains SEQ ID NO:96, and the antisense chain contains SEQ ID NO:214; jjjjj. The sense chain contains SEQ ID NO:96, and the antisense chain contains SEQ ID NO:215; kkkkk. The sense chain contains SEQ ID NO:96, and the antisense chain contains SEQ ID NO:216; lllll. The sense chain contains SEQ ID NO:124, and the antisense chain contains SEQ ID NO:212; mmmmm. The sense chain contains SEQ ID NO:124, and the antisense chain contains SEQ ID NO:213; nnnnn. The sense chain contains SEQ ID NO:124, and the antisense chain contains SEQ ID NO:214; ooooo. The sense chain contains SEQ ID NO:124, and the antisense chain contains SEQ ID NO:215; ppppp. The sense chain contains SEQ ID NO:124, and the antisense chain contains SEQ ID NO:216; The sense chain contains SEQ ID NO:124, and the antisense chain contains SEQ ID NO:184; rrrrr. The sense chain contains SEQ ID NO:125, and the antisense chain contains SEQ ID NO:212; The sense chain contains SEQ ID NO:125, and the antisense chain contains SEQ ID NO:213; The sense chain contains SEQ ID NO:125, and the antisense chain contains SEQ ID NO:214; uuuuu. The sense chain contains SEQ ID NO:125, and the antisense chain contains SEQ ID NO:215; vvvvv. The sense chain contains SEQ ID NO:125, and the antisense chain contains SEQ ID NO:216; www. The sense chain contains SEQ ID NO:125, and the antisense chain contains SEQ ID NO:184; xxxxx. The sense chain contains SEQ ID NO:126, and the antisense chain contains SEQ ID NO:212; yyyyy. The sense chain contains SEQ ID NO:126, and the antisense chain contains SEQ ID NO:213; zzzzz. The sense chain contains SEQ ID NO:126, and the antisense chain contains SEQ ID NO:214; aaaaaa. The sense chain contains SEQ ID NO:126, and the antisense chain contains SEQ ID NO:215; bbbbbb. The sense chain contains SEQ ID NO:126, and the antisense chain contains SEQ ID NO:216; The sense chain contains SEQ ID NO:126, and the antisense chain contains SEQ ID NO:184; dddddd. The sense chain contains SEQ ID NO:127, and the antisense chain contains SEQ ID NO:217; The sense chain contains SEQ ID NO:127, and the antisense chain contains SEQ ID NO:218; The sense chain contains SEQ ID NO:127, and the antisense chain contains SEQ ID NO:219; gggggg. The sense chain contains SEQ ID NO:128, and the antisense chain contains SEQ ID NO:220; hhhhhh. The sense chain contains SEQ ID NO:128, and the antisense chain contains SEQ ID NO:221; iiiiii. The sense chain contains SEQ ID NO:128, and the antisense chain contains SEQ ID NO:222; jjjjjj. The sense chain contains SEQ ID NO:129, and the antisense chain contains SEQ ID NO:223; kkkkkk. The sense chain contains SEQ ID NO:129, and the antisense chain contains SEQ ID NO:224; The sense chain contains SEQ ID NO:129, and the antisense chain contains SEQ ID NO:225; mmmmmm. The sense chain contains SEQ ID NO:130, and the antisense chain contains SEQ ID NO:226; The sense chain contains SEQ ID NO:130, and the antisense chain contains SEQ ID NO:227; oooooo. The sense chain contains SEQ ID NO:130, and the antisense chain contains SEQ ID NO:228; pppppp. The sense chain contains SEQ ID NO:131, and the antisense chain contains SEQ ID NO:229; The sense chain contains SEQ ID NO:131, and the antisense chain contains SEQ ID NO:230; The sense chain contains SEQ ID NO:131, and the antisense chain contains SEQ ID NO:231; The sense chain contains SEQ ID NO:232, and the antisense chain contains SEQ ID NO:184; The sense chain contains SEQ ID NO:234, and the antisense chain contains SEQ ID NO:215; uuuuuu. The sense chain contains SEQ ID NO:236, and the antisense chain contains SEQ ID NO:184; vvvvvv. The sense chain contains SEQ ID NO:237, and the antisense chain contains SEQ ID NO:184; wwwwww. The sense chain contains SEQ ID NO:238, and the antisense chain contains SEQ ID NO:213; The sense chain contains SEQ ID NO:240, and the antisense chain contains SEQ ID NO:213; yyyyyy. The sense chain contains SEQ ID NO:238, and the antisense chain contains SEQ ID NO:215; zzzzzz. The sense chain contains SEQ ID NO:240, and the antisense chain contains SEQ ID NO:215; aaaaaaa. The sense chain contains SEQ ID NO:241, and the antisense chain contains SEQ ID NO:215; bbbbbbb. The sense chain contains SEQ ID NO:238, and the antisense chain contains SEQ ID NO:212; ccccccc. The sense chain contains SEQ ID NO:232, and the antisense chain contains SEQ ID NO:213; ddddddd. The sense chain contains SEQ ID NO:240, and the antisense chain contains SEQ ID NO:214.
[0037] In some implementations of RNAi reagents, the duplex comprises a sense strand and an antisense strand, wherein: a. The sense chain consists of SEQ ID NO:94, and the antisense chain consists of SEQ ID NO:132; b. The sense chain consists of SEQ ID NO:95, and the antisense chain consists of SEQ ID NO:133; c. The sense chain consists of SEQ ID NO:96, and the antisense chain consists of SEQ ID NO:134; d. The sense chain consists of SEQ ID NO:97, and the antisense chain consists of SEQ ID NO:135; e. The sense chain consists of SEQ ID NO:98, and the antisense chain consists of SEQ ID NO:136; f. The sense chain consists of SEQ ID NO:99, and the antisense chain consists of SEQ ID NO:137; g. The sense chain consists of SEQ ID NO:100, and the antisense chain consists of SEQ ID NO:138; h. The sense chain consists of SEQ ID NO:101, and the antisense chain consists of SEQ ID NO:139; i. The sense chain consists of SEQ ID NO:102, and the antisense chain consists of SEQ ID NO:140; j. The sense chain consists of SEQ ID NO:103, and the antisense chain consists of SEQ ID NO:141; k. The sense chain consists of SEQ ID NO:104, and the antisense chain consists of SEQ ID NO:142; l. The sense chain consists of SEQ ID NO:105, and the antisense chain consists of SEQ ID NO:143; m. The sense chain consists of SEQ ID NO:106, and the antisense chain consists of SEQ ID NO:144; n. The sense chain consists of SEQ ID NO:107, and the antisense chain consists of SEQ ID NO:145; o. The sense chain consists of SEQ ID NO:108, and the antisense chain consists of SEQ ID NO:146; p. The sense chain consists of SEQ ID NO:109, and the antisense chain consists of SEQ ID NO:147; q. The sense chain consists of SEQ ID NO:110, and the antisense chain consists of SEQ ID NO:148; r. The sense chain consists of SEQ ID NO:111, and the antisense chain consists of SEQ ID NO:149; s. The sense chain consists of SEQ ID NO:112, and the antisense chain consists of SEQ ID NO:150; t. The sense chain consists of SEQ ID NO:113, and the antisense chain consists of SEQ ID NO:151; u. The sense chain consists of SEQ ID NO:114, and the antisense chain consists of SEQ ID NO:152; v. The sense chain consists of SEQ ID NO:115, and the antisense chain consists of SEQ ID NO:153; w. The sense chain consists of SEQ ID NO:116, and the antisense chain consists of SEQ ID NO:154; x. The sense chain consists of SEQ ID NO:117, and the antisense chain consists of SEQ ID NO:155; y. The sense chain consists of SEQ ID NO:118, and the antisense chain consists of SEQ ID NO:156; z. The sense chain consists of SEQ ID NO:119, and the antisense chain consists of SEQ ID NO:157; aa. The sense chain consists of SEQ ID NO:120, and the antisense chain consists of SEQ ID NO:158; bb. The sense chain consists of SEQ ID NO:121, and the antisense chain consists of SEQ ID NO:159; cc. The sense chain consists of SEQ ID NO:122, and the antisense chain consists of SEQ ID NO:160; dd. The sense chain consists of SEQ ID NO:123, and the antisense chain consists of SEQ ID NO:161; ee. The sense chain consists of SEQ ID NO:96, and the antisense chain consists of SEQ ID NO:162; ff. The sense chain consists of SEQ ID NO:96, and the antisense chain consists of SEQ ID NO:163; gg. The sense chain consists of SEQ ID NO:96, and the antisense chain consists of SEQ ID NO:164; hh. The sense chain consists of SEQ ID NO:96, and the antisense chain consists of SEQ ID NO:165; ii. The sense chain consists of SEQ ID NO:96, and the antisense chain consists of SEQ ID NO:166; jj. The sense chain consists of SEQ ID NO:124, and the antisense chain consists of SEQ ID NO:162; kk. The sense chain consists of SEQ ID NO:124, and the antisense chain consists of SEQ ID NO:163; ll. The sense chain consists of SEQ ID NO:124, and the antisense chain consists of SEQ ID NO:164; mm. The sense chain consists of SEQ ID NO:124, and the antisense chain consists of SEQ ID NO:165; The sense chain consists of SEQ ID NO:124, and the antisense chain consists of SEQ ID NO:166; oo. The sense chain consists of SEQ ID NO:124, and the antisense chain consists of SEQ ID NO:134; pp. The sense chain consists of SEQ ID NO:125, and the antisense chain consists of SEQ ID NO:162; The sense chain consists of SEQ ID NO:125, and the antisense chain consists of SEQ ID NO:163; rr. The sense chain consists of SEQ ID NO:125, and the antisense chain consists of SEQ ID NO:164; The sense chain consists of SEQ ID NO:125, and the antisense chain consists of SEQ ID NO:165; The sense chain consists of SEQ ID NO:125, and the antisense chain consists of SEQ ID NO:166; uu. The sense chain consists of SEQ ID NO:125, and the antisense chain consists of SEQ ID NO:134; vv. The sense chain consists of SEQ ID NO:126, and the antisense chain consists of SEQ ID NO:162; The sense chain consists of SEQ ID NO:126, and the antisense chain consists of SEQ ID NO:163; xx. The sense chain consists of SEQ ID NO:126, and the antisense chain consists of SEQ ID NO:164; The sense chain consists of SEQ ID NO:126, and the antisense chain consists of SEQ ID NO:165; zz. The sense chain consists of SEQ ID NO:126, and the antisense chain consists of SEQ ID NO:166; aaa. The sense chain consists of SEQ ID NO:126, and the antisense chain consists of SEQ ID NO:134; bbb. The sense chain consists of SEQ ID NO:127, and the antisense chain consists of SEQ ID NO:167; ccc. The sense chain consists of SEQ ID NO:127, and the antisense chain consists of SEQ ID NO:168; ddd. The sense chain consists of SEQ ID NO:127, and the antisense chain consists of SEQ ID NO:169; eee. The sense chain consists of SEQ ID NO:128, and the antisense chain consists of SEQ ID NO:170; fff. The sense chain consists of SEQ ID NO:128, and the antisense chain consists of SEQ ID NO:171; ggg. The sense chain consists of SEQ ID NO:128, and the antisense chain consists of SEQ ID NO:172; hhh. The sense chain consists of SEQ ID NO:129, and the antisense chain consists of SEQ ID NO:173; iii. The sense chain consists of SEQ ID NO:129, and the antisense chain consists of SEQ ID NO:174; jjj. The sense chain consists of SEQ ID NO:129, and the antisense chain consists of SEQ ID NO:175; kkk. The sense chain consists of SEQ ID NO:130, and the antisense chain consists of SEQ ID NO:176; lll. The sense chain consists of SEQ ID NO:130, and the antisense chain consists of SEQ ID NO:177; mmm. The sense chain consists of SEQ ID NO:130, and the antisense chain consists of SEQ ID NO:178; nnn. The sense chain consists of SEQ ID NO:131, and the antisense chain consists of SEQ ID NO:179; ooo. The sense chain consists of SEQ ID NO:131, and the antisense chain consists of SEQ ID NO:180; ppp. The sense chain consists of SEQ ID NO:131, and the antisense chain consists of SEQ ID NO:181; qqq. The sense chain consists of SEQ ID NO:232, and the antisense chain consists of SEQ ID NO:233; The sense chain consists of SEQ ID NO:234, and the antisense chain consists of SEQ ID NO:235; The sense chain consists of SEQ ID NO:236, and the antisense chain consists of SEQ ID NO:233; The sense chain consists of SEQ ID NO:237, and the antisense chain consists of SEQ ID NO:233; uuu. The sense chain consists of SEQ ID NO:238, and the antisense chain consists of SEQ ID NO:239; vvv. The sense chain consists of SEQ ID NO:240, and the antisense chain consists of SEQ ID NO:239; www. The sense chain consists of SEQ ID NO:238, and the antisense chain consists of SEQ ID NO:235; xxx. The sense chain consists of SEQ ID NO:240, and the antisense chain consists of SEQ ID NO:235; yyy. The sense chain consists of SEQ ID NO:241, and the antisense chain consists of SEQ ID NO:235; zzz. The sense chain consists of SEQ ID NO:238, and the antisense chain consists of SEQ ID NO:242; aaaa. The sense chain consists of SEQ ID NO:232, and the antisense chain consists of SEQ ID NO:239; The sense chain consists of SEQ ID NO:240, and the antisense chain consists of SEQ ID NO:242; The sense chain consists of SEQ ID NO:94, and the antisense chain consists of SEQ ID NO:182; The sense chain consists of SEQ ID NO:95, and the antisense chain consists of SEQ ID NO:183; The sense chain consists of SEQ ID NO:96, and the antisense chain consists of SEQ ID NO:184; The sense chain consists of SEQ ID NO:97, and the antisense chain consists of SEQ ID NO:185; The sense chain consists of SEQ ID NO:98, and the antisense chain consists of SEQ ID NO:186. hhhh. The sense chain consists of SEQ ID NO:99, and the antisense chain consists of SEQ ID NO:187; iiii. The sense chain consists of SEQ ID NO:100, and the antisense chain consists of SEQ ID NO:188; jjjj. The sense chain consists of SEQ ID NO:101, and the antisense chain consists of SEQ ID NO:189; kkkk. The sense chain consists of SEQ ID NO:102, and the antisense chain consists of SEQ ID NO:190; The sense chain consists of SEQ ID NO:103, and the antisense chain consists of SEQ ID NO:191; mmmm. The sense chain consists of SEQ ID NO:104, and the antisense chain consists of SEQ ID NO:192; The sense chain consists of SEQ ID NO:105, and the antisense chain consists of SEQ ID NO:193; The sense chain consists of SEQ ID NO:106, and the antisense chain consists of SEQ ID NO:194; The sense chain consists of SEQ ID NO:107, and the antisense chain consists of SEQ ID NO:195; The sense chain consists of SEQ ID NO:108, and the antisense chain consists of SEQ ID NO:196; The sense chain consists of SEQ ID NO:109, and the antisense chain consists of SEQ ID NO:197; The sense chain consists of SEQ ID NO:110, and the antisense chain consists of SEQ ID NO:198; The sense chain consists of SEQ ID NO:111, and the antisense chain consists of SEQ ID NO:199; uuuu. The sense chain consists of SEQ ID NO:112, and the antisense chain consists of SEQ ID NO:200; vvvv. The sense chain consists of SEQ ID NO:113, and the antisense chain consists of SEQ ID NO:201; www. The sense chain consists of SEQ ID NO:114, and the antisense chain consists of SEQ ID NO:202; xxxx. The sense chain consists of SEQ ID NO:115, and the antisense chain consists of SEQ ID NO:203; yyyy. The sense chain consists of SEQ ID NO:116, and the antisense chain consists of SEQ ID NO:204; zzzz. The sense chain consists of SEQ ID NO:117, and the antisense chain consists of SEQ ID NO:205; aaaaa. The sense chain consists of SEQ ID NO:118, and the antisense chain consists of SEQ ID NO:206; bbbbb. The sense chain consists of SEQ ID NO:119, and the antisense chain consists of SEQ ID NO:207; ccccc. The sense chain consists of SEQ ID NO:120, and the antisense chain consists of SEQ ID NO:208; The sense chain consists of SEQ ID NO:121, and the antisense chain consists of SEQ ID NO:209; eeeee. The sense chain consists of SEQ ID NO:122, and the antisense chain consists of SEQ ID NO:210; fffff. The sense chain consists of SEQ ID NO:123, and the antisense chain consists of SEQ ID NO:211; ggggg. The sense chain consists of SEQ ID NO:96, and the antisense chain consists of SEQ ID NO:212; hhhhh. The sense chain consists of SEQ ID NO:96, and the antisense chain consists of SEQ ID NO:213; iiiii. The sense chain consists of SEQ ID NO:96, and the antisense chain consists of SEQ ID NO:214; jjjjj. The sense chain consists of SEQ ID NO:96, and the antisense chain consists of SEQ ID NO:215; kkkkk. The sense chain consists of SEQ ID NO:96, and the antisense chain