Recombinant III-type collagen with antioxidant effect as well as preparation method and application of recombinant III-type collagen

Abstract

The invention belongs to the technical field of biological medicine, and particularly relates to recombinant III-type collagen with an anti-oxidation effect and a preparation method and application of the recombinant III-type collagen. The invention discloses recombinant III type collagen with an antioxidant effect. The amino acid sequence of the recombinant III type collagen is shown as SEQ ID NO. 1; 1, and a nucleotide sequence for coding the recombinant III type collagen is as shown in SEQ ID NO. 2. According to the present invention, the effective sequence of the human type III collagen is selected to construct and express the recombinant type III collagen FR4, and the recombinant type III collagen has characteristics of significant antioxidant effect, no cytotoxicity and good safety. When being applied to skin care products, the skin care product can effectively improve skin epidermis and dermis structures, promote skin collagen absorption and improve skin elasticity, and has a good application prospect.

Description

Technical Field

[0001] This invention belongs to the field of biomedical technology, specifically relating to a recombinant type III collagen with antioxidant effects, its preparation method, and its application. Background Technology

[0002] Collagen is the most abundant and widely distributed functional protein in mammals, and as a biological macromolecule, it is widely present in connective tissues. Collagen possesses excellent biocompatibility, biodegradability, low immunogenicity, and various biological activities, thus finding wide application in cosmetics, food, pharmaceuticals, and tissue engineering. Currently, collagen preparation methods are mainly divided into animal-derived extraction methods and genetic engineering methods. Animal-derived extraction methods, primarily using acid and enzymatic methods, offer cost advantages but also pose risks such as the transmission of animal-derived diseases, potential immunogenicity issues, and limited production capacity.

[0003] Genetic engineering methods for preparing collagen through recombinant expression systems offer significant advantages, including well-defined components, high safety, and controllable processes. Given the growing demand for high-quality collagen in the high-end medical materials and health supplement markets, developing recombinant collagen technology has become a crucial industry trend. Among the 28 known collagen types, type III collagen plays a key role in regulating physiological processes such as cell adhesion, proliferation, migration, and differentiation. Recombinant type III collagen obtained using synthetic biology techniques exhibits an amino acid sequence highly consistent with natural human type III collagen and retains multiple active sites, effectively mediating cell surface receptor signal transduction. However, current technologies vary in sequence design and activity maintenance strategies among different products, and their overall efficacy, particularly specific biological activities such as antioxidant activity, still requires further optimization.

[0004] To achieve the above objectives, this invention provides a recombinant type III collagen with clear and enhanced antioxidant effects, and further discloses its preparation method and its application in the field of skincare products, in order to overcome the shortcomings of the prior art. Summary of the Invention

[0005] The primary objective of this invention is to provide a recombinant type III collagen with antioxidant properties.

[0006] The second objective of this invention is to provide a method for preparing recombinant type III collagen with antioxidant effects.

[0007] The third objective of this invention is to provide an application of recombinant type III collagen with antioxidant effects in the preparation of skin care products.

[0008] To achieve the above objectives, the technical solution adopted by the present invention is as follows: A recombinant type III collagen with antioxidant properties, the amino acid sequence of which is shown in SEQ ID NO.1.

[0009] Furthermore, the nucleotide sequence encoding the recombinant type III collagen is shown in SEQ ID NO.2.

[0010] The above-described method for preparing recombinant type III collagen with antioxidant effects includes the following steps: (1) The nucleotide sequence encoding recombinant type III collagen with antioxidant effects was ligated to a vector to obtain a recombinant plasmid; (2) The recombinant plasmid obtained in step (1) was transferred into competent cells, and expressed by IPTG to obtain cell pellet. (3) The bacterial precipitate obtained in step (2) is separated and purified to obtain recombinant type III collagen with antioxidant effects.

[0011] Furthermore, the specific operation of step (1) is as follows: S1. The effective sequence of human type III collagen was spliced ​​together to obtain the amino acid sequence SEQ ID NO.1 of recombinant type III collagen; S2. Based on the amino acid sequence SEQ ID NO.1 of recombinant type III collagen, a gene sequence was reverse-engineered and codons were optimized to obtain the nucleotide sequence SEQ ID NO.2 encoding recombinant type III collagen; S3. Based on the nucleotide sequence SEQ ID NO.2 obtained in step S2, design upstream and downstream primers to amplify the corresponding nucleotide sequence of recombinant type III collagen, clone the recombinant collagen nucleotide sequence amplified by the primers into the pET30a vector, and construct a recombinant plasmid.

[0012] Further, the competent cells in step (2) are E. coli BL21 (DE3); the induction concentration of IPTG is 0.3-0.6 mM, and the induction time of IPTG is 5-7 h.

[0013] Furthermore, the separation and purification described in step (3) employs one or more of the following: chromatographic chromatography, ion exchange chromatography, and affinity chromatography.

[0014] The above describes the application of a recombinant type III collagen with antioxidant properties in the preparation of skincare products.

[0015] Compared with the prior art, the main advantages of the present invention are as follows: This invention utilizes the effective sequence of human type III collagen to construct and express a recombinant type III collagen protein, FR4, through genetic engineering. This recombinant type III collagen protein exhibits significant antioxidant effects, is non-cytotoxic, and demonstrates good safety. Its application in skincare products can effectively improve the structure of the epidermis and dermis, promote collagen absorption, and enhance skin elasticity. It is suitable for the research and development of skincare products focused on anti-oxidation and barrier repair, and shows promising application prospects. Attached Figure Description

[0016] Figure 1 The plasmid map of recombinant plasmid pET30a-FR4; Figure 2 This is an expression diagram of the purified recombinant type III collagen FR4 prepared in this invention; Figure 3 The plasmid map of recombinant plasmid pET30a-HF2; Figure 4 The graph shows the effect of different concentrations of recombinant type III collagen on the relative cell proliferation rate. Figure 5 The graph shows the DPPH- free radical scavenging rate of recombinant type III collagen FR4. Detailed Implementation

[0017] The technical solution of the present invention will be further described below with reference to specific embodiments. However, those skilled in the art should understand that the following embodiments are only for illustrating the present invention and should not be regarded as limiting the present invention. Specific conditions not specified in the embodiments are performed according to conventional conditions or conditions recommended by the manufacturer. Unless otherwise specified, the reagents or instruments used are all conventional products obtained through commercial channels.

[0018] Example 1 A recombinant type III collagen FR4 with antioxidant properties, wherein the amino acid sequence of the recombinant type III collagen with antioxidant properties is shown in SEQ ID NO.1, and the nucleotide sequence encoding the recombinant type III collagen with antioxidant properties is shown in SEQ ID NO.2.

[0019] The preparation method of the above-mentioned recombinant type III collagen FR4 with antioxidant effects specifically includes the following steps: (1) The hydrophobicity and protein stability of the functional regions of the amino acid sequence of human type III α1 chain collagen were analyzed. Short peptide fragments of amino acids 168-242 and 822-917 were selected. These two short peptide fragments were connected end to end to form a 171aa short peptide as a repeating unit and repeated twice to obtain a new collagen peptide. Then, GTSGHPGYQGAR was added to the tail of the new collagen peptide to obtain recombinant type III collagen FR4, which improved the hydrophilicity and stability of recombinant collagen. The recombinant collagen retained the core functional sequence of human type III collagen and had high biological activity. The amino acid sequence is shown in SEQ ID NO.1.

[0020] (2) Based on the amino acid sequence of recombinant type III collagen FR4 (SEQ ID NO.1), a reverse gene sequence was designed, and the corresponding base sequence was optimized according to the codon preference of E. coli in expressing heterologous proteins to obtain the nucleotide sequence encoding recombinant type III collagen, as shown in SEQ ID NO.2. Upstream and downstream primers for amplifying humanized collagen were designed based on the optimized nucleotide sequence. The upstream primer's nucleotide sequence was CATATGGGTCTGGCTGGTTACCCAGGTCCAG, containing the Nde I restriction site CATATG, and the downstream primer's nucleotide sequence was AAGCTACGCGCACCCTGGTAACCCGGATGA, containing the Hind III restriction site AAGCTTT. The gene was amplified by PCR, and the FR4 gene fragment was purified using a gel extraction kit.