consists of SEQ ID NO:216; lllll. The sense chain consists of SEQ ID NO:124, and the antisense chain consists of SEQ ID NO:212; mmmmm. The sense chain consists of SEQ ID NO:124, and the antisense chain consists of SEQ ID NO:213; nnnnn. The sense chain consists of SEQ ID NO:124, and the antisense chain consists of SEQ ID NO:214; ooooo. The sense chain consists of SEQ ID NO:124, and the antisense chain consists of SEQ ID NO:215; ppppp. The sense chain consists of SEQ ID NO:124, and the antisense chain consists of SEQ ID NO:216; The sense chain consists of SEQ ID NO:124, and the antisense chain consists of SEQ ID NO:184. rrrrr. The sense chain consists of SEQ ID NO:125, and the antisense chain consists of SEQ ID NO:212; The sense chain consists of SEQ ID NO:125, and the antisense chain consists of SEQ ID NO:213; The sense chain consists of SEQ ID NO:125, and the antisense chain consists of SEQ ID NO:214; uuuuu. The sense chain contains SEQ ID NO:125, and the antisense chain contains SEQ ID NO:215; vvvvv. The sense chain consists of SEQ ID NO:125, and the antisense chain consists of SEQ ID NO:216; www. The sense chain consists of SEQ ID NO:125, and the antisense chain consists of SEQ ID NO:184; xxxxx. The sense chain consists of SEQ ID NO:126, and the antisense chain consists of SEQ ID NO:212; yyyyy. The sense chain consists of SEQ ID NO:126, and the antisense chain consists of SEQ ID NO:213; zzzzz. The sense chain consists of SEQ ID NO:126, and the antisense chain consists of SEQ ID NO:214; aaaaaa. The sense chain consists of SEQ ID NO:126, and the antisense chain consists of SEQ ID NO:215; bbbbbb. The sense chain consists of SEQ ID NO:126, and the antisense chain consists of SEQ ID NO:216; The sense chain consists of SEQ ID NO:126, and the antisense chain consists of SEQ ID NO:184; The sense chain consists of SEQ ID NO:127, and the antisense chain consists of SEQ ID NO:217; The sense chain consists of SEQ ID NO:127, and the antisense chain consists of SEQ ID NO:218; The sense chain consists of SEQ ID NO:127, and the antisense chain consists of SEQ ID NO:219; gggggg. The sense chain consists of SEQ ID NO:128, and the antisense chain consists of SEQ ID NO:220; hhhhhh. The sense chain consists of SEQ ID NO:128, and the antisense chain consists of SEQ ID NO:221; iiiiii. The sense chain consists of SEQ ID NO:128, and the antisense chain consists of SEQ ID NO:222; jjjjjj. The sense chain consists of SEQ ID NO:129, and the antisense chain consists of SEQ ID NO:223; kkkkkk. The sense chain consists of SEQ ID NO:129, and the antisense chain consists of SEQ ID NO:224; The sense chain consists of SEQ ID NO:129, and the antisense chain consists of SEQ ID NO:225; mmmmmm. The sense chain consists of SEQ ID NO:130, and the antisense chain consists of SEQ ID NO:226; The sense chain consists of SEQ ID NO:130, and the antisense chain consists of SEQ ID NO:227; oooooo. The sense chain consists of SEQ ID NO:130, and the antisense chain consists of SEQ ID NO:228; pppppp. The sense chain consists of SEQ ID NO:131, and the antisense chain consists of SEQ ID NO:229; The sense chain consists of SEQ ID NO:131, and the antisense chain consists of SEQ ID NO:230; The sense chain consists of SEQ ID NO:131, and the antisense chain consists of SEQ ID NO:231; The sense chain consists of SEQ ID NO:232, and the antisense chain consists of SEQ ID NO:184; The sense chain consists of SEQ ID NO:234, and the antisense chain consists of SEQ ID NO:215; uuuuuu. The sense chain consists of SEQ ID NO:236, and the antisense chain consists of SEQ ID NO:184; vvvvvv. The sense chain consists of SEQ ID NO:237, and the antisense chain consists of SEQ ID NO:184; wwwwww. The sense chain consists of SEQ ID NO:238, and the antisense chain consists of SEQ ID NO:213; The sense chain consists of SEQ ID NO:240, and the antisense chain consists of SEQ ID NO:213; yyyyyy. The sense chain consists of SEQ ID NO:238, and the antisense chain consists of SEQ ID NO:215; zzzzzz. The sense chain consists of SEQ ID NO:240, and the antisense chain consists of SEQ ID NO:215; aaaaaaa. The sense chain consists of SEQ ID NO:241, and the antisense chain consists of SEQ ID NO:215; bbbbbbb. The sense chain consists of SEQ ID NO:238, and the antisense chain consists of SEQ ID NO:212; ccccccc. The sense chain consists of SEQ ID NO:232, and the antisense chain consists of SEQ ID NO:213; ddddddd. The sense chain consists of SEQ ID NO:240, and the antisense chain consists of SEQ ID NO:214.
[0038] In some implementations of the RNAi reagent, the antisense strand is essentially composed of SEQ ID NO: 233, and the sense strand is essentially composed of SEQ ID NO: 232.
[0039] In some implementations of the RNAi reagent, the antisense strand is essentially composed of SEQ ID NO: 235, and the sense strand is essentially composed of SEQ ID NO: 234.
[0040] In some implementations of the RNAi reagent, the antisense strand is essentially composed of SEQ ID NO: 233, and the sense strand is essentially composed of SEQ ID NO: 236.
[0041] In some embodiments, the RNAi reagent comprises a sense strand, which further comprises a delivery portion. In some embodiments, the RNAi reagent comprises an antisense strand, which further comprises a delivery portion.
[0042] In some embodiments of the RNAi reagent, the delivery portion is a lipophilic delivery portion. In one embodiment, the delivery portion is conjugated to a nucleobase in the sense strand, as shown by formula Ib. In another embodiment, the delivery portion is conjugated to a nucleobase in the sense strand, as shown by formulas in Table 10. In some embodiments, the delivery portion is conjugated to a nucleobase at position 12 or 13 starting from the 5' end of the sense strand.
[0043] In some embodiments, the RNAi reagent comprises nucleotide modifications. Accordingly, in some embodiments, the RNAi reagent comprises modified nucleotides, which are independently 2'-fluorinated or 2'-O-methylated nucleotides. In some embodiments, each nucleotide of the sense strand and each nucleotide of the antisense strand are modified.
[0044] In some embodiments, the 2' fluorine-modified nucleotide appears at a specific position selected from the following: a. Positions 2, 3, 7, 14, and 16, starting from the 5' end of the antisense chain; b. Positions 2, 5, 7, 14, and 16 starting from the 5' end of the antisense chain; c. Positions 2, 3, 8, 14, and 16 starting from the 5' end of the antisense chain; d. Positions 2, 5, 8, 14, and 16, starting from the 5' end of the antisense chain; e. Positions 2, 14, and 16 starting from the 5' end of the antisense chain; or f. Positions 2, 6, 14, and 16, starting from the 5' end of the antisense chain.
[0045] In some embodiments, the 2' fluorine-modified nucleotide appears at a specific position selected from the following: a. Positions 9, 10, and 11, starting from the 5' end of the meaningful chain; b. Positions 7, 9, and 11 starting from the 5' end of the meaningful chain; c. Positions 7, 9, and 10 starting from the 5' end of the sense chain; d. Positions 7, 10, and 11 starting from the 5' end of the sense chain; or e. Positions 7, 9, 10, and 11, starting from the 5' end of the meaningful chain.
[0046] In a further embodiment, the 2'-fluorine-modified nucleotide appears at a specific position selected from the following antisense strands: a. Positions 2, 3, 7, 14, and 16, starting from the 5' end of the antisense chain; b. Positions 2, 5, 7, 14, and 16 starting from the 5' end of the antisense chain; c. Positions 2, 3, 8, 14, and 16 starting from the 5' end of the antisense chain; d. Positions 2, 5, 8, 14, and 16, starting from the 5' end of the antisense chain; e. Positions 2, 14, and 16 starting from the 5' end of the antisense chain; or f. Positions 2, 6, 14, and 16 starting from the 5' end of the antisense chain; Furthermore, 2'-fluorine modified nucleotides appear at specific positions selected from the following sense strands: a. Positions 9, 10, and 11, starting from the 5' end of the meaningful chain; b. Positions 7, 9, and 11 starting from the 5' end of the meaningful chain; c. Positions 7, 9, and 10 starting from the 5' end of the sense chain; d. Positions 7, 10, and 11 starting from the 5' end of the sense chain; or e. Positions 7, 9, 10, and 11, starting from the 5' end of the meaningful chain; and f. Positions 7, 9, 10 and 11 starting from the 5' end of the sense chain, and positions 2, 6, 14 and 16 starting from the 5' end of the antisense chain; g. Positions 9, 10, and 11 starting from the 5' end of the sense chain, and positions 2, 5, 8, 14, and 16 starting from the 5' end of the antisense chain.
[0047] In some embodiments of the RNAi reagent, each nucleotide contains a 2' fluorine modification at positions 2, 6, 14, and 16 starting from the 5' end of the antisense strand and at positions 7, 9, 10, and 11 starting from the 5' end of the sense strand.
[0048] In some embodiments of the RNAi reagent, each nucleotide contains a 2' fluorine modification at positions 2, 5, 7, 14, and 16 starting from the 5' end of the antisense strand and at positions 9, 10, and 11 starting from the 5' end of the sense strand; In some embodiments of the RNAi reagent, each nucleotide contains a 2' fluorine modification at positions 2, 3, 7, 14, and 16 starting from the 5' end of the antisense strand and at positions 9, 10, and 11 starting from the 5' end of the sense strand.
[0049] In some embodiments of the RNAi reagent, each nucleotide contains a 2' fluorine modification at positions 2, 5, 8, 14, and 16 starting from the 5' end of the antisense strand and at positions 9, 10, and 11 starting from the 5' end of the sense strand.
[0050] In some embodiments of the RNAi reagent, each nucleotide contains a 2' fluorine modification at positions 2, 14, and 16 starting from the 5' end of the antisense strand and at positions 9, 10, and 11 starting from the 5' end of the sense strand.
[0051] In some embodiments of the RNAi reagent, each nucleotide at positions 2, 5, 7, 14, and 16 starting from the 5' end of the antisense strand and at positions 7, 9, 10, and 11 starting from the 5' end of the sense strand contains a 2' fluorine modification.
[0052] In some embodiments of the RNAi reagent in which the nucleotide at a specific position is modified to contain a 2'-fluorine modified nucleotide, the remaining nucleotides are also modified, and optionally contain a 2'-O-methyl modified nucleotide.
[0053] In some embodiments, the RNAi reagent comprises one or more modified internucleotide bonds. In some embodiments, the internucleotide bonds are phosphate thioester bonds. In some embodiments, the antisense strand has four or five phosphate thioester bonds. In some embodiments, the sense strand has four or five phosphate thioester bonds. In some embodiments, the antisense strand comprises no more than four phosphate thioester internucleotide bonds. In some embodiments, positions 1 and 2 of the sense strand (e.g., relative to the 5' or 3' end) are linked by modified internucleotide bonds. In some embodiments, positions 1 and 2 of the antisense strand (e.g., relative to the 5' or 3' end) are linked by phosphate thioester internucleotide bonds. In some embodiments, positions 2 and 3 of the sense strand (e.g., relative to the 5' or 3' end) are linked by modified internucleotide bonds. In some embodiments, positions 2 and 3 of the antisense strand (e.g., relative to the 5' or 3' end) are linked by phosphate thioester internucleotide bonds.
[0054] In some embodiments, the 5' end of the antisense chain is modified and contains a phosphate group or a phosphate analog. In some embodiments, the phosphate analog is 5'-(E)-vinylphosphonate.
[0055] In some embodiments, the RNAi reagent comprises a nucleotide modified as a debasement moiety. In some embodiments, the sense strand has a nucleotide modified as a debasement moiety. In some embodiments, the sense and antisense strands of the RNAi reagent herein form a complementary region of at least 15 nucleotides. In other embodiments, the sense and antisense strands form a complementary region of at least 16, 17, or 18 nucleotides. In other embodiments, the sense and antisense strands form a complementary region of 15, 16, 17, 18, 19, 20, or 21 nucleotides.
[0056] Another embodiment is an RNAi reagent having a sense strand and an antisense strand, wherein the antisense strand is complementary to a portion of the mRNA of SEQ ID NO:1 (transcription of the SCN10A gene), and wherein the sense strand and antisense strand form a duplex, wherein the length of each sense strand and antisense strand is independently 15 to 25 nucleotides, and optionally wherein each sense strand and antisense strand independently comprises one or more modified nucleotides. In some embodiments, the sense strand and / or antisense strand is selected from the tables disclosed herein. In some embodiments, the RNAi reagent comprises an antisense strand and a sense strand forming a duplex selected from the tables disclosed herein.
[0057] Another embodiment disclosed herein is an RNAi reagent having Formula I: RLD, wherein R is a double-stranded oligonucleotide having a sense strand and an antisense strand, wherein the sense strand and the antisense strand form a complementary region; wherein D is a delivery portion; and wherein L is absent or is a linker portion; and wherein the antisense strand comprises at least 15 adjacent nucleotides complementary to the mRNA transcript of the SCN10A gene (e.g., SEQ ID NO: 1), and wherein the sense strand and the antisense strand are complementary across at least 15 nucleotides, and wherein in some embodiments, the sense strand and the antisense strand form a complementary region of 15, 16, 17 or 18 nucleotides, and wherein the length of the sense strand and the antisense strand is each independently 18 to 23 nucleotides, and optionally wherein the sense strand and the antisense strand each independently comprise one or more modified nucleotides, and optionally D is...
[0058] In another embodiment, this document discloses an RNAi reagent having Formula I: RLD, wherein R is a double-stranded oligonucleotide having a sense strand and an antisense strand, wherein the sense strand and the antisense strand form a double strand; wherein D is a delivery portion; and wherein L is absent or is a linker portion; and wherein the antisense strand comprises at least 15 adjacent nucleotides complementary to the mRNA transcript of the SCN10A gene, and wherein the length of each of the sense strand and the antisense strand is independently 18 to 23 nucleotides, and optionally wherein each of the sense strand and the antisense strand independently comprises one or more modified nucleotides. In a further embodiment, the antisense strand comprises at least 15, 16, 17, 18, 19, 20, or 21 adjacent nucleotides complementary to the SCN10A gene.
[0059] This document also discloses an RNAi reagent having Formula I: RLD, wherein R is a double-stranded oligonucleotide having a sense strand and an antisense strand, wherein the sense strand and the antisense strand form a double strand; wherein D is a delivery portion; and wherein L is absent or is a linker portion; wherein the antisense strand is complementary to at least 18 nucleotides of the sequence in Table 1; wherein the sense strand and the antisense strand are complementary across at least 15, 16, 17, 18, 19, 20, or 21 nucleotides; wherein the length of the sense strand and the antisense strand is each independently 18 to 23 nucleotides; and optionally wherein the sense strand and the antisense strand each independently contain one or more modified nucleotides.
[0060] In some implementations, the delivery portion has Formula I: .