[0021] Table 1 Sequence List (3) The plasmid pET30a was double-digested with restriction endonucleases Nde I and Hind III. The double digestion reaction system is shown in Table 2. The expression vector pET30a recovered from double digestion was mixed with the amplified and recovered recombinant collagen FR4 gene fragment, and T4 DNA ligase was added. Details are shown in Table 3. The correct recombinant plasmid pET30a-FR4 was obtained by sequencing and identification. The map of the recombinant plasmid pET30a-FR4 is shown in Table 3. Figure 1 As shown.

[0022] Table 2. Double enzyme digestion reaction system Table 3. T4 DNA ligase reaction system (4) The correct recombinant plasmid pET30a-FR4 obtained in step (3) was transformed into E. coli BL21(DE3) engineered bacteria, plated on LB agar containing 100 μg / mL kanamycin, incubated overnight at 37°C with the plate inverted, and single colonies were selected for PCR verification to obtain the correct recombinant strain, named pET30a-FR4 / BL21. Positive single colonies were selected and inoculated into LB medium containing 100 μg / mL kanamycin, and cultured overnight at 37°C with shaking to obtain seed culture. The seed culture was inoculated into LB medium containing 100 μg / mL kanamycin at an inoculation rate of 5 v / v%, and cultured at 37°C with shaking until OD 600 The concentration was set to 0.8, the temperature was lowered to 25℃, and 0.5mM IPTG was added to induce the expression of recombinant type III collagen FR4 for 6 hours, resulting in bacterial cell precipitation.

[0023] (5) Recombinant type III collagen FR4 was purified by affinity chromatography to obtain recombinant collagen FR4. The purified recombinant type III collagen FR4 was detected by SDS-PAGE gel electrophoresis, and the results are as follows: Figure 2 As shown.

[0024] Comparative Example 1 A recombinant type III collagen HF2 with antioxidant effects, wherein the amino acid sequence of the recombinant type III collagen with antioxidant effects is shown in SEQ ID NO.3, and the nucleotide sequence encoding the recombinant type III collagen with antioxidant effects is shown in SEQ ID NO.4.

[0025] The preparation method of the above-mentioned recombinant type III collagen HF2 with antioxidant effects specifically includes the following steps: (1) The hydrophobicity and protein stability of the functional regions of the amino acid sequence of human type III α1 chain collagen were analyzed. Short peptide fragments of amino acids 168-242 and 822-917 were selected and spliced ​​together to form a new collagen. The recombinant protein structure composed of 171 amino acids is 100% identical to the corresponding protein sequence in the original human collagen III, and the recombinant type III collagen HF2 is obtained. The amino acid sequence is shown in SEQ ID NO.3.

[0026] (2) Based on the amino acid sequence of recombinant type III collagen HF2 (SEQ ID NO.3), a reverse gene sequence was designed, and the corresponding base sequence was codon optimized according to the codon preference of E. coli expressing heterologous proteins to obtain the nucleotide sequence encoding recombinant type III collagen, as shown in SEQ ID NO.4. Upstream and downstream primers for amplifying humanized collagen were designed based on the optimized nucleotide sequence. The upstream primer nucleotide sequence was CATATGGGTCTGGCTGGTTACCCAGGT, containing the NdeI restriction site CATATG, and the downstream primer nucleotide sequence was AAGCTTCGGAGAACCCGGCGCACCGG, containing the HindIII restriction site AAGCTT. The gene was amplified by PCR, and the target fragment HF2 gene fragment was purified using a gel extraction kit.

[0027] Table 4 Sequence List (3) The plasmid pET30a was double-digested with restriction endonucleases Nde I and Hind III. The double digestion reaction system is shown in Table 2. The expression vector pET30a recovered from double digestion was mixed with the amplified and recovered recombinant collagen HF2 gene fragment, and T4 DNA ligase was added. Details are shown in Table 3. The correct recombinant plasmid pET30a-HF2 was obtained by sequencing and identification. The map of recombinant plasmid pET30a-HF2 is shown below. Figure 3 As shown.

[0028] (4) The correct recombinant plasmid pET30a-HF2 obtained in step (3) was transformed into E. coli BL21 (DE3) engineered bacteria, plated on LB agar containing 100 μg / mL kanamycin, incubated overnight at 37°C with the plate inverted position, and single colonies were selected for PCR verification to obtain the correct recombinant strain, named pET30a-HF2 / BL21. Positive single colonies were selected and inoculated into LB medium containing 100 μg / mL kanamycin, and cultured overnight at 37°C with shaking to obtain seed culture. The seed culture was inoculated into LB medium containing 100 μg / mL kanamycin at an inoculation rate of 5 v / v%, and cultured at 37°C with shaking until OD 600 The concentration was set to 0.8, the temperature was lowered to 25℃, and 0.5mM IPTG was added to induce the expression of recombinant type III collagen HF2 for 6 hours, resulting in bacterial cell precipitation.