[0061] In some embodiments, the RNAi reagent comprises a sense strand and an antisense strand, wherein the sense strand and the antisense strand form a double-stranded region, and wherein the sense strand or antisense strand comprises a nucleotide modified with the following formula: In some embodiments, B is a nucleobase selected from adenine (A), cytosine (C), guanine (G), thymine (T), uracil (U), or derivatives thereof. In some embodiments, B is a nucleobase selected from A, C, G, T, and U. In some embodiments, B is a nucleobase derivative selected from 5-methylcytosine, 2-thiouridine, 4-thiouridine, C5-modified pyrimidine, C2-modified purine, N8-modified purine, pseudouracil, isocytosine, isoguanine, 2,6-diaminopurine, pseudocytosine, 2-aminopurine, xanthine, hypoxanthine, 7-methylguanine, 5-hydroxymethylcytosine, 5,6-dihydrouracil, 5-carboxycytidine, phenoxazine, N6-alkyl-A, or O6-alkyl-G.
[0062] In some embodiments, the sense chain comprises a nucleotide modified with formula Ia. In some embodiments, the sense chain comprises, for example, a nucleotide modified with any of formula Ia at any of positions 1-6 or 12-21 starting from the 5' end. In some embodiments, the sense chain comprises a nucleotide modified with formula Ia at position 13 starting from the 5' end of the sense chain. In some embodiments, the sense chain comprises a nucleotide modified with formula Ia at position 12 starting from the 5' end of the sense chain.
[0063] In some embodiments, the delivery moiety is conjugated to a nucleotide of the sense strand. In some embodiments, the delivery moiety is a modified nucleotide located in the sense strand. In some embodiments, the modified nucleotide is located at position 12 or 13, starting from the 5' of the sense strand. In some embodiments, depending on the sequence of the sense strand at position 12 or 13, the modified nucleotide is 2'-O-hexadecyluridine, 2'-O-hexadecylcytidine, 2'-O-hexadecylguanine, or 2'-O-hexadecyladenosine (see Table 10 for structure).
[0064] For the RNAi reagent described herein that reduces SCN10A gene expression, the antisense strand is complementary to the sequences in Table 1. In some embodiments, the antisense strand is complementary to at least 15 nucleotides of the sequences in Table 1. In some embodiments, the antisense strand is complementary to 18 adjacent nucleotides of the sequences in Table 1. In some embodiments, the RNAi reagent contains 0, 1, 2, or 3 mismatches between the sense and antisense strands.
[0065] In some embodiments, the antisense or sense strand of the RNAi reagent has a sequence identity of at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% with the antisense or sense strands listed in Table 2, Table 3A, or Table 3B. In some embodiments, the antisense or sense strand of the RNAi reagent has a sequence identity of 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% with the antisense or sense strands listed in Table 2, Table 3A, or Table 3B.
[0066] In some embodiments, the sense and antisense strands are complementary across 15, 16, 17, 18, 19, or 20 nucleotides. In some embodiments, the sense and antisense strands are complementary across 15, 16, 17, 18, 19, or 20 adjacent nucleotides. In a further embodiment, the RNAi reagent contains 0, 1, 2, or 3 mismatches between the sense and antisense strands.
[0067] In some embodiments of the RNAi reagents disclosed herein, the RNAi reagents are capable of reducing the expression of the SCN10A gene in cells. In some embodiments, the RNAi reagents disclosed herein are used for treatment. In one embodiment, the use is for the treatment of chronic pain. In some embodiments, the RNAi reagents are used to manufacture pharmaceuticals for treating pain, including chronic pain.
[0068] In some embodiments, the RNAi reagent is formulated in a pharmaceutical composition comprising the RNAi reagent and one or more pharmaceutically acceptable excipients.
[0069] Another embodiment provided herein is a method for reducing the expression of SCN10A protein and / or mRNA in cells, comprising contacting cells with the RNAi reagent disclosed herein and incubating the cells for a time sufficient for SCN10A mRNA degradation. The reduction in SCN10A protein and / or mRNA expression is measured by any suitable assay. In some embodiments, the degradation of SCN10A mRNA is determined by RT-PCR.
[0070] Some embodiments provided herein are methods for treating patients who would benefit from reduced expression of the SCN10A gene mRNA transcript, comprising administering an effective amount of an RNAi agent or a pharmaceutical composition thereof to a patient in need. Some embodiments are methods for treating chronic pain in patients in need, comprising administering a therapeutic amount of the RNAi agent or a pharmaceutical composition thereof disclosed herein.
[0071] RNAi reagents and compositions containing RNAi reagents may be administered in any suitable manner, including but not limited to: intrathecal delivery, such as intrathecal injection (lumbar puncture), epidural delivery, such as interlaminar (midline) epidural injection, epidural injection through the intervertebral foramen (peri-DRG), systemic delivery such as intravenous or subcutaneous delivery, such as intravenous or subcutaneous injection, or intraganglionic injection.
[0072] Dosing regimens can be adjusted to provide the optimal desired response (e.g., therapeutic response). For example, a single bolus can be administered, several fractionated doses can be administered over a period of time, or the dose can be proportionally reduced or increased as indicated by emergency instructions for the therapeutic situation.
[0073] Dosage values may vary depending on the type and severity of the condition to be alleviated. It should further be understood that, for any given subject, the specific dosage regimen should be adjusted over time based on individual needs and the professional judgment of the individual administering or supervising the application of the composition.
[0074] In another aspect, this article provides compounds, RNAi reagents, or pharmaceutical compositions for therapeutic purposes. This article also provides compounds, RNAi reagents, or pharmaceutical compositions for treating pain conditions.
[0075] NCBI reference sequence: NM_006514.4 (SEQ ID NO: 1): SEQ ID NO:1: 1 ttcttgcttc acacactagc ctcttggcta gagaacagac atcagatgga gtttcttctg 61 gctatgctg aatgttaagc tgaacgtag ttccaggagc tcgtggtctc cagtagaggc 121 aatctgggat agagagaag atatttctta cgtagagac aagcagatt gagcagcaaa 181 gagtataat acttcctgaa gaagaatgag aagatggaat tcccattgg atccctcgaa 241 actaacact tccgtcgctt tactccggag tcactggtgg agatagagaa gcaattgct 301 gccaagggaaaaaaaaaaggggaaaaaggggaaaaaaaaaaaaaaaaaaaaaaaaaaaagg'agg 361 aagcctcggc cccagctgga cttgaaagcc tgcaccagc tgcccagtt ctatggtgag 421 ctcccagcag aactgatcgg ggagccctg gaggatctag atccgttcta cagcacacac 481 cggacattta tggtgctgaa caagggagg accattccc gtttagtgc cactcggcc 541 ctgtggctat tcagtccttt caactgatc agagaacgg ccatcaagt gtctgtccac 601 tcgtggttca gtttatttat tacggtcact attgtgtgtg catgacccga 661 actgaccttc cagagaaaat tgaatatgtc ttcactgtca tttacacctt tgaagccttg 721 aaagatac tggcagagg atttgtcta aatgagttca cgtacctgag agatccttgg 781 aactggctgg attttagcgt cattaccctg gdatagttg gcacagcaat agatctccgt 841 gggatctcag gcctgcggac attcagagtt cttagagcat taaaaacagt ttctgtgatc 901 ccaggcctga aggtcattgt gggggccctg attcactcag tgaagaaact ggctgatgtg 961 accatcctca ccatcttctg cctaagtgtt tttgccttgg tggggctgca actcttcaag 1021 ggcaacctca aaaataaatg tgtcaagaat gacatggctg tcaatgagacaaccaactac 1081 tcatctcaca gaaaaccaga tatctacata aataagcgag gcacttctgaccccttactg 1141 tgtggcaatg gatctgactc aggccactgc cctgatggtt atatctgccttaaaacttct 1201 gacaacccgg attttaacta caccagcttt gattccttg cttgggctttcctctcactg 1261 ttccgcctca tgacacagga ttcctgggaa cgcctctacc agcagaccctgaggacttct 1321 gggaaaatct atatgatctt ttttgtgctc gtaatcttcc tgggatctttctacctggtc 1381 aacttgatct tggctgtagt caccatggcg tatgaggagc agaaccaggcaaccactgat 1441 gaaattgaag caaaggagaa gaagttccag gaggccctcg agatgctccggaaggagcag 1501 gaggtgctag cagcactagg gattgacaca acctctctcc actcccacaatggatcacct 1561 ttaacctcca aaaatgccag tgagagaagg catagaataa agccaagagtgtcagagggc 1621 tccacagaag acaacaaatc accccgctct gatccttaca accagcgcaggatgtctttt 1681 ctaggcctcg cctctggaaa acgccgggct agtcatggca gtgtgttccatttccggtcc 1741 cctggccgag atatctcact ccctgaggga gtcacagatg atggagtctttcctggagac 1801 cacgaaagcc atcggggctc tctgctgctg ggtgggggtg ctggccagcaaggccccctc 1861 cctagaagcc ctcttcctca acccagcaac cctgactcca ggcatggagaagatgaacac 1921 caaccgccgc ccactagtga gcttgcccct ggagctgtcg atgtctcggcattcgatgca 1981 ggacaaaaga agactttctt gtcagcagaa tacttagatg aacctttccgggcccaaagg 2041 gcaatgagtg ttgtcagtat cataacctcc gtccttgagg aactcgaggagtctgaacag 2101 aagtgcccac cctgcttgac cagcttgtct cagaagtatc tgatctgggattgctgcccc 2161 atgtgggtga agctcaagac aattctcttt gggcttgtga cggatccctttgcagagctc 2221 accatcacct tgtgcatcgt ggtgaacacc atcttcatgg ccatggagcaccatggcatg 2281 agccctacct tcgaagccat gctccagata ggcaacatcg tctttaccatattttttact 2341 gctgaaatgg tcttcaaaat cattgccttc gacccatact attatttccagaagaagtgg 2401 aatatctttg actgcatcat cgtcactgtg agtctgctag agctgggcgtggccaagaag 2461 ggaagcctgt ctgtgctgcg gagcttccgc ttgctgcgcg tattcaagctggccaaatcc 2521 tggcccacct taaacacact catcaagatc atcggaaact cagtgggggcactggggaac 2581 ctcaccatca tcctggccat cattgtcttt gtctttgctc tggttggcaagcagctccta 2641 ggggaaaact accgtaacaa ccgaaaaaat atctccgcgc cccatgaagactggccccgc 2701 tggcacatgc acgacttctt ccactctttc ctcattgtct tccgtatcctctgtggagag 2761 tggattgaga acatgtgggc ctgcatggaa gttggccaaa aatccatatgcctcatcctt 2821 ttcttgacgg tgatggtgct agggaacctg gtggtgctta acctgttcatcgccctgcta 2881 ttgaactctt tcagtgctga caacctcaca gccccggagg acgatggggaggtgaacaac 2941 ctgcaggtgg ccctggcacg gatccaggtc tttggccatc gtaccaaacaggctctttgc 3001 agcttcttca gcaggtcctg cccattcccc cagcccaagg cagagcctgagctggtggtg 3061 aaactcccac tctccagctc caaggctgag aaccacattg ctgccaacactgccaggggg 3121 agctctggag ggctccaagc tcccagaggc cccagggatg agcacagtgacttcatcgct 3181 aatccgactg tgtgggtctc tgtgcccatt gctgagggtg aatctgatcttgatgacttg 3241 gaggatgatg gtggggaaga tgctcagagc ttccagcagg aagtgatccccaaaggacag 3301 caggagcagc tgcagcaagt cgagaggtgt ggggaccacc tgacacccaggagcccaggc 3361 actggaacat cttctgagga cctggctcca tccctgggtg agacgtggaaagatgagtct 3421 gttcctcagg tccctgctga gggagtggac gacacaagct cctctgagggcagcacggtg 3481 gactgcctag atcctgagga aatcctgagg aagatccctg agctggcagatgacctggaa 3541 gaaccagatg actgcttcac agaaggatgc attcgccact gtccctgctgcaaactggat 3601 accaccaaga gtccatggga tgtgggctgg caggtgcgca agacttgctaccgtatcgtg 3661 gagcacagct ggtttgagag cttcatcatc ttcatgatcc tgctcagcagtggatctctg 3721 gcctttgaag actattacct ggaccagaag cccacggtga aagctttgctggagtacact 3781 gacagggtct tcacctttat ctttgtgttc gagatgctgc ttaagtgggtggcctatggc 3841 ttcaaaaagt acttcaccaa tgcctggtgc tggctggact tcctcattgtgaatatctca 3901 ctgataagtc tcacagcgaa gattctggaa tattctgaag tggctcccatcaaagccctt 3961 cgaacccttc gcgctctgcg gccactgcgg gctctttctc gatttgaaggcatgcgggtg 4021 gtggtggatg ccctggtggg cgccatccca tccatcatga atgtcctcctcgtctgcctc 4081 atcttctggc tcatcttcag catcatgggt gtgaacctct tcgcagggaagttttggagg 4141 tgcatcaact ataccgatgg agagttttcc cttgtacctt tgtcgattgtgaataacaag 4201 tctgactgca agattcaaaa ctccactggc agcttcttct gggtcaatgtgaaagtcaac 4261 tttgataatg ttgcaatggg ttaccttgca cttctgcagg tggcaacctttaaaggctgg 4321 atggacatta tgtatgcagc tgttgattcc cgggaggtca acatgcaacccaagtgggag 4381 gacaacgtgt acatgtattt gtactttgtc atcttcatca tttttggaggcttcttcaca 4441 ctgaatctct ttgttggggt cataattgac aacttcaatc aacagaaaaaaaagttaggg 4501 ggccaggaca tcttcatgac agaggagcag aagaaatact acaatgccatgaagaagttg 4561 ggctccaaga agccccagaa gcccatccca cggcccctga acaagttccagggttttgtc 4621 tttgacatcg tgaccagaca agcttttgac atcaccatca tggtcctcatctgcctcaac 4681 atgatcacca tgatggtgga gactgatgac caaagtgaag aaaagacgaaaattctgggc 4741 aaaatcaacc agttctttgt ggccgtcttc acaggcgaat gtgtcatgaagatgttcgct 4801 ttgaggcagt actacttcac aaatggctgg aatgtgtttg acttcattgtggtggttctc 4861 tccattgcga gcctgatttt ttctgcaatt cttaagtcac ttcaaagttacttctcccca 4921 acgctcttca gagtcatccg cctggcccga attggccgca tcctcagactgatccgagcg 4981 gccaagggga tccgcacact gctctttgcc ctcatgatgt ccctgcctgccctcttcaac 5041 atcgggctgt tgctattcct tgtcatgttc atctactcta tcttcggtatgtccagcttt 5101 ccccatgtga ggtgggaggc tggcatcgac gacatgttca acttccagaccttcgccaac 5161 agcatgctgt gcctcttcca gattaccacg tcggccggct gggatggcctcctcagcccc 5221 atcctcaaca cagggccccc ctactgtgac cccaatctgc ccaacagcaatggcaccaga 5281 ggggactgtg ggagcccagc cgtaggcatc atctttcttca ccacctacatcatcatctcc 5341 ttcctcatca tggtcaacat gtacattgca gtgattctgg agaacttcaatgtggccacg 5401 gaggagagca ctgagcccct gagtgaggac gactttgaca tgttctatgagacctgggag 5461 aagtttgacc cagaggccac tcagtttatt accttttctg ctctctcggactttgcagac 5521 actctcttg gtcccctgag aatcccaaaa cccaatcgaa atatactgatccagatggac 5581 ctgccttg tcctggaga taagatccac tgcttggaca tcctttttgctttcaccaag 5641 aatgtcctag gagaatccgg ggagttggat tctctgaagg caaatatggaggaagaagtttt 5701 atggcaacta atctttcaaa atcatcctat gaaccaatag caaccactctccgatggaag 5761 caagaagaca ttcagccac tgtcattcaa aaggcctatc ggagctatgtgctgcaccgc 5821 tccatggcac tctctaacac cccatgtgtg cccagagctg aggaggctgcatcactc 5881 ccagatgaag gttttgttgc attcacagca aatgaaaatt gtgtactcccagacaaatct 5941 gaaactgctt ctgccacatc attcccaccg tcctatgaga gtgtcactagaggccttagt 6001 richness acatgaggac atctagctca atacaaaatg aagatgaagccaccagtatg 6061 gagctgattg cccctgggcc ctagtgaga cactccagcc tggatatgttcagttatgat 6121 gcgtccttct gctctgtgtt aactctttcc cattgcagat cacacccagctacagcctca 6181 ccaatgcatg ccactggtca caatgtcaga actgggcagg gaatgcaactggtaaccacc 6241 tttgaaaaaa ccatcataca caataggag tcagaagcta agagcacttccactgtgatt 6301 tcccttctga atttcaatat cagatcatgg gttctcttac tctccagaaaatatcccttg 6361 tccttttatt tttgttgtaa tcagattata tttactgaga caaacttctcaggaccaga 6421 cttccaaaga tatagaacaa gaacattact gaaggtccaa ggtagtcctctgtggagcac 6481 catacagaga ttggcaatat tatttaggat tttgcatgac tgcatgtgagagctgtcgga 6541 caactgctct gacccagggt aacacctgtg gcctatgtca tgaaaagcctttgagatatc 6601 cattaaaatt aatattttta aatgta Table 1. Target regions of the SCN10A gene SEQ ID NO: 18-mer target region SEQ ID NO: 2 UAACUACACCAGCUUUGA SEQ ID NO: 3 UUGUCAGCAGAAUACUUA SEQ ID NO: 4 UCAGCAGAAUACUUAGAU SEQ ID NO: 5 GUGACUUCAUCGCUAAUC SEQ ID NO: 6 GCACAGUGACUUCAUCGC SEQ ID NO: 7 UGUCUAAAUGAGUUCACG SEQ ID NO: 8 UUUGAAGCCUUGAUAAAG SEQ ID NO: 9 AUCCUAUGAACCAAUAGC SEQ ID NO: 10 ACUCUUUCAGUGCUGACA SEQ ID NO: 11 GAAUCUCUUUGUUGGGGU SEQ ID NO: 12 AUGAGGACAUCUAGCUCA SEQ ID NO: 13 UUACGGUCACUAUUUUGG SEQ ID NO: 14 CAAUUCUCUUUGGGCUUG SEQ ID NO: 15 CAUGAGCCCUACCUUCGA SEQ ID NO: 16 CAAUGAGUGUUGUCAGUA SEQ ID NO: 17 UUGGCAAGCAGCUCCUAG SEQ ID NO: 18 UCACCAUCUUCUGCCUAA SEQ ID NO: 19 CAGAUGAUGGAGUCUUUC SEQ ID NO: 20 GGCAUAUGUUGGCACAGC SEQ ID NO: 21 AGUGUUGUCAGUAUCAUA SEQ ID NO: 22 CUAUGAACCAAUAGCAAC SEQ ID NO: 23 UGUUGUCAGUAUCAUAAC SEQ ID NO: 24 AUAACAAGUCUGACUGCA SEQ ID NO: 25 UCAUUACCCUGGCAUAUG SEQ ID NO: 26 ACUGACAGGGUCUUCACC SEQ ID NO: 27 AAGCCUUGAUAAAGAUAC SEQ ID NO: 28 UGAGAGUGUCACUAGAGG SEQ ID NO: 29 AUUUCAGCCACUGUCAUU SEQ ID NO: 30 GAUUGUGAAUAACAAGUC SEQ ID NO: 31 UACGGUCACUAUUUUGGU SEQ ID NO: 32 UCAGCAG-Ab-AUACUUAGAU
[0076] Table 2. Exemplary nucleotide sequences of the sense and antisense strands of RNAi reagents that reduce SCN10A gene mRNA transcript expression: Duplex ID NO: SEQ ID NO: Righteous (5' to 3') SEQ ID NO: Antonyms (5'-3') Double-stranded ID NO: 1 SEQ ID NO: 33 UUUAACUACACCAGCUUUGAA SEQ ID NO: 64 UUCAAAGCUGGUGUAGUUAAAAU Double-stranded ID NO: 2 SEQ ID NO: 34 UCUUGUCAGCAGAAUACUUAA SEQ ID NO: 65 UUAAGUAUUCUGCUGACAAGAAA Double-stranded ID NO: 3 SEQ ID NO: 35 UGUCAGCAGAAUACUUAGAUA SEQ ID NO: 66 UAUCUAAGUAUUCUGCUGACAAG Double-stranded ID NO: 4 SEQ ID NO: 36 CAGUGACUUCAUCGCUAAUCA SEQ ID NO: 67 UGAUUAGCGAUGAAGUCACUGUG Double-stranded ID NO: 5 SEQ ID NO: 37 GAGCACAGUGACUUCAUCGCA SEQ ID NO: 68 UGCGAUGAAGUCACUGUGCUCAU Double-stranded ID NO: 6 SEQ ID NO: 38 UUUGUCUAAAUGAGUUCACGA SEQ ID NO: 69 UCGUGAACUCAUUUAGACAAAAU Double-stranded ID NO: 7 SEQ ID NO: 39 CCUUUGAAGCCUUGAUAAAGA SEQ ID NO: 70 UCUUUAUCAAGGCUUCAAAGGUG Double-stranded ID NO: 8 SEQ ID NO: 40 UCAUCCUAUGAACCAAUAGCA SEQ ID NO: 71 UGCUAUUGGUUCAUAGGAUGAUU Double-stranded ID NO: 9 SEQ ID NO: 41 GAACUCUUUCAGUGCUGACAA SEQ ID NO: 72 UUGUCAGCACUGAAAGAGUUCAA Double-stranded ID NO: 10 SEQ ID NO: 42 CUGAAUCUCUUUGUUGGGUA SEQ ID NO: 73 UACCCCAACAAAGAGAUUCAGUG Double-stranded ID NO: 11 SEQ ID NO: 43 ACAUGAGGACAUCUAGCUCAA SEQ ID NO: 74 UUGAGCUAGAUGUCCUCAUGUUG Double-stranded ID NO: 12 SEQ ID NO: 44 UAUUACGGUCACUAUUUUGGA SEQ ID NO: 75 UCCAAAAUAGUGACCGUAAUAAA Double-stranded ID NO: 13 SEQ ID NO: 45 GACAAUUCUCUUUGGGCUUGA SEQ ID NO: 76 UCAAGCCCAAAGAGAAUUGUCUU Double-stranded ID NO: 14 SEQ ID NO: 46 GGCAUGAGCCCUACCUUCGAA SEQ ID NO: 77 UUCGAAGGUAGGGCUCAUGCCAU Double-stranded ID NO: 15 SEQ ID NO: 47 GGCAAUGAGUGUUGUCAGUAA SEQ ID NO: 78 UUACUGACAACACUCAUUGCCCU Double-stranded ID NO: 16 SEQ ID NO: 48 GGUUGGCAAGCAGCUCCUAGA SEQ ID NO: 79 UCUAGGAGCUGCUUGCCAACCAG Double-stranded ID NO: 17 SEQ ID NO: 49 CCUCACCAUCUUCUGCCUAAA SEQ ID NO: 80 UUUAGGCAGAAGAUGGUGAGGAU Double-stranded ID NO: 18 SEQ ID NO: 50 CACAGAUGAUGGAGUCUUUCA SEQ ID NO: 81 UGAAAGACUCCAUCAUCUGUGAC Double-stranded ID NO: 19 SEQ ID NO: 51 CUGGCAUAUGUUGGCACAGCA SEQ ID NO: 82 UGCUGUGCCAACAUAUGCCAGGG Double-stranded ID NO: 20 SEQ ID NO: 52 UGAGUGUUGUCAGUAUCAUAA SEQ ID NO: 83 UUAUGAUACUGACAACACUCAUU Double-stranded ID NO: 21 SEQ ID NO: 53 UCCUAUGAACCAAUAGCAACA SEQ ID NO: 84 UGUUGCUAUUGGUUCAUAGGAUG Double-stranded ID NO: 22 SEQ ID NO: 54 AGUGUUGUCAGUAUCAUAACA SEQ ID NO: 85 UGUUAUGAUACUGACAACACUCA Double-stranded ID NO: 23 SEQ ID NO: 55 GAAUAACAAGUCUGACUGCAA SEQ ID NO: 86 UUGCAGUCAGACUUGUUAUUCAC Double-stranded ID NO: 24 SEQ ID NO: 56 CGUCAUUACCCUGGCAUAUGA SEQ ID NO: 87 UCAUAUGCCAGGGUAAUGACGCU Double-stranded ID NO: 25 SEQ ID NO: 57 ACACUGACAGGGUCUUCACCA SEQ ID NO: 88 UGGUGAAGACCCUGUCAGUGUAC Double-stranded ID NO: 26 SEQ ID NO: 58 UGAAGCCUUGAUAAAGAUACA SEQ ID NO: 89 UGUAUCUUUAUCAAGGCUUCAAA Double-stranded ID NO: 27 SEQ ID NO: 59 UAUGAGAGUGUCACUAGAGGA SEQ ID NO: 90 UCCUCUAGUGACACUCUCAUAGG Double-stranded ID NO: 28 SEQ ID NO: 60 ACAUUUCAGCCACUGUCAUUA SEQ ID NO: 91 UAAUGACAGUGGCUGAAAUGUCU Double-stranded ID NO: 29 SEQ ID NO: 61 UCGAUUGUGAAUAACAAGUCA SEQ ID NO: 92 UGACUUGUUAUUCACAAUCGACA Double-stranded ID NO: 30 SEQ ID NO: 62 AUUACGGUCACUAUUUUGGUA SEQ ID NO: 93 UACCAAAAUAGUGACCGUAAUAA Double-stranded ID NO: 31 SEQ ID NO: 63 UGUCAGCAG-Ab-AUACUUAGAUA SEQ ID NO:66 UAUCUAAGUAUUCUGCUGACAAG
[0077] Table 3A. List of embodiments of the SCN10A RNAi reagent. In some embodiments, the RNAi reagent is conjugated with a delivery portion. In one embodiment, the delivery portion is teg-cholesterol.
[0078] Table 3B. List of alternative embodiments of the SCN10A RNAi reagent and RNAi reagents conjugated with the delivery portion.
[0079] In Tables 3A and 3B, modifications are indicated immediately before the corresponding modified nucleotide. The abbreviation "P" represents a phosphate group; "m" represents methylation of the OH group, resulting in a 2' methoxy modification on the ribose; "f" represents a 2' fluorine modification of the ribose; "*" represents a thiophosphate modification of the phosphodiester bond in the backbone; "Ab" represents a debased residue; "ads" indicates formula Ia; Ahd or Uhd indicates the delivery moiety, which is a 2'-O-hexadecyl nucleobase as shown in Table 10. In some embodiments, the RNAi reagent contains a "phosphate analog" modification placed at the 5' terminal nucleotide of a sense or antisense oligonucleotide instead of the 5'-phosphate group. In some embodiments, the 5' modification is a phosphate group ("p"). In some embodiments, the modification is 5'-(E)-vinylphosphonate (5'-VP or VP). In some embodiments, the sense chain includes a delivery portion conjugated to a nucleotide at position 12 or 13 starting from the 5' end of the sense chain, wherein in some embodiments, the lipophilic delivery portion optionally has Formula I or is 2'-O-hexadecyl. Example
[0080] Example 1: RNAi reagent design RNAi reagents are designed to contain an antisense strand complementary to an 18-mer region of SCN10A having the sequence of transcript NM_000718.4 (SEQ ID NO: 1), as listed in Table 1. The sense and antisense RNA oligonucleotide chains are 18 to 23 nucleotides in length, with optional overhangs of 1, 2, 3, 4, or 5 nucleotides. The nucleotides are characterized by 1–10 fluorine substitutions introduced at the 2' position of the ribose, and the remaining nucleotides are methylated at the 2' position of the ribose (producing a 2' methoxy group, i.e., a 2' O-methyl modification).
[0081] In some embodiments, the sense and / or antisense strands independently comprise one, two, three, four, or five fluorine substitutions introduced at the 2' position of the ribose, and the remaining nucleotide is methylated at the 2' position of the ribose. In some embodiments, the antisense strand is optionally phosphorylated at the 5' end of the strand. In other embodiments, the antisense strand is optionally modified with a vinylphosphonate group at the 5' end of the antisense strand. One or more phosphodiester bonds are present at the 5' and 3' ends of each strand. Optionally, a VPN, e.g., instead of a phosphate, is present at the 5' end of the antisense strand.
[0082] The 18-mer sequence used to generate the complementary antisense strand is shown in Table 1. In some embodiments, the antisense strand is designed to be 23 nucleotides in length.
[0083] The 18-mer in Table 1 is used to produce the double strands shown in Table 2.
[0084] Example 2: Knockdown of SCN10A gene expression in vitro The knockdown of SCN10A expression via RNAi reagent was determined using the following procedure: Human iPSC-derived sensory neurons (purchased from Anatomic) were plated, and each RNAi reagent was added directly to each well. RNAi reagents derived from the sequences in Table 2 were added in duplicate at a single concentration of 1 μM (1000 nM). Treated cells were lysed, and changes in gene expression in RNAi-treated cells were measured using the Cells-to-CT kit, following the manufacturer's protocol (ThermoFisher A35377). Pre-designed gene expression assays (provided as 20x mixtures) were selected from Applied Bio-systems (Foster City, CA, USA). The efficiency of these assays (ThermoFisher Hs_01045139_m1 SCN10A and ThermoFisher Hs99999905_m1 GAPDH) was characterized using a series of cDNA dilutions. RT-qPCR was performed in MicroAmp Optical 384-well plates using a QuantStudio 7 Flex system. The relative levels of gene expression were determined using a ΔΔCT method normalized to the housekeeping gene GAPDH. IC50 was determined by three-parameter logistic fitting using GraphPad Prism v9.0.
[0085] The selected siRNA reagents with nucleotide sequences were tested at multiple concentrations: teg-cholesterol conjugated siRNAs at concentrations of 4000, 1000, 250, 62.5, 15.6, 3.9, 0.98, and 0.24 nM.
[0086] The SCN10A oligonucleotide was conjugated to the lipophilic delivery moiety as follows: a doublet with ID Nos as shown in Tables 4 and 5 was conjugated to teg-cholesterol. The teg-cholesterol conjugates were evaluated for knockdown in iPSC cells in vitro. The sense and antisense strands of the conjugated RNAi reagents are shown in Table 3A.
[0087] The results, representing the percentage knockdown (%KD) of the SCN10A transcript, are shown in Table 4.
[0088] The conjugated RNAi reagents described above were tested in vitro in iPSC cells using the same method. Knockdown results at single or different concentrations are shown in Tables 4 and 5, respectively. Table 5 includes data from multiple concentrations to determine IC50, but only 4 μM and IC50 are shown. ND entries correspond to undetermined measurements.
[0089] Table 4. Summary of %KD of RNAi reagents from Table 3A conjugated with teg-cholesterol, tested at a single concentration in iPSC cells.
[0090] Table 5. Summary of %KD and IC50 values of double-stranded RNAi reagents tested in vitro in iPSC cells with teg-cholesterol conjugates, as listed in Table 3A.
[0091] Example 3: SCN10A knockdown in cultured human DRG cells The selected RNAi reagents were further tested in human DRG cultures. DRG was isolated from deceased human donors and plated in DMEM / F12 medium supplemented with 2% horse serum (ThermoFisher Scientific), 30 ng / ml human NGF-B (N-245; Alomone), 30 ng / ml human GDNF (G-240; Alomone), 10 ng / ml human NT3 (N-260; Alomone), Gem21 NeuroPlex (GeminiBio), and penicillin / streptomycin (10378016; ThermoFisher Scientific), followed by a 3-day maintenance period. Then, siRNA (conjugated to Teg-cholesterol) was added directly to the DRG neuron cultures at a final concentration of 1000 nM, and the culture was allowed to rest for 5 days prior to harvest.
[0092] RNA was harvested. Specifically, siRNA-treated cells were lysed, and cellular RNA was isolated using the RNAdvance v2 for Cell kit (A47943; Beckman Coulter). From 60 μL of eluted RNA, 1.5 μL of total RNA was used for RT-qPCR using the Luna Universal Probe One-Step RT-qPCR kit (E3006E; NEB), following the manufacturer's instructions. TaqMan assays for SCN10A (Hs01045137_m1, Thermo Fisher), GAPDH (Hs99999905_m1, Thermo Fisher), and STMN2 (Hs00975900_m1, Thermo Fisher) were performed to measure gene expression using the QuanStudio 6 Flex system. The ΔΔCt of the RT-qPCR data was analyzed using Design & Analysis Software 2.6.0, and the data were subsequently visualized using GraphPad 9.0.