[0029] (5) Recombinant type III collagen HF2 was purified by affinity chromatography to obtain recombinant type III collagen HF2.

[0030] Experimental Example 1 Safety evaluation of recombinant type III collagen FR4 and HF2: (1) Fibroblast L929 cells were cultured in DMEM medium containing 10% fetal bovine serum and double antibiotic PS, and placed in an incubator at 37°C and 5% CO2. To ensure the reliability of the experiments, all experiments used cells in the logarithmic growth phase.

[0031] (2) Take L929 fibroblasts in good growth condition and use 6×10 3 The cells were seeded at a density of 100 μL / mL into 96-well cell culture plates and incubated at 37°C in a 5% CO2 incubator for 30 hours.

[0032] (3) Discard the original culture medium from step (2), and add 100 μL of cell culture medium diluted with different concentrations of recombinant type III collagen FR4 and HF2 (0.25 g / L, 0.5 g / L, 1 g / L) to each well. These are set as Example 1 group and Comparative Example 1 group, respectively. At the same time, a negative control group (DMEM medium containing 10% fetal bovine serum + double anti-PS medium) is set up, with 3 replicates for each group.

[0033] (4) After drug treatment, the cells were cultured for another 40 hours. After the culture was completed, 50 μL of MTT solution was added to each well, and the cells were returned to the incubator and incubated at 37°C for 2 hours. All supernatant in the wells was carefully aspirated. Immediately 150 μL of dimethyl sulfoxide (DMSO) was added, and the cells were gently shaken at room temperature for 20 minutes to ensure that the generated formazan crystals were completely dissolved.

[0034] (5) The absorbance (A) of each well was measured at a wavelength of 490 nm using an ELISA reader, and the relative cell proliferation rate (RGR) was calculated as (absorbance of experimental group / absorbance of negative control group) × 100%. The toxicity of recombinant type III collagen FR4 and HF2 was evaluated based on the relative cell proliferation rate, as shown in Table 5. The results of the relative cell proliferation rate of recombinant type III collagen FR4 and HF2 at 40 h are as follows: Figure 4 As shown.

[0035] Table 5. Relative cell proliferation rate and cytotoxicity level The results are as follows Figure 4 The figure shown illustrates the effect of different concentrations of recombinant type III collagen on the relative cell proliferation rate. Figure 4 It can be seen that when recombinant type III collagen FR4 and HF2 at concentrations of 0.25 g / L, 0.5 g / L, and 1 g / L were added respectively, the cell proliferation rate was significantly increased. This indicates that the recombinant type III collagen FR4 and HF2 prepared in this invention have the effect of promoting cell proliferation, are non-cytotoxic, and have good safety, and can be used in the preparation and use of skin care products.

[0036] Experimental Example 2 Antioxidant evaluation of recombinant type III collagen FR4 and HF2: DPPH free radical scavenging experiment: Recombinant type III collagen FR4 and recombinant type III collagen HF2 prepared in Example 1 and Comparative Example 1 were used as experimental groups, and commercially available humanized type III collagen solution was used as the control group. Sample concentrations of 0.5, 1, 2, 3, and 4 mg / mL of recombinant humanized collagen FR4, HF2, and commercially available humanized type III collagen solution were prepared. The DPPH free radical scavenging rate was detected using a commercially available DPPH free radical scavenging ability kit. The DPPH free radical scavenging rate was calculated using the following formula: DPPH free radical scavenging rate % = [(A0-Ax) / A0] × 100%, where A0 is the absorbance of the blank control group (containing only DPPH solution and solvent, without sample), and Ax is the absorbance of the sample group (absorbance after the DPPH solution reacts with the sample). The test results are shown below. Figure 5 As shown.

[0037] Figure 5 The DPPH free radical scavenging rate of recombinant type III collagen FR4 and HF2. Figure 5 It is evident that the DPPH free radical scavenging rate of the recombinant type III collagen FR4 prepared by this invention is higher than that of commercially available humanized type III collagen, which has almost no antioxidant properties. This indicates that the recombinant type III collagen FR4 provided by this invention has a significant antioxidant effect, and its active ingredients can be used as high-quality antioxidant ingredients in cosmetics, with anti-aging effects.