[0093] The results, as percentage knockdown (%KD) of SCN10A transcript levels, are shown in Table 6.
[0094] Table 6. Summary of the % knockdown of teg-cholesterol conjugates with duplexes as listed in Table 3A in human DRG cultures.
[0095] Example 4: RNAi reagent administered in vivo in rats Lipid-conjugated siRNAs are prepared as described in the art. A 16-carbon carboxylic acid is attached to a nucleotide at the 13th position of the sense strand. The 5' end of the antisense strand is modified with a 5' VP portion. In Table 7, double strand 100 is double strand 32, which comprises a 16-carbon chain displayed on a nucleotide with a 2' hydroxyl group at the 13th position of the sense strand, and the 5' end of the antisense strand is modified with a 5' VP portion instead of 5' P. In Table 7, double strand 101 is double strand 33, which comprises a 16-carbon chain displayed on a nucleotide with a 2' hydroxyl group at the 13th position of the sense strand, and the 5' end of the antisense strand is modified with a 5' VP portion instead of 5' P. In Table 7, double strand 102 is double strand 34, which comprises a 16-carbon chain displayed on the nucleotide of the nucleotide at the 13th position of the sense strand, with the 5' end of the antisense strand modified with a 5' VP portion instead of 5' P. In Table 7, double strand 105 is double strand 37, which comprises a 16-carbon chain displayed on the nucleotide of the nucleotide at the 13th position of the sense strand, with the 5' end of the antisense strand modified with a 5' VP portion instead of 5' P. In Table 7, double strand 106 is double strand 38, which comprises a 16-carbon chain displayed on the nucleotide of the nucleotide at the 13th position of the sense strand, with the 5' end of the antisense strand modified with a 5' VP portion instead of 5' P. In Table 7, double strand 107 is double strand 39, which includes a 16-carbon chain displayed on the nucleotide of the 2' hydroxyl group of the nucleotide at the 13th position of the sense strand, and the 5' end of the antisense strand is modified with a 5' VP portion instead of 5' P.
[0096] Rats expressing the human SCN10A gene at the rat locus were intrathecally administered 4 μg of siRNA or a control vector. Two weeks later, the animals were sacrificed, and the cervical dorsal root ganglia (CDRG), lumbar dorsal root ganglia (LDRG), and upper thoracic dorsal root ganglia (TDRG) were isolated. RNA was prepared as described above, and RT-PCR was performed as described above. The percentage of remaining SCN10A mRNA was measured relative to GAPDH. The results are shown in Table 7.
[0097] Table 7. Percentage of SCN10A mRNA remaining in DRG after in vivo administration of RNAi reagent. Double chain numbering The remaining % mRNA in CDRG % mRNA remaining in LDRG % mRNA remaining in TDRG 100 78 53 82 101 75 49 64 102 70 37 70 105 82 46 86 106 65 31 82 107 89 57 79
[0098] Rats expressing the human SCN10A gene at the rat locus were intrathecally administered 300 μg of siRNA or a control vector. Animals were sacrificed after 1, 2, or 4 weeks (see Table 8), and the cervical dorsal root ganglia (CDRG), lumbar dorsal root ganglia (LDRG), and upper thoracic dorsal root ganglia (TDRG) were isolated. RNA was prepared as described above, and RT-PCR was performed as described above. The percentage of remaining SCN10A mRNA was measured relative to GAPDH. The results are shown in Table 8.
[0099] Table 8. Summary of the remaining % SCN10A mRNA in DRG from in vivo rat studies. Double chain number: % Remaining LDRG 7 days 300 ug % Remaining LDRG 14 days 300 ug % Remaining LDRG 7 days 300 ug % Remaining LDRG 28 days 300 ug 168 37% 37% 171 33% 173 47% 174 47% 175 39% 40% 47% 169 36% 21% 176 32% 21% 178 33% 179 61%
[0100] Example 5: In vivo administration of RNAi reagents in non-human primate (NHP) studies The double-stranded organism was numbered 168 in the cynomolgus monkey (cynomolgus monkey ( Macaca fascicularis In vivo assays were performed to evaluate the efficacy of SCN10A siRNA. To elucidate the efficacy of siRNA in silencing target genes, n=4 cynomolgus monkeys were implanted in the lumbar region using an indwelling intrathecal catheter. Monkeys were infused with either aCSF or double-stranded number 168 (8 mg / ml aCSF solution) over 15 minutes and perfused 29 days later. Tissues collected at necropsy included dorsal root ganglia, spinal cord, nerves, and skin biopsies. qPCR was performed to identify mRNA knockdown in the target region of interest. Table 9 below shows the residual SCN10A mRNA observed in the lumbar DRG 29 days after a single siRNA administration.
[0101] Table 9. Summary of the remaining % mRNA in DRGs from in vivo NHP studies.
[0102] Example 6: Lipophilic delivery moiety, modified nucleotides containing the moiety, and nucleic acid containing the modified nucleotides. Some abbreviations are defined as follows: "ACN" refers to acetonitrile; "AEX" refers to anion exchange; "C / D" refers to cutting and deprotection; "CPG" refers to well-drained glass; "aCSF" refers to artificial cerebrospinal fluid; "DCM" refers to dichloromethane; "DEA" refers to diethylamine; "DIPEA" refers to N,N-diisopropylethylamine; "DMA" refers to dimethylacetamide; "DMAP" refers to 4-dimethylaminopyridine; "DMF" refers to dimethylformamide; "DMSO" refers to dimethyl sulfoxide; "DMT" refers to 4,4'-dimethoxytriphenylmethyl; "EDCI" refers to 1-ethyl-3-(3-dimethylaminopropyl)carbodiimide; "ES / MS" refers to electrospray mass spectrometry; "EtOAc" refers to ethyl acetate; "EtOH" refers to ethanol and ethyl acetate. "alcohol"; "IP-RP" refers to ion-pair reversed-phase chromatography; "LC / MS" refers to liquid chromatography-mass spectrometry; "MeOH" refers to methanol and methyl alcohol; "MPA" refers to mobile phase A; "MPB" refers to mobile phase B; "MWCO" refers to molecular weight cutoff; "NaOAc" refers to sodium acetate; "NHS" refers to N-hydroxysuccinimide; "NMR" refers to nuclear magnetic resonance; "PBS" refers to phosphate buffered saline; "PVDF" refers to polyvinylidene fluoride; "RP" refers to reversed-phase chromatography; "siRNA" refers to small interfering ribonucleic acid; "TCEP" refers to tris(2-carboxyethyl)phosphine; "TEA" refers to triethylamine; "TFA" refers to trifluoroacetic acid; "THF" refers to tetrahydrofuran; "UPLC" refers to ultra-high performance liquid chromatography; and "UV" refers to ultraviolet light.
[0103] Scheme 1, Step A depicts the reaction of compound (1) with 2,2'-dipyridyl disulfide in a solvent system such as MeOH and THF to give compound (2). Step B shows the reaction of compound (2) with 3-mercaptopropionic acid in a solvent such as MeOH to give compound (3). Step C shows the addition of a coupling agent such as EDCI and a catalyst such as DMAP, NHS in a solvent such as DCM to give compound (4). Step D shows the addition of a suitably modified sense chain to compound (4) in the presence of a borate buffer to give compound (5).
[0104] Preparation 1 2-(Dodecyldisulfaneyl)pyridine 1-Dodecylthiol (12.7 g, 61.4 mmol) was added to a solution of 2,2'-dipyridyl disulfide (20.5 g, 92.1 mmol) in MeOH (90 mL) and THF (5 mL). The mixture was stirred at ambient temperature for 16 hours and then concentrated under vacuum. The resulting residue was purified by rapid silica gel chromatography eluting with a hexane solution of 0–15% EtOAc to give the title compound as a colorless oil (14.35 g, 75%). ES / MS (m / z): 312 (M+H).
[0105] Preparation 2 3-(dodecyl dithioalkyl)propionic acid 3-Mercaptopropionic acid (7.58 g, 71.44 mmol) was added to a solution of 2-(dodecyldithioalkyl)pyridine (18.55 g, 59.5 mmol) in MeOH (60 mL). The reaction was stirred at ambient temperature for 1 hour, followed by concentration under vacuum. The resulting residue was purified by rapid silica gel chromatography eluting with a 5–30% EtOAc solution in hexane to give the title compound as a colorless oil (14 g, 76%). 1 H NMR (DMSO- d 6) δ 2.86 (t, 2H, J = 7.0 Hz), 2.71(t, 2H, J = 7.0 Hz), 2.62 (t, 2H, J = 7.0 Hz), 1.61 (quintet, 2H), 1.33 (q, 2H), 1.28 (s, 16H), 0.90 (t, 3H), J = 6.8 Hz).
[0106] Preparation 3 2,5-Dioxopyrrolidone-1-yl 3-(dodecyl dithioalkyl)propionate NHS (1.35 g, 11.7 mmol) was added to a solution of 3-(dodecyldithioalkyl)propionic acid (3.0 g, 9.8 mmol), EDCI (2.25 g, 11.7 mmol), and DMAP (0.24 g, 2 mmol) in DCM (39 mL). The mixture was stirred at ambient temperature for 3 hours and then concentrated under vacuum. The resulting residue was purified by rapid silica gel chromatography eluting with a hexane solution of 0–40% EtOAc to give the title compound as a white solid (3.2 g, 81%). 1 H NMR (DMSO- d 6) δ 3.10 (t, 2H, J = 6.3 Hz), 2.99 (t, 2H, J = 6.3 Hz), 2.80 (s, 4H), 2.75 (t, 2H, J = 7.0 Hz), 1.61 (quintet, 2H), 1.33 (q, 2H), 1.28 (s, 16H), 0.90 (t, 3H), J = 6.8Hz).
[0107] C12 ADS linked siRNA The sense chain (3.1 g, 0.44 mmol) synthesized under the conditions described below in 4X borate buffer water (113 mL) was treated with a solution of 2,5-dioxopyrrolidone-1-yl 3-(dodecyl dithioalkyl)propionate (5.3 g, 4.4 mmol) in ACN (113 mL). The solution was shaken at 30°C for 1.5 h. The reaction was quenched by dilution with water and adjustment to pH 7 with 1.2 M HCl aqueous solution. The organic solvent was then removed by concentration via Genevac, yielding crude oligonucleotides.
[0108] Crude oligonucleotides were purified using the AKTA™ Pure purification system via reverse phase on a Source 15 RPC column (MPA: 50 mM NaOAc with 10% ACN and MPB: 80% ACN / water). In all cases, fractions containing greater than 85% mass purity and free from >5% impurities were combined.
[0109] The purified oligonucleotides were centrifuged in 15 mL 3K MWCO rotation tubes at 3500 rpm. xgDesalting was performed for approximately 30 minutes. The oligonucleotides were washed with RNase-free water until the eluent conductivity reached <100 usemi / cm. After desalting, 2–3 mL of RNase-free water was added, followed by aspiration at 10x, and the retentate was transferred to a 50 mL Falcon tube. This was repeated until complete transfer of the oligonucleotides was achieved by measuring the concentration of the compound on the filter via a nanodrop. The final oligonucleotides were then centrifuged in a 15 mL 100 K MWCO rotary centrifuge at 3500 rpm. xg Next 2 minutes, nanofiltration 2x. The final desalted oligonucleotides were analyzed for concentration (nano drop at A260) and characterized by IP-RP, LCMS for mass purity, and UPLC for UV purity. ES / MS (m / z): 7324.6 (M+H).
[0110] Table 10. Non-limiting implementation schemes for the delivery portion.
[0111] The delivery portions in Table 10 are synthesized and concatenated using standard methods. See, for example, WO2019 / 217459.
[0112] Example 7: Tissue Distribution and Microglial Cell Proliferation Analysis The selected SCN10A RNAi reagent was evaluated in rats for its tissue distribution and microglial proliferation. Rats received intrathecal injections of either double-stranded 168 or double-stranded 169 RNA reagent or PBS (phosphate-buffered saline). Animals were sacrificed two months after injection.
[0113] RNAi reagent tissue distribution and microglial proliferation analysis Selected tissues from the brain or spinal cord of treated rats were prepared for imaging. Images of rat tissues were analyzed for inflammation based on the criteria in Table 11.
[0114] Table 11. Microglial proliferation score Microglial proliferation score describe No inflammation Unactivated microglia. Minimal inflammation 3-5 focal lesions spanning the tissue show activated microglia. Microglia primary processes thicken, and cell bodies begin to round. The microglia upregulate the marker IBA1. Mild inflammation Five to ten focal lesions were observed across activated microglia in the tissue. Primary processes of microglia had thickened and were beginning to retract into the cell body. Microglia had lost most of their secondary and tertiary processes. The number of microglia was increased, and they continued to upregulate the marker IBA1. Moderate inflammation Activated microglia diffusely across the tissue. The microglia have become amoeba-like in shape. Small primary processes may be present, but no secondary or tertiary processes are present. The number of microglia continues to increase, and they continue to upregulate IBA1 marker expression. Severe inflammation Activated microglia are diffusely present across the tissue. The microglia are amoeba-like and lack processes. The number of microglia is increased, and there is high expression of the marker IBA1.
Claims
1. An SCN10A RNA interference (RNAi) reagent comprising a sense strand and an antisense strand, wherein the antisense strand comprises a sequence complementary to at least 15 nucleotides of a sequence selected from any one of SEQ ID NO: 2-32, wherein the sense strand and the antisense strand form a duplex, and optionally wherein each of the sense strand or the antisense strand independently comprises one or more modified nucleotides, and optionally wherein the internucleotide bonds of one or more nucleotides of the sense strand or the antisense strand are modified internucleotide bonds.
2. The RNAi reagent according to claim 1, wherein the antisense strand comprises a sequence complementary to 18 consecutive nucleotides from any one of SEQ ID NO: 2-32.
3. The RNAi reagent according to claim 1 or 2, wherein the antisense strand comprises a 3' overhang of two nucleotides.
4. The RNAi reagent according to claim 1, 2 or 3, wherein the antisense strand is 23 nucleotides in length.
5. The RNAi reagent according to any one of claims 1 to 4, wherein the sense strand is 21 nucleotides in length.
6. The RNAi reagent according to any one of claims 1 to 5, wherein the antisense strand comprises the sequence of any one of SEQ ID NO: 64 to 93.
7. The RNAi reagent according to any one of claims 1 to 6, wherein the sense strand comprises a sequence of any one of 33 to 63.
8. The RNAi reagent according to claim 1, wherein the sense strand and antisense strand form a double helix comprising a pair of nucleic acid sequences as listed in Table 2.
9. The RNAi reagent according to any one of claims 1 to 8, wherein the sense strand comprises SEQ ID NO: 35; and the antisense strand comprises SEQ ID NO: 66, or the sense strand comprises SEQ ID NO: 39, and the antisense strand comprises SEQ ID NO:
70.
10. The RNAi reagent according to any one of claims 1 to 9, wherein the RNAi reagent further comprises a delivery portion.
11. The RNAi reagent of claim 10, wherein the delivery portion is a lipophilic delivery portion.
12. The RNAi reagent of claim 11, wherein the lipophilic delivery portion optionally has formula I or is 2'-O-hexadecyl.
13. The RNAi reagent according to any one of claims 1 to 12, wherein the one or more modified nucleotides are independently 2'-fluorine modified nucleotides or 2'-O-methyl modified nucleotides.
14. The RNAi reagent according to any one of claims 1 to 13, wherein each nucleotide of the sense strand and each nucleotide of the antisense strand is modified.
15. The RNAi reagent according to any one of claims 1 to 14, wherein the antisense strand is 23 nucleotides in length, and wherein each nucleotide of the antisense strand is a modified nucleotide, and wherein the one or more modified nucleotides contain a 2' fluorine modification present at one of the following positions: a. Positions 2, 3, 7, 14, and 16, starting from the 5' end of the antisense chain; b. Positions 2, 5, 7, 14, and 16 starting from the 5' end of the antisense chain; c. Positions 2, 3, 8, 14, and 16 starting from the 5' end of the antisense chain; d. Positions 2, 5, 8, 14, and 16, starting from the 5' end of the antisense chain; e. Positions 2, 14, and 16 starting from the 5' end of the antisense chain; or f. Positions 2, 6, 14, and 16, starting from the 5' end of the antisense chain.