[0038] Experimental Example 3 Skincare product efficacy test: A skincare product comprising the following ingredients in weight percentages: 5% recombinant type III collagen, 5% glycerin, 2% butylene glycol, 3% caprylic / capric triglyceride, 1.5% PEG-100 stearate, 2% potassium cetyl phosphate, 0.5% vitamin E, 0.05% sodium hyaluronate, with the balance being deionized water.

[0039] The skincare products prepared by adding recombinant type III collagen FR4 from Example 1 and recombinant type III collagen HF2 from Comparative Example 1 were tested for their skin elasticity-enhancing effects. The specific process is as follows: Forty women aged 35-45 with aging skin were randomly divided into two groups of 20 each. Each group used skincare products prepared from recombinant type III collagen FR4 and HF2 (Example 1 and Comparative Example 1, respectively). Before each application of the skincare products, the face was washed with water twice daily, morning and evening, for four weeks. Skin elasticity was measured using an ElastiMeter. The skin elasticity of the cheek area was measured after 28 days, and the average value for each group was calculated. The percentage improvement in skin elasticity after 28 days of use is shown in Table 6.

[0040] Table 6 Improvement in Skin Elasticity As shown in Table 6, compared with Comparative Example 1, the skincare product prepared from recombinant type III collagen FR4 in Example 1 significantly improves skin elasticity. This indicates that recombinant type III collagen FR4 can promote the absorption of collagen in the skin and has a significant effect on improving skin elasticity.

[0041] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention, and not to limit them. The basic principles and main features of the present invention have been described above with specific implementation schemes. Based on the present invention, some modifications or substitutions can be made, but these modifications or substitutions do not cause the essence of the corresponding technical solutions to deviate from the scope of protection claimed by the present invention.

Claims

1. A recombinant collagen type III having an antioxidant effect, characterized by, The amino acid sequence of the recombinant collagen type III is shown as SEQ ID NO.

1.

2. The recombinant collagen type III according to claim 1, having antioxidant efficacy, wherein, The nucleotide sequence encoding the recombinant collagen type III is shown as SEQ ID NO.

2.

3. A method for preparing recombinant type III collagen with antioxidant effects according to claim 1 or 2, characterized in that, The method comprises the following steps: (1) connecting the nucleotide sequence encoding the recombinant collagen type III having antioxidant effect with a vector to obtain a recombinant plasmid; (2) transferring the recombinant plasmid obtained in step (1) into a competent cell, and inducing expression by IPTG to obtain a bacterial precipitate; (3) separating and purifying the bacterial precipitate obtained in step (2) to obtain the recombinant collagen type III having antioxidant effect.

4. The method for preparing recombinant type III collagen with antioxidant effects according to claim 3, characterized in that, The specific operation of step (1) is as follows: S1. splicing the effective sequence of human collagen type III to obtain the amino acid sequence SEQ ID NO. 1 of the recombinant collagen type III; S2. designing the gene sequence in reverse according to the amino acid sequence SEQ ID NO. 1 of the recombinant collagen type III, and performing codon optimization to obtain the nucleotide sequence SEQ ID NO. 2 encoding the recombinant collagen type III; S3. designing the upstream and downstream primers of the corresponding nucleotide sequence of the recombinant collagen type III according to the nucleotide sequence SEQ ID NO. 2 obtained in step S2, cloning the recombinant collagen nucleotide sequence amplified by the primers into a pET30a vector, and constructing a recombinant plasmid.

5. The method for preparing recombinant type III collagen with antioxidant effects according to claim 3, characterized in that, In step (2), the competent cell is E. coli BL21 (DE3), the concentration of the IPTG for inducing expression is 0.3-0.6 mM, and the time for inducing expression of the IPTG is 5-7 h.

6. The method for preparing recombinant type III collagen with antioxidant effects according to claim 3, characterized in that, In step (3), the separation and purification is performed by any one or several of chromatography, ion exchange chromatography, and affinity chromatography.

7. Use of the recombinant collagen type III having antioxidant effect according to claim 1 or 2 in the preparation of skin care products.

Images