16. The RNAi reagent according to any one of claims 1 to 14, wherein the sense strand is 21 nucleotides in length, and wherein each nucleotide of the sense strand is a modified nucleotide, and wherein the one or more modified nucleotides contain a 2' fluorine modification present at one of the following positions: a. Positions 9, 10, and 11, starting from the 5' end of the meaningful chain; b. Positions 7, 9, and 11 starting from the 5' end of the meaningful chain; c. Positions 7, 9, and 10 starting from the 5' end of the sense chain; d. Positions 7, 10, and 11 starting from the 5' end of the sense chain; or e. Positions 7, 9, 10, and 11, starting from the 5' end of the meaningful chain.
17. The RNAi reagent according to any one of claims 1 to 16, wherein the RNAi reagent comprises one or more modified internucleotide bonds that are phosphate thioester bonds.
18. The RNAi reagent of claim 17, wherein the sense strand has four or five phosphate thioester bonds.
19. The RNAi reagent according to claim 18, wherein the antisense strand has four or five phosphate thioester bonds.
20. The RNAi reagent according to any one of claims 1 to 19, wherein the nucleotide at the 5' end of the antisense strand has a phosphate group or a phosphate analog.
21. The RNAi reagent according to any one of claims 1 to 20, wherein the nucleotide at the 5' end of the antisense strand has a phosphate analog of 5'-(E)-vinylphosphonate.
22. The RNAi reagent according to any one of claims 1 to 21, wherein the sense strand has been modified or further modified to be a debasement moiety.
23. The RNAi reagent according to any one of claims 1 to 22, wherein each nucleotide at positions 2, 6, 14 and 16 from the 5' end of the antisense strand and at positions 7, 9, 10 and 11 from the 5' end of the sense strand comprises a 2' fluorine modification.
24. The RNAi reagent according to any one of claims 1 to 22, wherein each nucleotide at positions 2, 5, 7, 14 and 16 from the 5' end of the antisense strand and at positions 9, 10 and 11 from the 5' end of the sense strand comprises a 2' fluorine modification.
25. The RNAi reagent according to any one of claims 1 to 22, wherein each nucleotide at positions 2, 3, 7, 14 and 16 from the 5' end of the antisense strand and at positions 9, 10 and 11 from the 5' end of the sense strand comprises a 2' fluorine modification.
26. The RNAi reagent according to any one of claims 1 to 22, wherein each nucleotide at positions 2, 5, 8, 14 and 16 from the 5' end of the antisense strand and at positions 9, 10 and 11 from the 5' end of the sense strand comprises a 2' fluorine modification.
27. The RNAi reagent according to any one of claims 1 to 22, wherein each nucleotide at positions 2, 14 and 16 from the 5' end of the antisense strand and at positions 9, 10 and 11 from the 5' end of the sense strand contains a 2' fluorine modification.
28. The RNAi reagent according to any one of claims 1 to 22, wherein each nucleotide at positions 2, 5, 7, 14 and 16 from the 5' end of the antisense strand and at positions 7, 9, 10 and 11 from the 5' end of the sense strand comprises a 2' fluorine modification.
29. The RNAi reagent according to any one of claims 10 to 28, wherein the delivery portion is a lipophilic delivery portion conjugated to a nucleotide at position 12 or 13 starting from the 5' end of the sense strand.
30. The RNAi reagent according to any one of claims 10 to 29, wherein the delivery portion is a lipophilic delivery portion conjugated to a nucleotide at position 12 or 13 from the 5' end of the sense strand, wherein the lipophilic delivery portion is 2'-O-hexadecyl.
31. The RNAi reagent according to any one of claims 10 to 29, wherein the delivery portion is a lipophilic delivery portion conjugated to a nucleotide at position 12 or 13 from the 5' end of the sense strand, wherein the lipophilic delivery portion has formula I.
32. The RNAi reagent according to any one of claims 1 to 7 and 10 to 31, wherein the sense strand and antisense strand form a double helix, and wherein: a. The sense strand has at least 90% sequence identity with SEQ ID NO:33; and the antisense strand has at least 90% sequence identity with SEQ ID NO:64; b. The sense strand has at least 90% sequence identity with SEQ ID NO:34; and the antisense strand has at least 90% sequence identity with SEQ ID NO:65; c. The sense strand has at least 90% sequence identity with SEQ ID NO:35; and the antisense strand has at least 90% sequence identity with SEQ ID NO:66; d. The sense strand has at least 90% sequence identity with SEQ ID NO:36; and the antisense strand has at least 90% sequence identity with SEQ ID NO:67; e. The sense strand has at least 90% sequence identity with SEQ ID NO:37; and the antisense strand has at least 90% sequence identity with SEQ ID NO:68; f. The sense strand has at least 90% sequence identity with SEQ ID NO:38; and the antisense strand has at least 90% sequence identity with SEQ ID NO:69; g. The sense strand has at least 90% sequence identity with SEQ ID NO:39; and the antisense strand has at least 90% sequence identity with SEQ ID NO:70; h. The sense strand has at least 90% sequence identity with SEQ ID NO:40; and the antisense strand has at least 90% sequence identity with SEQ ID NO:71; i. The sense strand has at least 90% sequence identity with SEQ ID NO:41; and the antisense strand has at least 90% sequence identity with SEQ ID NO:72; j. The sense strand has at least 90% sequence identity with SEQ ID NO:42; and the antisense strand has at least 90% sequence identity with SEQ ID NO:73; k. The sense strand has at least 90% sequence identity with SEQ ID NO:43; and the antisense strand has at least 90% sequence identity with SEQ ID NO:74; l. The sense strand has at least 90% sequence identity with SEQ ID NO:44; and the antisense strand has at least 90% sequence identity with SEQ ID NO:75; m. The sense strand has at least 90% sequence identity with SEQ ID NO:45; and the antisense strand has at least 90% sequence identity with SEQ ID NO:76; n. The sense strand has at least 90% sequence identity with SEQ ID NO:46; and the antisense strand has at least 90% sequence identity with SEQ ID NO:77; o. The sense strand has at least 90% sequence identity with SEQ ID NO:47; and the antisense strand has at least 90% sequence identity with SEQ ID NO:78; p. The sense strand has at least 90% sequence identity with SEQ ID NO:48; and the antisense strand has at least 90% sequence identity with SEQ ID NO:79; q. The sense strand has at least 90% sequence identity with SEQ ID NO:49; and the antisense strand has at least 90% sequence identity with SEQ ID NO:80; r. The sense strand has at least 90% sequence identity with SEQ ID NO:50; and the antisense strand has at least 90% sequence identity with SEQ ID NO:81; s. The sense strand has at least 90% sequence identity with SEQ ID NO:51; and the antisense strand has at least 90% sequence identity with SEQ ID NO:82; t. The sense strand has at least 90% sequence identity with SEQ ID NO:52; and the antisense strand has at least 90% sequence identity with SEQ ID NO:83; u. The sense strand has at least 90% sequence identity with SEQ ID NO:53; and the antisense strand has at least 90% sequence identity with SEQ ID NO:84; v. The sense strand has at least 90% sequence identity with SEQ ID NO:54; and the antisense strand has at least 90% sequence identity with SEQ ID NO:85; w. The sense strand has at least 90% sequence identity with SEQ ID NO:55; and the antisense strand has at least 90% sequence identity with SEQ ID NO:86; x. The sense strand has at least 90% sequence identity with SEQ ID NO:56; and the antisense strand has at least 90% sequence identity with SEQ ID NO:87; y. The sense strand has at least 90% sequence identity with SEQ ID NO:57; and the antisense strand has at least 90% sequence identity with SEQ ID NO:88; z. The sense strand has at least 90% sequence identity with SEQ ID NO:58; and the antisense strand has at least 90% sequence identity with SEQ ID NO:89; aa. The sense strand has at least 90% sequence identity with SEQ ID NO:59; and the antisense strand has at least 90% sequence identity with SEQ ID NO:90; bb. The sense strand has at least 90% sequence identity with SEQ ID NO:60; and the antisense strand has at least 90% sequence identity with SEQ ID NO:91; cc. The sense strand has at least 90% sequence identity with SEQ ID NO:61; and the antisense strand has at least 90% sequence identity with SEQ ID NO:92; dd. The sense strand has at least 90% sequence identity with SEQ ID NO:62; and the antisense strand has at least 90% sequence identity with SEQ ID NO:93; or ee. The sense strand has at least 90% sequence identity with SEQ ID NO:63; and the antisense strand has at least 90% sequence identity with SEQ ID NO:
66.
33. The RNAi reagent according to any one of claims 1 to 7 and 9-31, wherein: a. The sense chain comprises SEQ ID NO:94, and the antisense chain comprises SEQ ID NO:132; b. The sense chain comprises SEQ ID NO:95, and the antisense chain comprises SEQ ID NO:133; c. The sense chain comprises SEQ ID NO:96, and the antisense chain comprises SEQ ID NO:134; d. The sense chain comprises SEQ ID NO:97, and the antisense chain comprises SEQ ID NO:135; e. The sense chain comprises SEQ ID NO:98, and the antisense chain comprises SEQ ID NO:136; f. The sense chain comprises SEQ ID NO:99, and the antisense chain comprises SEQ ID NO:137; g. The sense chain comprises SEQ ID NO:100, and the antisense chain comprises SEQ ID NO:138; h. The sense chain comprises SEQ ID NO:101, and the antisense chain comprises SEQ ID NO:139; i. The sense chain comprises SEQ ID NO:102, and the antisense chain comprises SEQ ID NO:140; j. The sense chain comprises SEQ ID NO:103, and the antisense chain comprises SEQ ID NO:141; k. The sense chain comprises SEQ ID NO:104, and the antisense chain comprises SEQ ID NO:142; l. The sense chain comprises SEQ ID NO:105, and the antisense chain comprises SEQ ID NO:143; m. The sense chain comprises SEQ ID NO:106, and the antisense chain comprises SEQ ID NO:144; n. The sense chain comprises SEQ ID NO:107, and the antisense chain comprises SEQ ID NO:145; o. The sense chain comprises SEQ ID NO:108, and the antisense chain comprises SEQ ID NO:146; p. The sense chain comprises SEQ ID NO:109, and the antisense chain comprises SEQ ID NO:147; q. The sense chain comprises SEQ ID NO:110, and the antisense chain comprises SEQ ID NO:148; r. The sense chain contains SEQ ID NO:111, and the antisense chain contains SEQ ID NO:149; s. The sense chain comprises SEQ ID NO:112, and the antisense chain comprises SEQ ID NO:150; t. The sense chain comprises SEQ ID NO:113, and the antisense chain comprises SEQ ID NO:151; u. The sense chain comprises SEQ ID NO:114, and the antisense chain comprises SEQ ID NO:152; v. The sense chain comprises SEQ ID NO:115, and the antisense chain comprises SEQ ID NO:153; w. The sense chain comprises SEQ ID NO:116, and the antisense chain comprises SEQ ID NO:154; x. The sense chain comprises SEQ ID NO:117, and the antisense chain comprises SEQ ID NO:155; y. The sense chain comprises SEQ ID NO:118, and the antisense chain comprises SEQ ID NO:156; z. The sense chain comprises SEQ ID NO:119, and the antisense chain comprises SEQ ID NO:157; aa. The sense chain comprises SEQ ID NO:120, and the antisense chain comprises SEQ ID NO:158; bb. The sense chain comprises SEQ ID NO:121, and the antisense chain comprises SEQ ID NO:159; cc. The sense chain comprises SEQ ID NO:122, and the antisense chain comprises SEQ ID NO:160; dd. The sense chain comprises SEQ ID NO:123, and the antisense chain comprises SEQ ID NO:161; ee. The sense chain contains SEQ ID NO:96, and the antisense chain contains SEQ ID NO:162; ff. The sense chain contains SEQ ID NO:96, and the antisense chain contains SEQ ID NO:163; gg. The sense chain contains SEQ ID NO:96, and the antisense chain contains SEQ ID NO:164; hh. The sense chain contains SEQ ID NO:96, and the antisense chain contains SEQ ID NO:165; ii. The sense chain comprises SEQ ID NO:96, and the antisense chain comprises SEQ ID NO:166; jj. The sense chain contains SEQ ID NO:124, and the antisense chain contains SEQ ID NO:162; kk. The sense chain contains SEQ ID NO:124, and the antisense chain contains SEQ ID NO:163; 11. The sense chain comprises SEQ ID NO:124, and the antisense chain comprises SEQ ID NO:164; mm. The sense chain comprises SEQ ID NO:124, and the antisense chain comprises SEQ ID NO:165; nn. The sense chain comprises SEQ ID NO:124, and the antisense chain comprises SEQ ID NO:166; oo. The sense chain contains SEQ ID NO:124, and the antisense chain contains SEQ ID NO:134; pp. The sense chain comprises SEQ ID NO:125, and the antisense chain comprises SEQ ID NO:162; qq. The sense chain contains SEQ ID NO:125, and the antisense chain contains SEQ ID NO:163; rr. The sense chain contains SEQ ID NO:125, and the antisense chain contains SEQ ID NO:164; The sense chain comprises SEQ ID NO:125, and the antisense chain comprises SEQ ID NO:165; tt. The sense chain comprises SEQ ID NO:125, and the antisense chain comprises SEQ ID NO:166; uu. The sense chain contains SEQ ID NO:125, and the antisense chain contains SEQ ID NO:134; vv. The sense chain comprises SEQ ID NO:126, and the antisense chain comprises SEQ ID NO:162; The sense chain contains SEQ ID NO:126, and the antisense chain contains SEQ ID NO:163; xx. The sense chain comprises SEQ ID NO:126, and the antisense chain comprises SEQ ID NO:164; The sense chain comprises SEQ ID NO:126, and the antisense chain comprises SEQ ID NO:165; zz. The sense chain contains SEQ ID NO:126, and the antisense chain contains SEQ ID NO:166; aaa. The sense chain contains SEQ ID NO:126, and the antisense chain contains SEQ ID NO:134; bbb. The sense chain contains SEQ ID NO:127, and the antisense chain contains SEQ ID NO:167; ccc. The sense chain contains SEQ ID NO:127, and the antisense chain contains SEQ ID NO:168; ddd. The sense chain contains SEQ ID NO:127, and the antisense chain contains SEQ ID NO:169; eee. The sense chain contains SEQ ID NO:128, and the antisense chain contains SEQ ID NO:170; fff. The sense chain contains SEQ ID NO:128, and the antisense chain contains SEQ ID NO:171; ggg. The sense chain contains SEQ ID NO:128, and the antisense chain contains SEQ ID NO:172; hhh. The sense chain contains SEQ ID NO:129, and the antisense chain contains SEQ ID NO:173; iii. The sense chain comprises SEQ ID NO:129, and the antisense chain comprises SEQ ID NO:174; jjj. The sense chain contains SEQ ID NO:129, and the antisense chain contains SEQ ID NO:175; kkk. The sense chain contains SEQ ID NO:130, and the antisense chain contains SEQ ID NO:176; lll. The sense chain comprises SEQ ID NO:130, and the antisense chain comprises SEQ ID NO:177; mmm. The sense chain contains SEQ ID NO:130, and the antisense chain contains SEQ ID NO:178; nnn. The sense chain contains SEQ ID NO:131, and the antisense chain contains SEQ ID NO:179; ooo. The sense chain contains SEQ ID NO:131, and the antisense chain contains SEQ ID NO:180; ppp. The sense chain contains SEQ ID NO:131, and the antisense chain contains SEQ ID NO:181; qqq. The sense chain contains SEQ ID NO:232, and the antisense chain contains SEQ ID NO:233; The sense chain comprises SEQ ID NO:234, and the antisense chain comprises SEQ ID NO:235; The sense chain contains SEQ ID NO:236, and the antisense chain contains SEQ ID NO:233; The sense chain comprises SEQ ID NO:237, and the antisense chain comprises SEQ ID NO:233; uuu. The sense chain contains SEQ ID NO:238, and the antisense chain contains SEQ ID NO:239; vvv. The sense chain contains SEQ ID NO:240, and the antisense chain contains SEQ ID NO:239; www. The sense chain contains SEQ ID NO:238, and the antisense chain contains SEQ ID NO:235; xxx. The sense chain contains SEQ ID NO:240, and the antisense chain contains SEQ ID NO:235; yyy. The sense chain contains SEQ ID NO:241, and the antisense chain contains SEQ ID NO:235; zzz. The sense chain contains SEQ ID NO:238, and the antisense chain contains SEQ ID NO:242; aaaa. The sense chain contains SEQ ID NO:232, and the antisense chain contains SEQ ID NO:239; bbbb. The sense chain contains SEQ ID NO:240, and the antisense chain contains SEQ ID NO:242; The sense chain comprises SEQ ID NO:94, and the antisense chain comprises SEQ ID NO:182; The sense chain contains SEQ ID NO:95, and the antisense chain contains SEQ ID NO:183; eeee. The sense chain contains SEQ ID NO:96, and the antisense chain contains SEQ ID NO:184; The sense chain contains SEQ ID NO:97, and the antisense chain contains SEQ ID NO:185; gggg. The sense chain contains SEQ ID NO:98, and the antisense chain contains SEQ ID NO:186; hhhh. The sense chain contains SEQ ID NO:99, and the antisense chain contains SEQ ID NO:187; iiii. The sense chain comprises SEQ ID NO:100, and the antisense chain comprises SEQ ID NO:188; jjjj. The sense chain contains SEQ ID NO:101, and the antisense chain contains SEQ ID NO:189; kkkk. The sense chain contains SEQ ID NO:102, and the antisense chain contains SEQ ID NO:190; llll. The sense chain comprises SEQ ID NO:103, and the antisense chain comprises SEQ ID NO:191; mmmm. The sense chain contains SEQ ID NO:104, and the antisense chain contains SEQ ID NO:192; The sense chain comprises SEQ ID NO:105, and the antisense chain comprises SEQ ID NO:193; The sense chain comprises SEQ ID NO:106, and the antisense chain comprises SEQ ID NO:194; pppp. The sense chain comprises SEQ ID NO:107, and the antisense chain comprises SEQ ID NO:195; qqqq. The sense chain contains SEQ ID NO:108, and the antisense chain contains SEQ ID NO:196; The sense chain contains SEQ ID NO:109, and the antisense chain contains SEQ ID NO:197; The sense chain contains SEQ ID NO:110, and the antisense chain contains SEQ ID NO:198; The sense chain contains SEQ ID NO:111, and the antisense chain contains SEQ ID NO:199; uuuu. The sense chain contains SEQ ID NO:112, and the antisense chain contains SEQ ID NO:200; vvvv. The sense chain contains SEQ ID NO:113, and the antisense chain contains SEQ ID NO:201; www. The sense chain includes SEQ ID NO:114, and the antisense chain includes SEQ ID NO:202; xxxx. The sense chain contains SEQ ID NO:115, and the antisense chain contains SEQ ID NO:203; yyyy. The sense chain contains SEQ ID NO:116, and the antisense chain contains SEQ ID NO:204; zzzz. The sense chain contains SEQ ID NO:117, and the antisense chain contains SEQ ID NO:205; aaaaa. The sense chain contains SEQ ID NO:118, and the antisense chain contains SEQ ID NO:206; bbbbb. The sense chain contains SEQ ID NO:119, and the antisense chain contains SEQ ID NO:207; ccccc. The sense chain contains SEQ ID NO:120, and the antisense chain contains SEQ ID NO:208; ddddd. The sense chain contains SEQ ID NO:121, and the antisense chain contains SEQ ID NO:209; eeeee. The sense chain contains SEQ ID NO:122, and the antisense chain contains SEQ ID NO:210; fffff. The sense chain contains SEQ ID NO:123, and the antisense chain contains SEQ ID NO:211; ggggg. The sense chain contains SEQ ID NO:96, and the antisense chain contains SEQ ID NO:212; hhhhh. The sense chain contains SEQ ID NO:96, and the antisense chain contains SEQ ID NO:213; iiiii. The sense chain comprises SEQ ID NO:96, and the antisense chain comprises SEQ ID NO:214; jjjjj. The sense chain contains SEQ ID NO:96, and the antisense chain contains SEQ ID NO:215; kkkkk. The sense chain contains SEQ ID NO:96, and the antisense chain contains SEQ ID NO:216; lllll. The sense chain contains SEQ ID NO:124, and the antisense chain contains SEQ ID NO:212; mmmmm. The sense chain contains SEQ ID NO:124, and the antisense chain contains SEQ ID NO:213; nnnnn. The sense chain contains SEQ ID NO:124, and the antisense chain contains SEQ ID NO:214; ooooo. The sense chain contains SEQ ID NO:124, and the antisense chain contains SEQ ID NO:215; ppppp. The sense chain contains SEQ ID NO:124, and the antisense chain contains SEQ ID NO:216; The sense chain contains SEQ ID NO:124, and the antisense chain contains SEQ ID NO:184; rrrrr. The sense chain contains SEQ ID NO:125, and the antisense chain contains SEQ ID NO:212; The sense chain contains SEQ ID NO:125, and the antisense chain contains SEQ ID NO:213; The sense chain comprises SEQ ID NO:125, and the antisense chain comprises SEQ ID NO:214; uuuuu. The sense chain contains SEQ ID NO:125, and the antisense chain contains SEQ ID NO:215; vvvvv. The sense chain contains SEQ ID NO:125, and the antisense chain contains SEQ ID NO:216; www. The sense chain contains SEQ ID NO:125, and the antisense chain contains SEQ ID NO:184; xxxxx. The sense chain contains SEQ ID NO:126, and the antisense chain contains SEQ ID NO:212; yyyyy. The sense chain contains SEQ ID NO:126, and the antisense chain contains SEQ ID NO:213; zzzzz. The sense chain contains SEQ ID NO:126, and the antisense chain contains SEQ ID NO:214; aaaaaa. The sense chain contains SEQ ID NO:126, and the antisense chain contains SEQ ID NO:215; bbbbbb. The sense chain contains SEQ ID NO:126, and the antisense chain contains SEQ ID NO:216; cccccc. The sense chain contains SEQ ID NO:126, and the antisense chain contains SEQ ID NO:184; The sense chain contains SEQ ID NO:127, and the antisense chain contains SEQ ID NO:217; eeeeee. The sense chain contains SEQ ID NO:127, and the antisense chain contains SEQ ID NO:218; ffffff. The sense chain contains SEQ ID NO:127, and the antisense chain contains SEQ ID NO:219; gggggg. The sense chain contains SEQ ID NO:128, and the antisense chain contains SEQ ID NO:220; hhhhhh. The sense chain contains SEQ ID NO:128, and the antisense chain contains SEQ ID NO:221; iiiiii. The sense chain comprises SEQ ID NO:128, and the antisense chain comprises SEQ ID NO:222; jjjjjj. The sense chain contains SEQ ID NO:129, and the antisense chain contains SEQ ID NO:223; kkkkkk. The sense chain contains SEQ ID NO:129, and the antisense chain contains SEQ ID NO:224; llllll. The sense chain comprises SEQ ID NO:129, and the antisense chain comprises SEQ ID NO:225; mmmmmm. The sense chain contains SEQ ID NO:130, and the antisense chain contains SEQ ID NO:226; The sense chain comprises SEQ ID NO:130, and the antisense chain comprises SEQ ID NO:227; oooooo. The sense chain contains SEQ ID NO:130, and the antisense chain contains SEQ ID NO:228; pppppp. The sense chain contains SEQ ID NO:131, and the antisense chain contains SEQ ID NO:229; qqqqqq. The sense chain contains SEQ ID NO:131, and the antisense chain contains SEQ ID NO:230; The sense chain contains SEQ ID NO:131, and the antisense chain contains SEQ ID NO:231; The sense chain contains SEQ ID NO:232, and the antisense chain contains SEQ ID NO:184; The sense chain comprises SEQ ID NO:234, and the antisense chain comprises SEQ ID NO:215; uuuuuu. The sense chain contains SEQ ID NO:236, and the antisense chain contains SEQ ID NO:184; vvvvvv. The sense chain contains SEQ ID NO:237, and the antisense chain contains SEQ ID NO:184; wwwwww. The sense chain contains SEQ ID NO:238, and the antisense chain contains SEQ ID NO:213; The sense chain comprises SEQ ID NO:240, and the antisense chain comprises SEQ ID NO:213; yyyyyy. The sense chain contains SEQ ID NO:238, and the antisense chain contains SEQ ID NO:215; zzzzzz. The sense chain contains SEQ ID NO:240, and the antisense chain contains SEQ ID NO:215; aaaaaaa. The sense chain contains SEQ ID NO:241, and the antisense chain contains SEQ ID NO:215; bbbbbbb. The sense chain contains SEQ ID NO:238, and the antisense chain contains SEQ ID NO:212; ccccccc. The sense chain contains SEQ ID NO:232, and the antisense chain contains SEQ ID NO:213; The sense chain contains SEQ ID NO:240, and the antisense chain contains SEQ ID NO:
214.
34. The RNAi reagent according to claim 33, wherein: a. The sense chain is composed of SEQ ID NO:94, and the antisense chain is composed of SEQ ID NO:132; b. The sense chain is composed of SEQ ID NO:95, and the antisense chain is composed of SEQ ID NO:133; c. The sense chain is composed of SEQ ID NO:96, and the antisense chain is composed of SEQ ID NO:134; d. The sense strand is composed of SEQ ID NO:97, and the antisense strand is composed of SEQ ID NO:135; e. The sense chain is composed of SEQ ID NO:98, and the antisense chain is composed of SEQ ID NO:136; f. The sense chain consists of SEQ ID NO:99, and the antisense chain consists of SEQ ID NO:137; g. The sense chain is composed of SEQ ID NO:100, and the antisense chain is composed of SEQ ID NO:138; h. The sense chain is composed of SEQ ID NO:101, and the antisense chain is composed of SEQ ID NO:139; i. The sense chain is composed of SEQ ID NO:102, and the antisense chain is composed of SEQ ID NO:140; j. The sense chain is composed of SEQ ID NO:103, and the antisense chain is composed of SEQ ID NO:141; k. The sense chain is composed of SEQ ID NO:104, and the antisense chain is composed of SEQ ID NO:142; l. The sense chain is composed of SEQ ID NO:105, and the antisense chain is composed of SEQ ID NO:143; m. The sense chain is composed of SEQ ID NO:106, and the antisense chain is composed of SEQ ID NO:144; n. The sense chain is composed of SEQ ID NO:107, and the antisense chain is composed of SEQ ID NO:145; o. The sense chain is composed of SEQ ID NO:108, and the antisense chain is composed of SEQ ID NO:146; p. The sense chain is composed of SEQ ID NO:109, and the antisense chain is composed of SEQ ID NO:147; q. The sense chain is composed of SEQ ID NO:110, and the antisense chain is composed of SEQ ID NO:148; r. The sense chain consists of SEQ ID NO:111, and the antisense chain consists of SEQ ID NO:149; s. The sense chain is composed of SEQ ID NO:112, and the antisense chain is composed of SEQ ID NO:150; t. The sense chain is composed of SEQ ID NO:113, and the antisense chain is composed of SEQ ID NO:151; u. The sense chain consists of SEQ ID NO:114, and the antisense chain consists of SEQ ID NO:152; v. The sense chain is composed of SEQ ID NO:115, and the antisense chain is composed of SEQ ID NO:153; w. The sense chain is composed of SEQ ID NO:116, and the antisense chain is composed of SEQ ID NO:154; x. The sense chain is composed of SEQ ID NO:117, and the antisense chain is composed of SEQ ID NO:155; y. The sense chain consists of SEQ ID NO:118, and the antisense chain consists of SEQ ID NO:156; z. The sense chain is composed of SEQ ID NO:119, and the antisense chain is composed of SEQ ID NO:157; aa. The sense chain is composed of SEQ ID NO:120, and the antisense chain is composed of SEQ ID NO:158; bb. The sense chain consists of SEQ ID NO:121, and the antisense chain consists of SEQ ID NO:159; cc. The sense chain consists of SEQ ID NO:122, and the antisense chain consists of SEQ ID NO:160; dd. The sense chain is composed of SEQ ID NO:123, and the antisense chain is composed of SEQ ID NO:161; ee. The sense chain consists of SEQ ID NO:96, and the antisense chain consists of SEQ ID NO:162; ff. The sense chain consists of SEQ ID NO:96, and the antisense chain consists of SEQ ID NO:163; gg. The sense chain consists of SEQ ID NO:96, and the antisense chain consists of SEQ ID NO:164; hh. The sense chain consists of SEQ ID NO:96, and the antisense chain consists of SEQ ID NO:165; ii. The sense chain consists of SEQ ID NO:96, and the antisense chain consists of SEQ ID NO:166; jj. The sense chain is composed of SEQ ID NO:124, and the antisense chain is composed of SEQ ID NO:162; kk. The sense chain consists of SEQ ID NO:124, and the antisense chain consists of SEQ ID NO:163; 11. The sense chain is composed of SEQ ID NO:124, and the antisense chain is composed of SEQ ID NO:164; mm. The sense chain is composed of SEQ ID NO:124, and the antisense chain is composed of SEQ ID NO:165; The sense chain is composed of SEQ ID NO:124, and the antisense chain is composed of SEQ ID NO:166; oo. The sense chain is composed of SEQ ID NO:124, and the antisense chain is composed of SEQ ID NO:134; pp. The sense strand is composed of SEQ ID NO:125, and the antisense strand is composed of SEQ ID NO:162; The sense chain is composed of SEQ ID NO:125, and the antisense chain is composed of SEQ ID NO:163; rr. The sense chain consists of SEQ ID NO:125, and the antisense chain consists of SEQ ID NO:164; The sense chain is composed of SEQ ID NO:125, and the antisense chain is composed of SEQ ID NO:165; The sense chain is composed of SEQ ID NO:125, and the antisense chain is composed of SEQ ID NO:166; uu. The sense chain is composed of SEQ ID NO:125, and the antisense chain is composed of SEQ ID NO:134; vv. The sense chain consists of SEQ ID NO:126, and the antisense chain consists of SEQ ID NO:162; The sense chain is composed of SEQ ID NO:126, and the antisense chain is composed of SEQ ID NO:163; xx. The sense chain is composed of SEQ ID NO:126, and the antisense chain is composed of SEQ ID NO:164; The sense chain is composed of SEQ ID NO:126, and the antisense chain is composed of SEQ ID NO:165; zz. The sense chain consists of SEQ ID NO:126, and the antisense chain consists of SEQ ID NO:166; aaa. The sense chain is composed of SEQ ID NO:126, and the antisense chain is composed of SEQ ID NO:134; bbb. The sense chain consists of SEQ ID NO:127, and the antisense chain consists of SEQ ID NO:167; ccc. The sense chain consists of SEQ ID NO:127, and the antisense chain consists of SEQ ID NO:168; ddd. The sense chain is composed of SEQ ID NO:127, and the antisense chain is composed of SEQ ID NO:169; eee. The sense chain consists of SEQ ID NO:128, and the antisense chain consists of SEQ ID NO:170; fff. The sense chain consists of SEQ ID NO:128, and the antisense chain consists of SEQ ID NO:171; ggg. The sense chain consists of SEQ ID NO:128, and the antisense chain consists of SEQ ID NO:172; hhh. The sense chain is composed of SEQ ID NO:129, and the antisense chain is composed of SEQ ID NO:173; iii. The sense chain is composed of SEQ ID NO:129, and the antisense chain is composed of SEQ ID NO:174; jjj. The sense chain is composed of SEQ ID NO:129, and the antisense chain is composed of SEQ ID NO:175; kkk. The sense chain is composed of SEQ ID NO:130, and the antisense chain is composed of SEQ ID NO:176; lll. The sense chain consists of SEQ ID NO:130, and the antisense chain consists of SEQ ID NO:177; mmm. The sense chain is composed of SEQ ID NO:130, and the antisense chain is composed of SEQ ID NO:178; The sense chain is composed of SEQ ID NO:131, and the antisense chain is composed of SEQ ID NO:179; ooo. The sense chain is composed of SEQ ID NO:131, and the antisense chain is composed of SEQ ID NO:180; ppp. The sense chain consists of SEQ ID NO:131, and the antisense chain consists of SEQ ID NO:181; The sense chain is composed of SEQ ID NO:232, and the antisense chain is composed of SEQ ID NO:233; The sense chain is composed of SEQ ID NO:234, and the antisense chain is composed of SEQ ID NO:235; The sense chain is composed of SEQ ID NO:236, and the antisense chain is composed of SEQ ID NO:233; The sense chain is composed of SEQ ID NO:237, and the antisense chain is composed of SEQ ID NO:233; uuu. The sense chain is composed of SEQ ID NO:238, and the antisense chain is composed of SEQ ID NO:239; vvv. The sense chain consists of SEQ ID NO:240, and the antisense chain consists of SEQ ID NO:239; www. The sense chain is composed of SEQ ID NO:238, and the antisense chain is composed of SEQ ID NO:235; xxx. The sense chain is composed of SEQ ID NO:240, and the antisense chain is composed of SEQ ID NO:235; The sense chain is composed of SEQ ID NO:241, and the antisense chain is composed of SEQ ID NO:235; zzz. The sense chain is composed of SEQ ID NO:238, and the antisense chain is composed of SEQ ID NO:242; aaaa. The sense chain is composed of SEQ ID NO:232, and the antisense chain is composed of SEQ ID NO:239; bbbb. The sense chain consists of SEQ ID NO:240, and the antisense chain consists of SEQ ID NO:242; The sense chain is composed of SEQ ID NO:94, and the antisense chain is composed of SEQ ID NO:182; The sense chain is composed of SEQ ID NO:95, and the antisense chain is composed of SEQ ID NO:183; eeee. The sense chain consists of SEQ ID NO:96, and the antisense chain consists of SEQ ID NO:184; The sense chain is composed of SEQ ID NO:97, and the antisense chain is composed of SEQ ID NO:185; gggg. The sense chain consists of SEQ ID NO:98, and the antisense chain consists of SEQ ID NO:186; hhhh. The sense chain is composed of SEQ ID NO:99, and the antisense chain is composed of SEQ ID NO:187; iiii. The sense chain consists of SEQ ID NO:100, and the antisense chain consists of SEQ ID NO:188; jjjj. The sense chain is composed of SEQ ID NO:101, and the antisense chain is composed of SEQ ID NO:189; kkkk. The sense chain is composed of SEQ ID NO:102, and the antisense chain is composed of SEQ ID NO:190; llll. The sense chain consists of SEQ ID NO:103, and the antisense chain consists of SEQ ID NO:191; mmmm. The sense chain is composed of SEQ ID NO:104, and the antisense chain is composed of SEQ ID NO:192; The sense chain is composed of SEQ ID NO:105, and the antisense chain is composed of SEQ ID NO:193; The sense chain is composed of SEQ ID NO:106, and the antisense chain is composed of SEQ ID NO:194; pppp. The sense chain consists of SEQ ID NO:107, and the antisense chain consists of SEQ ID NO:195; The sense chain is composed of SEQ ID NO:108, and the antisense chain is composed of SEQ ID NO:196; The sense chain is composed of SEQ ID NO:109, and the antisense chain is composed of SEQ ID NO:197; The sense chain is composed of SEQ ID NO:110, and the antisense chain is composed of SEQ ID NO:198; The sense chain is composed of SEQ ID NO:111, and the antisense chain is composed of SEQ ID NO:199; uuuu. The sense chain consists of SEQ ID NO:112, and the antisense chain consists of SEQ ID NO:200; vvvv. The sense chain consists of SEQ ID NO:113, and the antisense chain consists of SEQ ID NO:201; www. The sense chain consists of SEQ ID NO:114, and the antisense chain consists of SEQ ID NO:202; xxxx. The sense chain consists of SEQ ID NO:115, and the antisense chain consists of SEQ ID NO:203; The sense chain is composed of SEQ ID NO:116, and the antisense chain is composed of SEQ ID NO:204; zzzz. The sense chain consists of SEQ ID NO:117, and the antisense chain consists of SEQ ID NO:205; aaaaa. The sense chain is composed of SEQ ID NO:118, and the antisense chain is composed of SEQ ID NO:206; bbbbb. The sense chain consists of SEQ ID NO:119, and the antisense chain consists of SEQ ID NO:207; ccccc. The sense chain consists of SEQ ID NO:120, and the antisense chain consists of SEQ ID NO:208; ddddd. The sense chain is composed of SEQ ID NO:121, and the antisense chain is composed of SEQ ID NO:209; eeeee. The sense chain consists of SEQ ID NO:122, and the antisense chain consists of SEQ ID NO:210; fffff. The sense chain consists of SEQ ID NO:123, and the antisense chain consists of SEQ ID NO:211; ggggg. The sense chain consists of SEQ ID NO:96, and the antisense chain consists of SEQ ID NO:212; hhhhh. The sense chain is composed of SEQ ID NO:96, and the antisense chain is composed of SEQ ID NO:213; iiiii. The sense chain is composed of SEQ ID NO:96, and the antisense chain is composed of SEQ ID NO:214; jjjjj. The sense chain is composed of SEQ ID NO:96, and the antisense chain is composed of SEQ ID NO:215; kkkkk. The sense chain consists of SEQ ID NO:96, and the antisense chain consists of SEQ ID NO:216; lllll. The sense chain consists of SEQ ID NO:124, and the antisense chain consists of SEQ ID NO:212; mmmmm. The sense chain is composed of SEQ ID NO:124, and the antisense chain is composed of SEQ ID NO:213; nnnnn. The sense chain consists of SEQ ID NO:124, and the antisense chain consists of SEQ ID NO:214; ooooo. The sense chain is composed of SEQ ID NO:124, and the antisense chain is composed of SEQ ID NO:215; ppppp. The sense chain consists of SEQ ID NO:124, and the antisense chain consists of SEQ ID NO:216; The sense chain is composed of SEQ ID NO:124, and the antisense chain is composed of SEQ ID NO:184; The sense chain is composed of SEQ ID NO:125, and the antisense chain is composed of SEQ ID NO:212; The sense chain is composed of SEQ ID NO:125, and the antisense chain is composed of SEQ ID NO:213; The sense chain is composed of SEQ ID NO:125, and the antisense chain is composed of SEQ ID NO:214; uuuuu. The sense chain contains SEQ ID NO:125, and the antisense chain contains SEQ ID NO:215; vvvvv. The sense chain consists of SEQ ID NO:125, and the antisense chain consists of SEQ ID NO:216; www. The sense chain is composed of SEQ ID NO:125, and the antisense chain is composed of SEQ ID NO:184; xxxxx. The sense chain is composed of SEQ ID NO:126, and the antisense chain is composed of SEQ ID NO:212; The sense chain is composed of SEQ ID NO:126, and the antisense chain is composed of SEQ ID NO:213; zzzzz. The sense chain consists of SEQ ID NO:126, and the antisense chain consists of SEQ ID NO:214; aaaaaa. The sense chain is composed of SEQ ID NO:126, and the antisense chain is composed of SEQ ID NO:215; bbbbbb. The sense chain consists of SEQ ID NO:126, and the antisense chain consists of SEQ ID NO:216; The sense chain is composed of SEQ ID NO:126, and the antisense chain is composed of SEQ ID NO:184; The sense chain is composed of SEQ ID NO:127, and the antisense chain is composed of SEQ ID NO:217; eeeeee. The sense chain is composed of SEQ ID NO:127, and the antisense chain is composed of SEQ ID NO:218; The sense chain is composed of SEQ ID NO:127, and the antisense chain is composed of SEQ ID NO:219; The sense chain is composed of SEQ ID NO:128, and the antisense chain is composed of SEQ ID NO:220; hhhhhh. The sense chain is composed of SEQ ID NO:128, and the antisense chain is composed of SEQ ID NO:221; iiiiii. The sense chain consists of SEQ ID NO:128, and the antisense chain consists of SEQ ID NO:222; jjjjjj. The sense chain is composed of SEQ ID NO:129, and the antisense chain is composed of SEQ ID NO:223; kkkkkk. The sense chain is composed of SEQ ID NO:129, and the antisense chain is composed of SEQ ID NO:224; The sense chain is composed of SEQ ID NO:129, and the antisense chain is composed of SEQ ID NO:225; mmmmmm. The sense chain is composed of SEQ ID NO:130, and the antisense chain is composed of SEQ ID NO:226; The sense chain is composed of SEQ ID NO:130, and the antisense chain is composed of SEQ ID NO:227; The sense chain is composed of SEQ ID NO:130, and the antisense chain is composed of SEQ ID NO:228; pppppp. The sense chain is composed of SEQ ID NO:131, and the antisense chain is composed of SEQ ID NO:229; qqqqqq. The sense chain is composed of SEQ ID NO:131, and the antisense chain is composed of SEQ ID NO:230; The sense chain is composed of SEQ ID NO:131, and the antisense chain is composed of SEQ ID NO:231; The sense chain is composed of SEQ ID NO:232, and the antisense chain is composed of SEQ ID NO:184; The sense chain is composed of SEQ ID NO:234, and the antisense chain is composed of SEQ ID NO:215; uuuuuu. The sense chain is composed of SEQ ID NO:236, and the antisense chain is composed of SEQ ID NO:184; vvvvvv. The sense chain consists of SEQ ID NO:237, and the antisense chain consists of SEQ ID NO:184; wwwwww. The sense chain is composed of SEQ ID NO:238, and the antisense chain is composed of SEQ ID NO:213; The sense chain is composed of SEQ ID NO:240, and the antisense chain is composed of SEQ ID NO:213; The sense chain is composed of SEQ ID NO:238, and the antisense chain is composed of SEQ ID NO:215; zzzzzz. The sense chain consists of SEQ ID NO:240, and the antisense chain consists of SEQ ID NO:215; aaaaaaa. The sense chain is composed of SEQ ID NO:241, and the antisense chain is composed of SEQ ID NO:215; bbbbbbb. The sense chain is composed of SEQ ID NO:238, and the antisense chain is composed of SEQ ID NO:212; ccccccc. The sense chain consists of SEQ ID NO:232, and the antisense chain consists of SEQ ID NO:213; The sense chain is composed of SEQ ID NO:240, and the antisense chain is composed of SEQ ID NO:
214.
35. The RNAi reagent of claim 33, comprising a delivery portion, wherein the delivery portion is a lipophilic delivery portion conjugated to a nucleotide at position 12 or 13 from the 5' end of the sense strand.
36. The RNAi reagent of claim 35, wherein the delivery portion is a lipophilic delivery portion conjugated to a nucleotide at position 12 or 13 from the 5' end of the sense strand, wherein the lipophilic delivery portion is 2'-O-hexadecyl.
37. The RNAi reagent according to any one of claims 1-19, wherein the delivery portion is a lipophilic delivery portion conjugated to a nucleotide at position 12 or 13 from the 5' end of the sense strand, wherein the lipophilic delivery portion has formula I.
38. The RNAi reagent according to claim 1, wherein: a. The sense chain comprises SEQ ID NO: 35; and the antisense chain comprises SEQ ID NO: 66, or b. The sense strand comprises SEQ ID NO: 39, and the antisense strand comprises SEQ ID NO: 70, and The first nucleotide from the 5' end of the antisense strand is a nucleotide modified with a phosphate analog, wherein optionally the phosphate analog is a 5'-vinylphosphonate; wherein the sense strand and antisense strand have one, two, three, or four modified nucleotide bonds, wherein optionally the modified nucleotide bonds are thiophosphate bonds; wherein each nucleotide of the sense strand and antisense strand is a modified nucleotide, wherein the modified nucleotide of the antisense strand is a 2'-fluorinated nucleotide at positions 2, 6, 14, and 16 from the 5' end of the antisense strand, and a 2'-O-methylated nucleotide at the remaining positions; wherein the modified nucleotide of the sense strand is a 2'-fluorinated nucleotide at positions 7, 9, 10, and 11 from the 5' end of the sense strand, a 2'-O-C16 alkylated nucleotide at position 13 from the 5' end of the sense strand, and a 2'-O-methylated nucleotide at the remaining positions.
39. The RNAi reagent according to claim 1, wherein: a. The sense strand comprises SEQ ID NO: 35; and the antisense strand comprises SEQ ID NO: 66, or b. The sense strand comprises SEQ ID NO: 39, and the antisense strand comprises SEQ ID NO: 70, and The first nucleotide from the 5' end of the antisense strand is a nucleotide modified with a phosphate analog, wherein optionally the phosphate analog is a 5'-vinylphosphonate; wherein the sense strand and the antisense strand have one, two, three, or four modified nucleotide bonds, wherein optionally the modified nucleotide bonds are thiophosphate bonds; wherein each nucleotide of the sense strand and the antisense strand is a modified nucleotide, wherein the modified nucleotide of the antisense strand is a 2'-fluorinated nucleotide at positions 2, 6, 14, and 16 from the 5' end of the antisense strand, and a 2'-O-methylated nucleotide at the remaining positions; wherein the modified nucleotide of the sense strand is a 2'-fluorinated nucleotide at positions 7, 9, 10, and 11 from the 5' end of the sense strand, a 2'-O-C16 alkylated nucleotide at position 12 from the 5' end of the sense strand, and a 2'-O-methylated nucleotide at the remaining positions.
40. The RNAi reagent according to claim 1, wherein: a. The sense strand comprises SEQ ID NO: 35; and the antisense strand comprises SEQ ID NO: 66, or b. The sense strand comprises SEQ ID NO: 39, and the antisense strand comprises SEQ ID NO: 70, and The first nucleotide from the 5' end of the antisense strand is a nucleotide modified with a phosphate analog, wherein optionally the phosphate analog is 5'-vinylphosphonate; wherein the sense strand and antisense strand have one, two, three, or four modified nucleotide bonds, wherein optionally the modified nucleotide bonds are thiophosphate bonds; wherein each nucleotide of the sense strand and antisense strand is a modified nucleotide, wherein the modified nucleotide of the antisense strand is a 2'-fluorinated nucleotide at positions 2, 5, 8, 14, and 16 from the 5' end of the antisense strand, and a 2'-O-methylated nucleotide at the remaining positions; wherein the modified nucleotide of the sense strand is a 2'-fluorinated nucleotide at positions 9, 10, and 11 from the 5' end of the sense strand, a nucleotide of formula Ib at position 12 from the 5' end of the sense strand, and a 2'-O-methylated nucleotide at the remaining positions.
41. The RNAi reagent according to claim 1, wherein the antisense strand is substantially composed of SEQ ID NO: 233 and the sense strand is substantially composed of SEQ ID NO:
232.
42. The RNAi reagent according to claim 1, wherein the antisense strand is substantially composed of SEQ ID NO: 235 and the sense strand is substantially composed of SEQ ID NO:
234.
43. The RNAi reagent according to claim 1, wherein the antisense strand is substantially composed of SEQ ID NO: 233 and the sense strand is substantially composed of SEQ ID NO:
236.
44. The RNAi reagent according to any one of claims 1 to 43, for use in treatment.
45. The RNAi reagent according to any one of claims 1 to 43, for the treatment of pain, optionally chronic pain.
46. Use of the RNAi reagent according to any one of claims 1 to 43, for the manufacture of a medicament for treating pain, optionally chronic pain.
47. A pharmaceutical composition comprising an RNAi reagent according to any one of claims 1 to 43 and one or more pharmaceutically acceptable excipients.
48. A method of treating pain in a patient with this need, comprising administering an RNAi reagent or a pharmaceutical composition thereof according to any one of claims 1 to 43.
49. The method of claim 48, wherein the RNAi reagent or pharmaceutical composition of any one of claims 1-43 is administered intrathecally or epidurally.
Citation Information
Patent Citations
5′ phosphate mimics
US8927513B2
5'-end derivatives
WO2011133871A2
4'-phosphate analogs and oligonucleotides comprising the same
WO2018045317A1
Extrahepatic delivery
WO2019217459A1